Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

Hinweis: Diese Methode wurde in der Forschung Artikel berichtet in Medler, S und Ansari, A. 2 verwendet. 1. Die Anzucht und Ernte der Zellen <ol><li> Starten einer 5 ml - Kultur von Zellen in YPD - Medium (10 g / L Hefeextrakt, 20 g / l Pepton, 2% Dextrose) von einer frisch ausgestrichenen Platte Saccharomyces cerevisiae. </li><li> Wachsen die Zellen über Nacht in einem Orbitalschüttler bei 30 ° C und 250 Umdrehungen pro Minute. </li><li> Verdünnen Sie die über Nacht gewachsenen Kultur 100-mal auf ein endgültiges Volumen von 100 ml in YPD-Medium in einem 250 ml Schikanekolben. HINWEIS: Es wurden insgesamt 100 ml Kultur pro TRO Reaktion benötigt; Wenn mehrere Reaktionen benötigt werden, muss ein größeres Volumen der Kultur verwendet werden. </li><li> Wachsen die Zellen bis zu einer optischen Dichte von 0,8-1,0 bei 600 nm (A 600 ~ 0,8-1,0). </li><li> Ernte der Zellen durch Zentrifugation bei 820 xg für 5 min bei 4 ° C in einem sterilen 50 ml konischen Röhrchen. </li><li> Resuspendieren der Zellen in 10 ml eiskaltem TMN buffer (10 mM Tris-HCl pH 7,5, 5 mM MgCl 2, 100 mM NaCl) gegeben und 5 min auf Eis inkubieren. </li><li> Zentrifuge bei 820 × g für 5 min bei 4 ° C um die Zellen zu pelletieren. Entfernen Sie vorsichtig den Überstand durch Absaugen. </li></ol> 2. permeabilisierend und Vorbereitung Zellen für die Run-on-Test <ol><li> Resuspendieren der Zellen in 1 ml 0,6% Sarkosyl Lösung durch Auf- und Abpipettieren sanft ein verkürztes P 1000 Spitze verwenden. Übertragen die Zellsuspension auf eine gekühlte 1,5 ml Mikrozentrifugenröhrchen. </li><li> Schütteln, um die Zellen vorsichtig bei 4 ° C für 25 min auf einem Plattformschüttler. HINWEIS: Reaktionsgefäße sollten mit Eis in einem 50 ml konischen Röhrchen verpackt werden, um eine kalte Temperatur zu halten, was die Möglichkeit einer neuen Einleitung Ereignisse zu vermeiden an den Promotor in diesem Stadium auftreten. </li><li> Zentrifugieren der Zellen bei 1200 × g für 6 Minuten bei 4 ° C einer Tischkühlzentrifuge verwendet wird. </li><li> Den Überstand vorsichtig absaugen überschüssige Flüssigkeit aus dem pro entfernenmeabilized Zellpellet. </li></ol> 3. Die Transkription Run-on-Reaktion <ol><li> Zugabe von 150 &amp; mgr; l Transkriptions run-on - Puffer (50 mM Tris-HCl pH 7,5, 100 mM KCl, 10 mM MgCl 2, 2 mM DTT (Dithiothreit), 0,75 mM jeweils von ATP, CTP, GTP und BrUTP, 200 U RNase Inhibitor) auf die permeabilisierten Zellpellet. </li><li> Vorsichtig mischen durch Pipettieren nach oben und unten ein verkürztes P 200 Spitze mit. HINWEIS: Wenn mehrere Proben verarbeiten, alles auf Eis zu halten, bis alle Proben fertig sind und dann mit dem nächsten Schritt fortfahren. </li><li> Inkubieren für 5 min bei 30 ° C in einem Wasserbad. HINWEIS: Stellen Sie die Zeit der Inkubation zwischen 1 bis 5 min optimale Einbindung von BrUTP in die im Entstehen begriffenen RNA zu gewährleisten. </li><li> Die Reaktion durch Zugabe von 500 &amp; mgr; l kaltem ready-to-use-RNA-Isolierung Reagenz. Inkubieren für 5 min bei Raumtemperatur. </li></ol> 4. RNA-Extraktion <ol><li> In 200 ul Säure gewaschenen Glasperlen in die Zelle Schutzsperreauf (3.4 Schritt), und in einem Vortex-Mischer bei 4 ° C für 20 min kräftig schütteln. </li><li> Stechen Sie den Boden des Mikrozentrifugenröhrchen eine heiße 22 G-Nadel und legen Sie es auf der Spitze eines 15-ml sterilen konischen Röhrchen. </li><li> Zentrifuge bei 300 × g für 1 min bei 4 ° C, um das Zelllysat zu sammeln. Übertragen das Zelllysat in ein 1,5 ml Mikrozentrifugenröhrchen. </li><li> Hinzufügen 500 ul kaltem RNA Isolation Reagenz und 200 &amp; mgr; l Chloroform zu dem Zelllysat. Mischen Sie den Inhalt auf einem Vortex-Mixer und Zentrifuge bei 16.168 xg für 20 min bei 4 ° C. </li><li> Übertragen Sie die obere wässrige Phase in ein neues Mikrozentrifugenröhrchen. </li><li> Ein gleiches Volumen von kaltem Phenol / Chloroform / Isoamylalkohol (125: 24: 1) pH 4-5. Kräftig schütteln auf einem Vortex-Mischer und Zentrifuge bei 16.168 × g für 15 min bei 4 ° C. </li><li> Übertragen Sie die obere wässrige Phase, die RNA auf ein neues Mikrozentrifugenröhrchen. Wiederholen Sie Schritt 4.6 zwei weitere Male. </li><li> Um die endgültige RNA-haltige wässrige Phase, fügen 5 M NaCl stock eine Endkonzentration von 0,3 M zu erhalten, das Volumen von kaltem Ethanol In 3 mal die RNA auszufällen. <ol><li> Inkubieren für 1 h oder über Nacht bei -20 ° C. HINWEIS: Führen Sie die Schritte 4,9-4,11, während die Anti-BrdU-Perlen zum Blockieren inkubiert werden (siehe Schritt 5.3). </li></ol></li><li> Zentrifuge bei 16.168 xg für 20 min bei 4 ° C. Entfernen Sie den Überstand und resuspendieren RNA-Pellet in 100 ul DEPC (Diethylpyrocarbonat) Wasser. </li><li> Verwenden Sie eine RNA-Isolierung Mini-Kit, um die RNA aus den unincorporated BrUTP Nukleotide zu trennen. Eluieren der RNA von der Säule mit 100 &amp; mgr; l RNase-freiem Wasser. </li><li> Inkubieren Sie die RNA in einem 65 ° C Wasserbad für 5 min und dann übertragen auf Eis für mindestens 2 min. </li></ol> 5. Affinitätsreinigung von BrUTP-markierten RNA <ol><li> Bis 25 &amp; mgr; l Anti-BrdU besiedelt beads, 500 &amp; mgr; l 0,25x SSPE (Natrium Saline Phosphate EDTA) Bindungspuffer (20x SSPE: 3 M NaCl, 0,2 M NaH 2 PO 4 </sub&gt;, 0,02 M EDTA, pH 7,4, 1 mM EDTA, 0,05% Tween, 37,5 mM NaCl). Zentrifuge bei 200 × g für 30 s bei 4 ° C und entfernt den Überstand. </li><li> Wiederholen Sie Schritt 5.1 dreimal. </li><li> In 500 l Blocking-Puffer (1x Bindungspuffer, 0,1% Polyvinylpyrrolidon, 1 mg ultrareinem Rinderserumalbumin (BSA)) zu den Perlen und leicht schütteln mit 1 - 2 h bei 4 ° C auf einem Plattformschüttler. </li><li> Waschen der Kügelchen zweimal mit 500 ul Bindungspuffer, wie in Schritt 5.1 beschrieben. </li><li> In 400 &amp; mgr; l Bindungspuffer an die Kügelchen. </li><li> Transfer von 100 &amp; mgr; l RNA (aus Schritt 4.11) direkt an die Kügelchen. Inkubiere unter leichtem Schütteln für 1 - bei 4 ° C 2 h auf einem Plattformschüttler. </li><li> Waschen der Kügelchen nacheinander mit 500 ul Bindungspuffer, 500 &amp; mgr; l Puffer mit niedrigem Salz (0,2X SSPE, 1 mM EDTA, 0,05% Tween), 500 ul Hochsalzpuffer (0,25x SSPE, 1 mM EDTA, 0,05% Tween, 100 mM NaCl) und zweimal mit 500 ul TET-Puffer (1x TE, 0,05% Tween), Verspinnen bei200 xg für 30 s bei 4 ° C zwischen jedem Waschen. </li><li> Eluieren die BrUTP-markierte RNA aus Perlen nacheinander zweimal mit 150 &amp; mgr; l und einmal mit 200 &amp; mgr; l Elutionspuffer (20 mM DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7,5, 1 mM EDTA, 0,1% SDS), durch Inkubieren für 4 min bei 42 ° C in einem Wasserbad mit einer kurzen Spin gefolgt Perlen von dem Überstand zu trennen. </li></ol> 6. Fällung von BrUTP Beschriftete RNA <ol><li> Fügen 500 ul kaltem Phenol / Chloroform / Isoamylalkohol (125: 24: 1) pH 4 - 5 an den affinitätsgereinigten BrUTP markierte RNA. Mit Hilfe eines Vortex-Mixer und Zentrifuge bei 16.168 × g für 15 min bei 4 ° C. </li><li> Übertragen Sie die obere wässrige Phase in ein neues Mikrozentrifugenröhrchen. </li><li> Zugabe von 5 M NaCl Lager um eine Endkonzentration von 0,3 M und 3-fachen Volumen von kaltem Ethanol zu erhalten, die RNA auszufällen. </li><li> Inkubieren bei -20 ° C über Nacht. </li><li> Sammeln des ausgefällten RNA durch Zentrifugation bei 16.168 xg für 30 min bei 4 ° C. &lt;/ Li&gt; <li> Entfernen Sie den Überstand und lassen Sie das Pellet an der Luft trocknen für 10 min. </li><li> Resuspendieren RNA-Pellet in 26 &amp; mgr; l DEPC-Wasser. </li><li> Bestimmen die endgültige RNA-Konzentration durch Absorption bei 260 nm unter Verwendung eines Spektrophotometers gemessen wird. Außerdem bestimmen die 260/280 Verhältnis. Ein Verhältnis ~ 2 ist kennzeichnend für eine reine RNA Probe. </li><li> Speichern die RNA-Proben in Aliquots bei -80 ° C bis zur cDNA-Synthese benötigt wird. </li></ol> 7. reverse Transkription von BrUTP markierte RNA <ol><li> Stellen Sie die RNA-Konzentration auf 100 ng / &amp; mgr; l mit DEPC Wasser. Verwenden Sie 0,5 ug RNA für jede cDNA-Synthesereaktion. HINWEIS: Die Konzentration der RNA-Matrize 0,5 bis 1,0 &amp; mgr; g variieren kann optimal cDNA-Synthese zu erreichen. </li><li> Reverse Transkription der RNA unter Verwendung von mehreren Rückwärtsprimer konstruiert stromabwärts des Poly (A) -Stelle (Terminationsstelle) , wie in 3A gezeigt. </li><li> Zu jeder reverse Transkriptionsreaktion, fügen Sie 5 ul RNA template (0,5 ug), 1 ul dNTP - Mix (jeweils 10 mM), 2 &amp; mgr; l reverse Primer C, D, E, F oder G (50 &amp; mgr; M jeweils) und nukleasefreiem Wasser (siehe 3A). Das endgültige Reaktionsvolumen in jedem Röhrchen 13 &amp; mgr; l. HINWEIS: Die Anzahl der reversen Transkriptionsreaktionen werden für die cDNA-Synthese verwendet, von der Anzahl der Rückwärtsprimer abhängen. Zum Beispiel für ASC1 fünf Reverse - Primer verwendet wurden und daher fünf Reverse Transkriptionsreaktionen wurden eingerichtet. Beschriften der Rohre als C, D, E, F und G auf der Basis der Reverse-Primer für die cDNA-Synthese verwendet. </li><li> Inkubieren der Röhrchen RNA-Matrize, dNTP-Mix und Primern in einem Thermocycler bei 65 ° C für 5 min mit einer beliebigen sekundären strukturellen Konformation zu entfernen, und dann Abkühlen auf 4 ° C für mindestens 2 min. </li><li> 1 ul reverse Transkriptase (200 U / &amp; mgr; l), 4 &amp; mgr; l Puffer und 2 ul 0,1 M DTT in jedes Röhrchen, enthaltend die RNA-Matrize und Primer (Schritt 7.4). Mix von sanft bis Pipettieren und ab. </li><li> Führen der reversen Transkription, indem die Reaktionsmischung in einem Thermocycler bei 42 ° C inkubiert für 60 min. </li><li> Inaktivierung der reversen Transkriptase bei 65 ° C für 20 min. </li><li> Lagern Sie die cDNA bei -20 ° C oder fahren Sie mit dem nächsten Schritt. </li></ol> 8. Amplification of cDNA <ol><li> Führen Sie die PCR - Reaktion zur Amplifikation von jeder cDNA - Präparation ( mit der Bezeichnung C, D, E, F und G für ASC1) aus Schritt 7.8 wie folgt: 3,0 &amp; mgr; l cDNA - Matrize aus Schritt 7.8 und 1.0 &amp; mgr; l Vorwärts - Primer B (10 &amp; mgr; M), 1,0 &amp; mgr; l Rückwärtsprimer C oder D oder E oder F oder G (10 uM), 2,5 ul 10x - Polymerase PCR - Puffer, 0,5 ul dNTP - Mix (jeweils 10 mM), 1,0 &amp; mgr; l MgCl 2 (2,5 mM) 15,5 &amp; mgr; l PCR-Wasser, und 0,5 ul thermostabile Polymerase-Enzym. HINWEIS: Verschiedene Verdünnungen von cDNA-Matrize im Bereich von 1: 5 bis 1: 100 getestet werden sollte, die PCR Produktausbeute zu optimieren. Ein einzelner Promotor-proximalen Vorwärts-Primer werden verwendet, um cDNA zu verstärkenmit verschiedenen Reverse-Primer erhalten. So wurde beispielsweise für ASC1 in Kombination mit fünf Rückwärtsprimer von C bis G ein einziger Vorwärtsprimer B in der Nähe des Promotors verwendet. BC, BD, BE, BF und BG in Rohren als C, D, E, F und G jeweils gekennzeichnet sind, verwendet wurden , wie in 3A gezeigt. </li><li> Führen Sie die PCR die folgenden thermischen Zyklus Parametern: 1 Zyklus 95 ° C für 2 min (Hot-Start für die Aktivierung der Polymerase), 30 - 40 Zyklen 95 ° C für 30 s (Denaturierung), 54 ° C für 15 s (Annealing) , 68 ° C für 1 min (Verlängerung) und 1 Zyklus 68 ° C für 5 min (final Extension). HINWEIS: Die Glühtemperatur auf den spezifischen Primern variieren je verwendet wird und die Verlängerungszeit in Abhängigkeit von der erwarteten Produktgröße variieren. </li><li> Trenne die PCR-Produkts durch Elektrophorese auf 0,8%, 1,5% bzw. 2% Agarose-Gelen auf der erwarteten Größe des Produkts abhängig. </li><li> Quantifizierung der PCR - Produkt wie in El Kaderi et al. 2012 11. HINWEIS: Alternativ können Sie Echtzeit-RT-qPCR-Strategie die Menge der im Entstehen begriffenen Transkripte zu quantifizieren. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

Die strangspezifischen TRO hier verwendete Protokoll wurde aus dem Protokoll für GRO-Seq (Global Run On-Sequenzierung) Analyse in Säugetierzellen 12 verwendet angepasst. Wir modifizierten erfolgreich das Protokoll in Bäckerhefe im Entstehen begriffenen Transkription zu studieren. Um insbesondere die Transkriptionsterminierungs Defekt zu analysieren, passten wir das Protokoll weiter, indem sie von der RNA-Hydrolyse Schritt befreien. Dies ermöglichte es uns, um speziell die volle Länge im Ents...

Die eukaryotischen Transkription Zyklus besteht aus drei Hauptschritten; Initiation, Elongation und Termination. Die Beendigung der Transkription durch RNA - Polymerase II besteht aus zwei verschiedenen, voneinander abhängigen Schritten 3. Der erste Schritt beinhaltet die Spaltung, die Polyadenylierung und die Freisetzung von mRNA aus der Vorlage, und wird sofort durch den zweiten Schritt, gekennzeichnet durch Ausrücken der Polymerase aus der Vorlage. Ordnungsgemäße Beendigung ist entscheidend für die Wiederverwertung der Polymerase während der Initiierung / Reinitiierung der Transkription, für eine Interferenz mit der Transkription der nachgeschalteten Gene zu verhindern, und für aberrant Transkription unter Kontrolle zu halten , indem die Transkription des Begrenzens pervasive nicht-codierende RNA 4, 5. Trotz der jüngsten Fortschritte ist Kündigung bei weitem am wenigsten verstandenen Schritt der RNA-Polymerase II Transkriptionszyklus. Eine zuverlässige Abschlusstest ist von wesentlicher Bedeutung für die Untersuchung des Mechanismus Sekundärmarkg Termination der Transkription durch RNA - Polymerase II in vivo. Eine Reihe von experimentellen Ansätze werden verwendet, um die Beendigung Defekt in einem aktiv transkribierten Gen unter physiologischen Bedingungen zu erfassen. Dazu zählen Northern Blot, Terminationsfaktor ChIP (Chromatin Immunopräzipitation) und die traditionelle TRO-Test. Jede dieser Techniken haben einige Vorteile und Nachteile. Die traditionelle TRO - Assay verwendet werden , um verlässliche und sensibles Vorgehen zum Nachweis eines Transkriptionsterminierungs Defekt in vivo 1. Dieser Assay lokalisiert die transkriptionell aktive Polymerase-Moleküle auf den verschiedenen Regionen eines Gens in der Zelle. Unter normalen Bedingungen zeigt der Assay transkriptionell Eingriff Polymerasemoleküle streng zwischen dem Promotor und Terminator - Region des Gens (1A) verteilt. Nach Beendigung defekte, jedoch ist die Polymerase nicht in der Lage das Beendigungssignal zu lesen,und in dem Bereich stromabwärts des 3&#39; - Endes des Gens (1B) detektiert. Eine Transkriptions - Terminationssequenz Defekt in Gegenwart eines Sinnes Transkribieren Polymerase manifestiert , die aus der Promotor-proximalen Bereich eingeleitet, und nicht in der Lage das Beendigungssignal zu lesen, setzt die Region stromabwärts von dem 3&#39; - Ende eines Gens transkribiert , wie in Abbildung gezeigt 2A. Mit der Erkenntnis , dass die eukaryotische Genom es überwältigend Pervasive Transkription in Sinn sowie Antisense - Richtungen in und um ein Gen , 6, 7, 8, 9, 10, wurde bald klar zeigt , dass die traditionelle TRO - Test nicht , wenn die Polymerase - Signal erkennen kann stromabwärts eines Gens stellt einen Promotor initiierte Transkript (2A) oder eine anomale RNA , die som initiiertewhere in der Mitte des Gens , oder stromabwärts des Terminators Element (2B) oder der Polymerase - Transkription in der anti-sense - Richtung vom 3&#39; - Ende des Gens (Figur 2C). Die strangspezifischen TRO-Assay unter Verwendung BrUTP hier beschriebenen unterscheiden, wenn die beobachtete Überlesen Polymerase Signal Promotor initiierte erweiterten Sinne mRNA oder ein Antisense-Transkript darstellt, die stromabwärts des Gens unter Prüfung eingeleitet. Wir haben diesen Ansatz erfolgreich verwendet in Bäckerhefe 2 die Rolle der Kin28 Kinase in Termination der Transkription zu demonstrieren. Der Einsatz der Ansatz hier zeigen wir , dass Rna14 für die Beendigung der Transkription von ASC1 in Bäckerhefe erforderlich ist.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

Dieses Manuskript beschreibt ein Protokoll Transkriptionsterminierungs Defekt in vivo zu erkennen. Die strangspezifischen TRO-Protokoll BrUTP hier beschrieben ist eine leistungsfähige experimentelle Ansatz für die Transkriptionsterminierungs Defekt unter physiologischen Bedingungen zu analysieren. Wie das traditionelle TRO - Assay beruht auf der Gegenwart einer transkriptionell aktiven Polymerase über das 3&#39; - Ende des Gens als ein Indikator für eine Transkriptions - Terminationssequenz Defekt 1. Es überwindet zwei große Probleme mit dem traditionellen TRO-Test festgestellt. Erstens kann sie erkennen, ob der Polymerase durch das Endsignal liest die ist, die Transkription von dem Promotor-proximalen initiiert Region oder wenn es einfach ist, die eine pervasively Transkribieren Polymerase, die unspezifisch von irgendwo in dem Körper eingeleitet bzw. das 3&#39; Ende des Gens. Zweitens kann es zu unterscheiden, ob die transcriptionsaktive Polymerase-Signal über dieTerminatorregion ist wirklich die Readthrough Sense-mRNA transkribiert Polymerase oder ein Terminator-initiierte nicht-codierende anti-sense RNA-Signal. Kurz gesagt umfasst das Protokoll die exponentiell wachsenden Hefezellen durchdringbar, so dass die Transkripte , die in Gegenwart des BrUTP Nukleotid zu verlängern in vivo initiierten BrUTP-markierte RNA durch die Affinität Ansatz Reinigung in umgekehrter gereinigter naszierende RNA und Amplifizieren der cDNA unter Verwendung Transkribieren strangspezifischen Primern den Promotor und die Terminator - Regionen des 2 - Gens flankieren.

Um die Anwendbarkeit des BrUTP strangspezifische TRO Verfahren bei der Erkennung eines Transkriptionsterminierungs Defekt zeigen, haben wir eine Beendigung-defekt, temperaturempfindliche Mutante von RNA14 rna14-1 genannt. Die Rolle der Rna14 in Beendigung der Transkription durch RNA - Polymerase II wurde mit der traditionellen TRO - Test gezeigt , dass RNA in der Terminator-proximalen Bereich ausgewählter Gene 1 nachgewiesen. Der Nachweis von RN...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

Die Analyse der Beendigung der Transkription unter Verwendung von BrUTP strangspezifische Transkription Run-on (TRO) Ansatz

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.7K Aufrufe.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Serie: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

In - vitro - Transkriptionsassays und ihre Anwendung in der Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Forschung

Genetik

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

Metagenomanalyse von Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

Die Analyse der Feinstaub in der Luft-induzierte Chromosomenaberrationen Mit Hilfe eines<em&gt; In Vitro</em&gt; System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Analyse des c-KIT-Liganden-Promotors unter Verwendung von Chromatin-Immunpräzipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Bestimmung der optimalen chromosomalen Speicherorte für eine DNA-Element in Escherichia coli mit einem neuartigen Transposon-vermittelte Ansatz

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Echtzeit-Analyse des Transkriptionsfaktors verbindlich, Transkription, Übersetzung und Umsatz, globale Ereignisse während der zellulären Aktivierung anzuzeigen

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Genomweite Überwachung der Übertragungsfehler in Eukaryonten

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Ein neuartiger Sättigung Mutagenese Ansatz: Einzelschritt Charakterisierung der regulatorischen Protein Bindungsstellen im RNA mit Phosphorthioate

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Reverse Transkription-Loop-vermittelten Isothermen Verstärkung (RT-Lampe) Assay für Zika-Virus und Housekeeping-Gene in Urin, Serum und Moskito-Proben

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

Bestimmende 3'-Termini und Sequenzen der im Entstehen begriffenen einsträngige virale DNA-Moleküle während HIV-1 Reverse Transkription in infizierten Zellen

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...