Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

NOTA: Questo metodo è stato utilizzato nell&#39;articolo ricerca riportata nel Medler, S e Ansari, A. 2. 1. la coltura e la raccolta delle cellule <ol><li> Avviare una cultura 5 mL di cellule in terreno YPD (estratto di 10 g / L di lievito, 20 g / L peptone, 2% di destrosio) da una piastra di Saccharomyces cerevisiae appena striato. </li><li> Far crescere le cellule durante la notte in un agitatore orbitale a 30 ° C e 250 rpm. </li><li> Diluire la coltura cresciuta overnight 100 orari ad un volume finale di 100 ml in mezzo YPD in un pallone da 250 mL confuso. NOTA: E &#39;necessario un totale di 100 ml di coltura per reazione TRO; se sono necessari più reazioni, deve essere utilizzato un volume maggiore di cultura. </li><li> Far crescere le cellule ad una densità ottica pari a 0,8 - 1,0 in 600 nm (A 600 ~ 0,8 - 1.0). </li><li> Raccogliere le cellule per centrifugazione a 820 xg per 5 minuti a 4 ° C in un contenitore sterile tubo da 50 ml. </li><li> Risospendere le cellule in 10 ml di ghiaccio freddo bu TMNffer (10 mM Tris-HCl pH 7,5, 5 mM MgCl 2, 100 mM NaCl) e incubare in ghiaccio per 5 min. </li><li> Centrifugare a 820 xg per 5 minuti a 4 ° C per sedimentare le cellule. Rimuovere delicatamente il surnatante tramite aspirazione. </li></ol> 2. permeabilizzante e preparare cellule per Run-on Assay <ol><li> Risospendere le cellule in 1 ml di soluzione Sarkosyl 0,6% pipettando su e giù delicatamente con un tronco di P 1000 punta. Trasferire la sospensione cellulare ad una refrigerata 1,5 ml provetta. </li><li> Agitare gentilmente le cellule a 4 ° C per 25 minuti su un agitatore piattaforma. NOTA: i tubi microcentrifuga devono essere imballati in una provetta da 50 ml con ghiaccio per mantenere una temperatura fredda, evitando possibilità di eventuali nuovi eventi di iniziazione che si verificano al promotore in questa fase. </li><li> Centrifugare le cellule a 1200 xg per 6 minuti a 4 ° C usando un tavolo refrigerata centrifuga. </li><li> Aspirare delicatamente il surnatante per rimuovere il liquido in eccesso dal alpellet cellulare meabilized. </li></ol> 3. Trascrizione Run-on Reaction <ol><li> Aggiungere 150 ml di trascrizione di run-in di buffer (50 mM Tris-HCl pH 7.5, 100 mM KCl, 10 mM MgCl 2, 2 mM DTT (ditiotreitolo), 0,75 mm ciascuno di ATP, CTP, GTP, e BrUTP, 200 U RNAsi inibitore) al pellet di cellule permeabilizzate. </li><li> Mescolare delicatamente pipettando su e giù con un tronco di P 200 punta. NOTA: Se l&#39;elaborazione di più campioni, tenere tutto in ghiaccio fino a quando tutti i campioni sono pronti e quindi procedere alla fase successiva. </li><li> Incubare per 5 minuti a 30 ° C in un bagno d&#39;acqua. NOTA: Regolare il tempo di incubazione tra 1 e 5 min per assicurare integrazione ottimale del BrUTP nel RNA nascente. </li><li> Arrestare la reazione aggiungendo 500 ml di freddo reagente isolamento RNA pronto per l&#39;uso. Incubare per 5 minuti a temperatura ambiente. </li></ol> 4. RNA Estrazione <ol><li> Aggiungere 200 ml di perline di vetro lavata con acido al suspensi cellularesu (passo 3,4), e agitare vigorosamente per 20 minuti a 4 ° C in un vortex. </li><li> Forare il fondo della provetta utilizzando un 22 G ago caldo e posizionarlo sulla parte superiore di un tubo conico sterile da 15 ml. </li><li> Centrifugare a 300 xg per 1 min a 4 ° C per raccogliere il lisato cellulare. Trasferire il lisato cellulare di una provetta da microcentrifuga da 1,5. </li><li> Aggiungere 500 ml di RNA freddo reagente isolamento e 200 ml di cloroformio al lisato cellulare. Mescolare il contenuto su un vortex e centrifugare a 16.168 xg per 20 minuti a 4 ° C. </li><li> Trasferire la fase acquosa superiore ad una nuova provetta. </li><li> Aggiungere un volume uguale di fenolo freddo / cloroformio / alcool isoamilico (125: 24: 1) pH 4-5. Agitare vigorosamente su un vortex e centrifugare a 16.168 xg per 15 min a 4 ° C. </li><li> Trasferire la fase acquosa contenente RNA superiore ad una nuova provetta. Ripetere il punto 4.6 altre due volte. </li><li> Per la fase acquosa finale di RNA contenenti, aggiungere 5 M NaCl stock per ottenere una concentrazione finale di 0,3 M. Aggiungere 3 volte la quantità in volume di etanolo freddo per precipitare l&#39;RNA. <ol><li> Incubare per 1 ora o durante la notte a -20 ° C. NOTA: Eseguire le operazioni da 4.9 - 4.11, mentre le perle anti-BrdU vengono incubate per bloccare (vedi punto 5.3). </li></ol></li><li> Centrifugare a 16.168 xg per 20 min a 4 ° C. Rimuovere il surnatante e risospendere il pellet di RNA in 100 ml di acqua DEPC (dietilpirocarbonato). </li><li> Utilizzare un isolamento mini kit di RNA per separare l&#39;RNA dai nucleotidi BrUTP prive di personalità giuridica. Eluire l&#39;RNA dalla colonna con 100 ml di acqua RNasi-free. </li><li> Incubare l&#39;RNA in un bagno d&#39;acqua a 65 ° C per 5 minuti e poi trasferire in ghiaccio per almeno 2 min. </li></ol> 5. Affinità Purificazione di RNA BrUTP marcato <ol><li> Per 25 ml di anti-BrdU stabilì perline, aggiungere 500 ml di 0,25x SSPE (sodio fosfato salino EDTA) tampone di legame (20x PESS: 3 M di NaCl, 0,2 M NaH 2 PO 4 </sub&gt;, 0,02 M EDTA, pH 7,4, 1 mM EDTA, 0,05% Tween, 37,5 mM NaCl). Centrifugare a 200 xg per 30 s a 4 ° C e rimuovere il surnatante. </li><li> Ripetere il passaggio 5.1 tre volte. </li><li> Aggiungere 500 ml di tampone di bloccaggio (1x Binding Buffer, 0.1% polivinilpirrolidone, 1 mg di ultra-puri albumina sierica bovina (BSA)) per le perline e agitare delicatamente per 1 - 2 ore a 4 ° C su un agitatore piattaforma. </li><li> Lavare le perline altre due volte con 500 ml di tampone di legame, come descritto al punto 5.1. </li><li> Aggiungere 400 ml di Binding Buffer ai talloni. </li><li> Trasferire 100 ml di RNA (dal punto 4.11) direttamente ai talloni. Incubare con delicata agitazione per 1 - 2 ore a 4 ° C su un agitatore piattaforma. </li><li> Lavare le perline in sequenza con 500 ml di tampone di legame, 500 ml di tampone basso contenuto di sale (0.2x PESS, 1 mM EDTA, 0.05% Tween), 500 ml di tampone di sale (0,25x PESS, 1 mM EDTA, 0,05% di Tween, 100 mM NaCl), e due volte con 500 ml di buffer di TET (1x TE, 0,05% di Tween), filatura a200 xg per 30 s a 4 ° C tra ogni lavaggio. </li><li> Eluire l&#39;RNA BrUTP marcato da perline in sequenza, due volte con 150 microlitri e una volta con 200 ml di tampone di eluizione (20 mM DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7,5, 1 mM EDTA, 0,1% SDS), incubando per 4 min a 42 ° C in un bagno di acqua seguita da una breve centrifuga per separare perline dal surnatante. </li></ol> 6. Precipitazione di RNA BrUTP Labeled <ol><li> Aggiungere 500 ml di freddo fenolo / cloroformio / alcool isoamilico (125: 24: 1) pH 4-5 per l&#39;affinità purificato BrUTP etichettati RNA. Miscelare su vortex e centrifugare a 16.168 xg per 15 min a 4 ° C. </li><li> Trasferire la fase acquosa superiore ad una nuova provetta. </li><li> Aggiungere 5 M NaCl magazzino per ottenere una concentrazione finale di 0,3 M e 3 volte il volume di etanolo freddo per precipitare l&#39;RNA. </li><li> Incubare a -20 ° C per una notte. </li><li> Raccogliere il RNA precipitato per centrifugazione a 16.168 xg per 30 min a 4 ° C. &lt;/ Li&gt; <li> Rimuovere il surnatante e consentire il pellet asciugare all&#39;aria per 10 min. </li><li> Risospendere il pellet di RNA in 26 ml di acqua DEPC. </li><li> Determinare la concentrazione di RNA finale misurando l&#39;assorbanza a 260 nm utilizzando uno spettrofotometro. Inoltre, determinare il rapporto di 260/280. Un rapporto ~ 2 è indicativa di un campione di RNA puro. </li><li> Conservare i campioni di RNA in aliquote a -80 ° C fino al momento della sintesi del DNA. </li></ol> 7. trascrizione inversa di RNA BrUTP marcato <ol><li> Regolare la concentrazione di RNA a 100 ng / ml con acqua DEPC. Utilizzare 0,5 mg di RNA per ogni reazione di sintesi del DNA. NOTA: La concentrazione di template di RNA può variare da 0,5 a 1.0 mg per ottenere sintesi ottimale cDNA. </li><li> Reverse trascrivere l&#39;RNA utilizzando più primer inversa disegnati a valle del sito (sito di terminazione) poli (A) come mostrato nella figura 3A. </li><li> Per ogni reazione di trascrizione inversa, aggiungere 5 ml di RNA template (0,5 mg), 1 dNTP mix microlitri (10 mM ciascuno), 2 ml di primer reverse C, D, E, F o G (50 pM ciascuno) (vedere la Figura 3A) e acqua priva di nucleasi. Il volume finale di reazione in ciascuna provetta è di 13 microlitri. NOTA: Il numero di reazioni di trascrizione inversa dipenderà dal numero di primer inversi utilizzati per la sintesi di cDNA. Ad esempio, per ASC1 cinque primer inverso sono stati utilizzati e quindi cinque reazioni trascrizione inversa sono stati istituiti. Etichettare i tubi come C, D, E, F e G sulla base del primer reverse utilizzato per la sintesi di cDNA. </li><li> Incubare le provette contenenti RNA template, miscela dNTP e primer in un termociclatore a 65 ° C per 5 minuti per rimuovere ogni conformazione strutturale secondaria, e poi raffreddare a 4 ° C per almeno 2 min. </li><li> Aggiungere 1 ml trascrittasi (200 U / mL) invertono, 4 microlitri di buffer e 2 ml di 0,1 M DTT in ogni provetta contenente il modello di RNA e innesco (passo 7,4). Mescolare pipettando gentilmente su e giù. </li><li> Eseguire trascrizione inversa incubando la miscela di reazione in un termociclatore a 42 ° C per 60 min. </li><li> Inattivare i trascrittasi inversa a 65 ° C per 20 min. </li><li> Conservare il cDNA a -20 ° C o procedere al passo successivo. </li></ol> 8. amplificazione di cDNA <ol><li> Eseguire la reazione di PCR per l&#39;amplificazione di ciascun preparato cDNA (etichettata C, D, E, F e G per ASC1) dal punto 7.8 come segue: template 3,0 microlitri di cDNA dal punto 7.8, 1.0 ml forward primer B (10 mM), 1,0 microlitri inversa Primer C o 10x polimerasi tampone D o e o F o G (10 micron), 2,5 microlitri PCR, 0,5 microlitri miscela dNTP (10 mm ciascuno), 1,0 ml MgCl 2 (2,5 mm), 15,5 acqua di grado microlitri PCR, e 0,5 microlitri termostabile polimerasi dell&#39;enzima. NOTA: diverse diluizioni di cDNA che va da 1: 5 a 1: 100 dovrebbero essere testati per ottimizzare la resa del prodotto di PCR. Un primer forward singolo promotore-prossimale sarà utilizzato per amplificare il cDNAottenuta utilizzando diversi inneschi inversa. Ad esempio, un singolo innesco B avanti situato vicino il promotore è stato usato in combinazione con cinque primer inversi da C a G per ASC1. BC, BD, BE, BF e BG sono stati usati in provette etichettate rispettivamente come C, D, E, F e G, come mostrato nella Figura 3A. </li><li> Eseguire la PCR utilizzando i seguenti parametri ciclo termico: 1 ciclo di 95 ° C per 2 min (hot start per l&#39;attivazione della polimerasi), 30 - 40 cicli a 95 ° C per 30 s (denaturazione), 54 ° C per 15 s (ricottura) , 68 ° C per 1 min (estensione) e 1 ciclo a 68 ° C per 5 min (estensione finale). NOTA: La temperatura di ricottura può variare a seconda delle primers specifici utilizzati e il tempo di estensione varia a seconda delle dimensioni del prodotto atteso. </li><li> Separare il prodotto di PCR mediante elettroforesi su 0,8%, 1,5%, o 2 gel di agarosio% a seconda della dimensione prevista del prodotto. </li><li> Quantificare il prodotto di PCR come descritto in El Kaderi et al. , 2012 11. NOTA: In alternativa, utilizzare strategia in tempo reale RT-qPCR per quantificare la quantità di trascritti nascenti. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

Il protocollo specifica TRO-filo usato qui è stato adattato dal protocollo utilizzato per GRO-Seq (Global Run On-Sequencing) analisi in cellule di mammifero 12. Abbiamo modificato con successo il protocollo di studiare la trascrizione nascente in erba lievito. Per analizzare in particolare il difetto di terminazione della trascrizione, abbiamo regolato il protocollo ulteriormente per sbarazzarsi della fase di RNA idrolisi. Questo ci ha permesso di rilevare in particolare la lunghezza trascrizion...

Il ciclo di trascrizione eucariotica si compone di tre fasi principali; iniziazione, l&#39;allungamento e la terminazione. La terminazione della trascrizione da parte della RNA polimerasi II è costituito da due distinte fasi, interdipendenti 3. Il primo passo prevede la scissione, poliadenilazione e il rilascio di mRNA dal modello, ed è immediatamente seguita dalla seconda fase, segnata dal disimpegno della polimerasi dal modello. La corretta terminazione è di fondamentale importanza per il riciclaggio della polimerasi durante l&#39;iniziazione / ripresa della trascrizione, per evitare l&#39;interferenza con la trascrizione dei geni a valle, e per mantenere la trascrizione aberranti sotto controllo limitando trascrizione di pervasiva non codificante RNA 4, 5. Nonostante i recenti progressi, la risoluzione è di gran lunga il meno passo capito del ciclo di trascrizione RNA polimerasi II. Un test terminazione affidabile è essenziale per studiare il meccanismo underlying terminazione della trascrizione da parte della RNA polimerasi II in vivo. Un certo numero di approcci sperimentali sono utilizzati per rilevare il difetto di terminazione in un gene trascrizione attivamente in condizioni fisiologiche. Questi includono Northern blot, fattore di terminazione Chip (immunoprecipitazione della cromatina) e il saggio TRO tradizionale. Ognuna di queste tecniche hanno alcuni vantaggi e svantaggi. Il saggio TRO tradizionali utilizzati per essere l&#39;approccio più affidabile e sensibile per la rilevazione di un difetto di terminazione della trascrizione in vivo 1. Questo test localizza le molecole polimerasi trascrizionalmente attivi su diverse regioni di un gene all&#39;interno della cella. In condizioni normali, il saggio dimostra molecole polimerasi trascrizionalmente impegnati rigorosamente distribuiti tra la regione promotore e terminatore del gene (Figura 1A). Alla cessazione difettoso, tuttavia, la polimerasi è in grado di leggere il segnale di terminazionee viene rilevato nella regione a valle del &#39;fine del gene (Figura 1B) 3. Un difetto terminazione della trascrizione si manifesta in presenza di una polimerasi di senso trascrizione che ha avviato dalla regione promotore-prossimale, ed essere in grado di leggere il segnale di terminazione, continua trascrivere la regione a valle della estremità 3 &#39;di un gene, come mostrato in figura 2A. Con la realizzazione che il genoma eucariotico presenta schiacciante trascrizione diffusa in senso così come le direzioni anti-senso e intorno a un gene 6, 7, 8, 9, 10, divenne presto chiaro che il saggio TRO tradizionale non può rilevare se il segnale polimerasi a valle di un gene rappresenta una trascrizione promotore-avviata (Figura 2A) o un RNA aberrante che ha avviato somewhere nel mezzo del gene oa valle dell&#39;elemento terminatore (Figura 2B), o la trascrizione polimerasi in direzione anti-senso dall&#39;estremità 3 &#39;del gene (Figura 2C). Il dosaggio specifico TRO-strand utilizzando BrUTP qui descritto può distinguere se il segnale polimerasi translettura osservato rappresenta promotore-avviato mRNA senso esteso o un trascritto antisenso che ha avviato valle del gene in esame. Abbiamo utilizzato con successo questo approccio per dimostrare il ruolo delle chinasi Kin28 a cessazione della trascrizione in erba di lievito 2. Utilizzando l&#39;approccio qui dimostriamo che Rna14 è necessario per la terminazione della trascrizione di ASC1 in erba lievito.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Phenol -chloroform-isoamyl alcohol mixture</td>
			<td>Sigma-Aldrich</td>
			<td>77619</td>
			<td>pH 4-5</td>
		</tr>
		<tr>
			<td>TRIzol reagent</td>
			<td>Life technologies</td>
			<td>15596-026</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase Inhibitor, human placenta</td>
			<td>New England Biolabs</td>
			<td>M0307S</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-BrdU beads</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-32323AC</td>
			<td></td>
		</tr>
		<tr>
			<td>Protoscript II</td>
			<td>New England Biolabs</td>
			<td>M03368L</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>Advantage 2 polymerase Mix</td>
			<td>Clontech</td>
			<td>639201</td>
			<td>or an equivalent enzyme</td>
		</tr>
		<tr>
			<td>5-Bromouridine 5&#39; triphosphate sodium salt</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-214314A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>Qiagen</td>
			<td>74104</td>
			<td></td>
		</tr>
		<tr>
			<td>ATP</td>
			<td>New England Biolabs</td>
			<td>N0451AA</td>
			<td></td>
		</tr>
		<tr>
			<td>CTP</td>
			<td></td>
			<td>N0454AA</td>
			<td></td>
		</tr>
		<tr>
			<td>GTP</td>
			<td></td>
			<td>N0452AA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultra-pure bovine serum albumin (BSA)</td>
			<td>MC Labs</td>
			<td>UBSA-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Asc1 B</td>
			<td></td>
			<td></td>
			<td>AGATTCGTCGGTCACAAGTCC</td>
		</tr>
		<tr>
			<td>Asc1 C</td>
			<td></td>
			<td></td>
			<td>GAACTTTATACATATTCTTAGTT 
			AGCAGTC</td>
		</tr>
		<tr>
			<td>Asc1 D</td>
			<td></td>
			<td></td>
			<td>TGTACATATGTATTTTCGCAGCA</td>
		</tr>
		<tr>
			<td>Asc1 E</td>
			<td></td>
			<td></td>
			<td>GCCAAGGAGACTGAATTTAATG</td>
		</tr>
		<tr>
			<td>Asc1 F</td>
			<td></td>
			<td></td>
			<td>CTATGGAATGGGGGTTTTAAG</td>
		</tr>
		<tr>
			<td>Asc1 G</td>
			<td></td>
			<td></td>
			<td>GGTTATGGCAGACATGCCAC</td>
		</tr>
		<tr>
			<td>5s cDNA</td>
			<td></td>
			<td></td>
			<td>AGATTGCAGCACCTGAGT</td>
		</tr>
		<tr>
			<td>5&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>GGTTGCGGCCATATCTAC</td>
		</tr>
		<tr>
			<td>3&#8217; 5s reverse</td>
			<td></td>
			<td></td>
			<td>TGAGTTTCGCGTATGGTC</td>
		</tr>
	</tbody>
</table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

Questo manoscritto descrive un protocollo per rilevare difetti trascrizione terminazione in vivo. Il protocollo TRO specifico filamento utilizzando BrUTP qui descritto è un potente approccio sperimentale per analizzare il difetto di terminazione della trascrizione in condizioni fisiologiche. Come il dosaggio TRO tradizionale, si basa sulla presenza di una polimerasi trascrizionalmente attivo oltre all&#39;estremità 3 &#39;del gene come indicatore di trascrizione terminazione difetti 1. Supera due principali problemi incontrati con il test TRO tradizionale. In primo luogo, esso può rilevare se la polimerasi lettura attraverso il segnale di terminazione è quello che ha avviato la trascrizione dal promotore-prossimale, o se è semplicemente rappresentando una polimerasi diffusamente trascrizione che ha avviato non specificamente da qualche nel corpo o 3 &#39; fine del gene. In secondo luogo, può distinguere se il segnale polimerasi trascrizionalmente attivo oltre laregione terminatore è veramente il translettura polimerasi senso mRNA di trascrizione o un segnale di RNA anti-senso non codificante terminator-iniziati. Brevemente, il protocollo prevede permeabilizzante le cellule di lievito in crescita esponenziale, permettendo ai trascritti che avviati in vivo di allungare in presenza del nucleotide BrUTP, purificare RNA BrUTP marcato dall&#39;approccio affinità, trascrizione inversa del RNA nascente purificato e amplificando il cDNA usando primer specifici filamento che fiancheggiano il promotore e le regioni di terminazione del gene 2.

Per dimostrare l&#39;applicabilità della procedura TRO BrUTP-strand-specifica nel rilevare un difetto di terminazione della trascrizione, abbiamo utilizzato un mutante sensibile alla temperatura di cessazione difettoso di RNA14 chiamato rna14-1. Il ruolo di Rna14 in cessazione di trascrizione di RNA polimerasi II è stata dimostrata con il saggio TRO tradizionale che ha rilevato l&#39;RNA nella regione Terminator-prossimale di geni selezionati 1.</sup...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

Analisi di terminazione della trascrizione Utilizzando BrUTP-strand-specifici Trascrizione Run-on (TRO) Approccio

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.7K Views.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

In vitro trascrizione saggi e la loro applicazione in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Ricerca

Genetica

Metagenomic Analysis of Silage

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of the microbial communities present within them. Two main metagenomic approaches exist; sequencing the 16S rRNA gene coding region, which exhibits sufficient variation between taxa for identification, and shotgun sequencing, in which genomes of the organisms that are present in the sample are analyzed and ascribed to "operational taxonomic units"; species, genera or families depending on the extent of sequencing coverage. 
In this study, shotgun sequencing was used to analyze the microbial community present in cattle silage and, coupled with a range of bioinformatics tools to quality check and filter the DNA sequence reads, perform taxonomic classification of the microbial populations present within the sampled silage, and achieve functional annotation of the sequences. These methods were employed to identify potentially harmful bacteria that existed within the silage, an indication of silage spoilage. If spoiled silage is not remediated, then upon ingestion it could be potentially fatal to the livestock.

Metagenomics was used to investigate the microbiome of silage cattle feed. Analysis was performed by shotgun sequencing. This approach was used to characterize the composition of the microbial community within the cattle feed.

L&#39;analisi metagenomica di insilato

Metagenomics is defined as the direct analysis of deoxyribonucleic acid (DNA) purified from environmental samples and enables taxonomic identification of ...

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. To assess the impact of PM on nuclear genetic integrity, structural chromosomal aberrations are scored in the metaphase spreads of mouse RAW264.7 macrophage cells. PM is collected from ambient air with a high volume total suspended particles sampler. The collected material is solubilized and filtered to retain the water-soluble, fine portion. The particles are characterized for chemical composition by nuclear magnetic resonance (NMR) spectroscopy. Different concentrations of particle suspension are added onto an in vitro culture of RAW264.7 mouse macrophages for a total exposure time of 72 hr, along with untreated control cells. At the end of exposure, the culture is treated with colcemid to arrest cells in metaphase. Cells are then harvested, treated with hypotonic solution, fixed in acetomethanol, dropped onto glass slides and finally stained with Giemsa solution. Slides are examined to assess the structural chromosomal aberrations (CAs) in metaphase spreads at 1,000X magnification using a bright-field microscope. 50 to 100 metaphase spread are scored for each treatment group. This technique is adapted for the detection of structural chromosomal aberrations (CAs), such as chromatid-type breaks, chromatid-type exchanges, acentric fragments, dicentric and ring chromosomes, double minutes, endoreduplication, and Robertsonian translocations in vitro after exposure to PM. It is a powerful method to associate a well-established cytogenetic endpoint to epigenetic alterations.

Analysis of the Ambient Particulate Matter-induced Chromosomal Aberrations Using an In Vitro System

This protocol describes techniques for the quantification and characterization of chromosomal aberrations in vitro in RAW264.7 mouse macrophages after treatment with ambient air particulate matter.

L&#39;analisi del particolato ambientale indotto aberrazioni cromosomiche L&#39;utilizzo di un<em&gt; In Vitro</em&gt; sistema

Exposure to particulate matter (PM) is a major world health concern, which may damage various cellular components, including the nuclear genetic material. ...

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Analisi del promotore di ligandi di c-KIT utilizzando l&#39;immunoprecipitazione cromatina

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Determinazione dei percorsi cromosomici ottimali per un elemento di DNA in Escherichia coli usando un approccio novello Transposon-mediata

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

In tempo reale analisi del fattore di trascrizione associazione, trascrizione, traduzione e fatturato per visualizzare eventi globali durante l'attivazione cellulare

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

Sorveglianza di genoma di errori di trascrizione in organismi eucarioti

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

A Novel Saturation Mutagenesis Approach: Single Step Characterization of Regulatory Protein Binding Sites in RNA Using Phosphorothioates

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to control gene expression. These regulatory proteins control gene expression either at the level of DNA (transcription) or at the level of RNA (pre-mRNA splicing, polyadenylation, mRNA transport, decay, and translation). Identification of regulatory sequences helps understand not only how a gene is switched on or off, but also which downstream genes are regulated by a particular regulatory protein. Here, we describe a one-step approach that allows saturation mutagenesis of a protein binding site in RNA. It involves doping DNA template with non-wild-type nucleotides within the binding site, synthesis of separate RNAs with each phosphorothioate nucleotide, and isolation of the bound fraction following incubation with protein. Interference from non-wild-type nucleotides results in their preferential exclusion from the protein-bound fraction. This is monitored by gel electrophoresis following selective chemical cleavage with iodine of phosphodiester bonds containing phosphorothioates (phosphorothioate mutagenesis or PTM). This single-step saturation mutagenesis approach is applicable to the characterization of any protein binding site in RNA.

Proteins that bind specific RNA sequences play critical roles in gene expression. Detailed characterization of these binding sites is crucial for our understanding of gene regulation. Here, a single-step approach for saturation mutagenesis of protein-binding sites in RNA is described. This approach is relevant for all protein-binding sites in RNA.

Un approccio di mutagenesi romanzo saturazione: Unico passaggio caratterizzazione della proteina regolatrice siti in RNA usando fosforotioati di legame

Gene regulation plays an important role in development. Numerous DNA- and RNA-binding proteins bind their target sequences with high specificity to ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Invertire l'amplificazione isotermica mediata da Loop-trascrizione (RT-LAMP) analisi per Virus di Zika e geni Housekeeping in urina, siero ed esempi di zanzara

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

Sequenze di molecole nascente Single-Stranded DNA virale durante HIV-1 e 3'-Termini determinante retrotrascrizione in cellule infettate

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...