We acknowledge the lab of Prof. Joris Winderickx, who provided the UV crosslinking apparatus equipped with the conventional UV lamp. K. G. is supported by the KU Leuven research fund and acknowledges support from FWO grant G065713N.

The authors have nothing to disclose.

We successfully applied mRNA interactome capture, developed for yeast and human cells, to plant leaf mesophyll protoplasts. Leaf mesophyll cells are the major type of ground tissue in plant leaves. The major advantage of this method is that it uses in vivo crosslinking to discover the proteins from a physiological environment.
In this protocol, we mainly present a number of optimized experimental conditions (e.g., the number of protoplasts to use as starting material and the duration of UV irradiation)50. The captured proteins in the CL samples can only be detected by SDS-PAGE and silver staining when a minimum of 107 protoplasts (medium-scale) is used (step 1.5.5). Lower concentrations do not yield an observable mRBP pattern on SDS-PAGE and should probably not be used for further analysis by proteomics. Indeed, using more than 107 cells (e.g., 109 in a large-scale experiment) is also possible20. Results from silver-staining assays suggest that UV irradiation for 1 min with 0.00875 W/cm2 of intensity generated by a continuous-wave UV source is optimal (Figure 1D). High efficiency at the critical step (i.e., mRNP pull-down and purification by oligo-d(T)25 beads, step 4) is supported by the results of the RT-qPCR, silver-staining, and MS assays (Figure 1C; 1D; and 1E, right). The combination of qualitative and quantitative proteomics can help to identify the positive RBPs in the overlap region between non-CL control and CL samples (Figure 1E). The majority of identified proteins were RBPs not previously annotated in datasets (Figure 1F). We presented these previously unknown RNA-binding proteins in category III as candidate RBPs50 (Figure 1F). Exploring the binding specificities of these candidate RBPs must be done using other methods, such as the previously mentioned CLIP methods23. One example that investigates the binding specificity of an RBP to regulate its target mRNA transcript in Arabidopsis through the use of CLIP51 can be found in Zhang et al., 2015. In addition, an alternative modified method from PAR-CLIP, called photoactivatable-ribonucleoside-enhanced crosslinking (PAR-CL, 365-nm UV-A) has also been previously recommended for the investigation of mRNA-bound proteomes from yeast and human cells14,23. PAR-CL requires 4Su, which is taken up by cells and incorporated into nascent RNAs during RNA metabolism and can be highly reactive, forming covalent bonds with amino acids52 under UV-A (365-nm) irradiation. Currently, there are no studies focusing on the toxicity of 4sU to the plant cells and the efficient uptake of exogenous 4sU into mesophyll protoplasts53. However, we believe that it will become possible to use both conventional CL (254-nm UV-C) and PAR-CL (365 nm UV-A) on plants, which will contribute to the discovery and validation of diverse RBPs from the physiological environment in the future.

Eukaryotes use multiple RNA biogenesis regulatory pathways to maintain cellular biological processes. Among the known types of RNA, mRNA is very diverse and carries the coding capacity of proteins and their isoforms1.The PTGR pathway directs the fates of pre-mRNAs2,3. RBPs from different gene families control the regulation of RNA, and in PTGR, specific mRBPs guide mRNAs through direct physical interactions, forming functional mRNPs. Therefore, identifying and characterizing mRBPs and their mRNPs is critical to understanding the regulation of cellular mRNA metabolism2.Over the past three decades, various in vitro methods &#8211; including RNA electrophoretic mobility shift (REMSA) assays, systematic evolution of ligands by exponential enrichment assays (SELEX) based on library-derived constructs, RNA Bind-n-Seq (RBNS), radiolabeled or quantitative fluorescence RNA binding assays, X-ray crystallography, and NMR spectroscopy4,5,6,7,8,9 &#8211; have been widely applied to studies of RBPs, mainly from mammalian cells. The results of these studies of mammalian RBPs can be searched via the RNA-binding Protein DataBase (RBPDB), which collects the published observations10.
Although these in vitro approaches are powerful tools, they determine the bound RNA motifs from a given RNA pool of sequences and therefore are limited in their ability to discover new target RNAs. The same is true for computational strategies to predict genome-wide RBPs, which are based on the conservation of protein sequence and structure15. To overcome this, a new experimental method has been established that allows for the identification of the RNA motifs that an RBP of interest interacts with, as well as for the determination of the precise location of binding. This method, called &#34;crosslinking and immunoprecipitation&#34; (CLIP), is composed of in vivo UV crosslinking followed by immunoprecipitation11. Early studies have shown that photoactivation of DNA and RNA nucleotides can occur at excitation UV wavelengths greater than 245 nm. The reaction through thymidine seems to be favored (rank in order of decreased photoreactivity: dT &#8805; dC &#62; rU &#62; rC, dA, dG)12. Using UV light with a wavelength of 254 nm (UV-C), it was observed that covalent bonds between RNA nucleotides and protein residues are created when in the range of only a few Angstroms (&#197;). The phenomenon is therefore called the &#34;zero-length&#34; crosslinking of RNA and RBP. This can be followed by a stringent purification procedure with little background13,14.
A strategy complementary to CLIP is to combine in vivo UV crosslinking with protein identification to describe the landscape of RBPs. A number of such genome-wide mRNA-bound proteomes have been isolated from yeast cells, embryonic stem cells (ESCs), and human cell lines (i.e., HEK293 and HeLa) using this novel experimental approach, called &#34;mRNA interactome capture&#34;18,19,20,21. The method is composed of in vivo UV crosslinking followed by mRNP purification and MS-based proteomics. By applying this strategy, many novel &#34;moonlighting&#34; RBPs containing non-canonical RBDs have been discovered, and it has become clear that more proteins have RNA-binding capacities than previously supposed15,16,17. The use of this method allows for new applications and for the ability to answer new biological questions when investigating RBPs. For example, a recent study has investigated the conservation of the mRNA-bound proteome (the core RBP proteome) between yeast and human cells22.
Plant RBPs have already been found to be involved in growth and development (e.g., in the post-transcriptional regulation of flowering time, the circadian clock, and gene expression in mitochondria and chloroplasts)24,25,26,27,28,29. Furthermore, they are thought to perform functions in the cellular processes responding to abiotic stresses (e.g., cold, drought, salinity, and abscisic acid (ABA))31,32,33,34. There are more than 200 predicted RBP genes in the Arabidopsis thaliana genome, based on RNA recognition motif (RRM) and K homology (KH) domain sequence motifs; in rice, approximately 250 have been noted35,36. It is notable that many predicted RBPs seem to be unique to plants (e.g., no metazoan orthologs to approximately 50% of predicted Arabidopsis RBPs containing an RRM domain)35, suggesting that many may serve new functions. The functions of most predicted RBPs remain uncharacterized23.
The isolation of mRNA-bound proteomes from Arabidopsis etiolated seedlings, leaf tissue, cultured root cells, and leaf mesophyll protoplasts through the use of mRNA interactome capture has recently been reported38,39. These studies demonstrate the strong potential of systematically cataloging functional RBPs in plants in the near future. Here, we present a protocol for mRNA interactome capture from plant protoplasts (i.e., cells without cell walls). Arabidopsis thaliana leaf mesophyll protoplasts are the major type of leaf cell. The isolated protoplasts allow optimal access of UV light to the cells. This cell type can be used in assays that transiently express proteins for functional characterization40,41. Furthermore, protoplasting has been applied to several other plant cell types and species42,43,44 (e.g., Petersson et al., 2009; Bargmann and Birnbaum, 2010; and Hong et al., 2012).
The method encompasses a total of 11 steps (Figure 1A). Arabidopsis leaf mesophyll protoplasts are first isolated (step 1) and are subsequently UV irradiated to form crosslinked mRNPs (step 2). When protoplasts are lysed under denaturing conditions (step 3), the crosslinked mRNPs are released in lysis/binding buffer and pulled down by oligo-d(T)25 beads (step 4). After several rounds of stringent washes, the mRNPs are purified and further analyzed. The denatured peptides of mRBPs are digested by proteinase K before the crosslinked mRNAs are purified and the RNA quality is verified by qRT-PCR (steps 5 and 6). After RNase treatment and protein concentration (step 7), the protein quality is controlled by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and silver staining (step 8). The difference in protein band patterns can easily be visualized between a crosslinked sample (CL) and a non-crosslinked sample (non-CL; the negative control sample from protoplasts that is not subjected to UV irradiation). The identification of proteins is achieved through MS-based proteomics. The proteins from the CL sample are separated by one-dimensional polyacrylamide gel electrophoresis (1D-PAGE) to remove possible background contamination, are &#34;in-gel digested&#34; into short peptides using trypsin, and are purified (step 9). Nano reverse-phase liquid chromatography coupled to mass spectrometry (nano-LC-MS) allows for the determination of the amount of definitive proteins in the mRNA-bound proteome (step 10). Finally, the identified mRBPs are characterized and cataloged using bioinformatic analysis (step 11).

<table>
	<tbody>
		<tr>
			<td colspan="4">REAGENTS</td>
		</tr>
		<tr>
			<td>0.8 M Mannitol</td>
			<td>Sigma</td>
			<td>M1902-500G</td>
			<td>Primary isotonic Enzyme solution &#38; 
			MMg solution</td>
		</tr>
		<tr>
			<td>2M KCl</td>
			<td>MERCK</td>
			<td>Art. 4935</td>
			<td>Primary isotonic Enzyme solution &#38; 
			W5 buffer</td>
		</tr>
		<tr>
			<td>0.2 M MES (pH 5.7) 
			(4-morpholineethanesulfonic acid)</td>
			<td>Sigma-aldrich</td>
			<td>M2933</td>
			<td>Primary isotonic Enzyme solution, 
			W5 buffer &#38; 
			MMg solution, 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>Cellulase R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>CELLULASE 
			&#8220;ONOZUKA&#8221; 
			R-10, 10 g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Macerozyme R10</td>
			<td>Yakult Pharmaceutical Industry Co., Ltd.</td>
			<td>MACEROZYME R-10, 10g</td>
			<td>Final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>10% (w/v) BSA 
			(Bovine Serum Albumin)</td>
			<td>Sigma-aldrich</td>
			<td>A7906-100G</td>
			<td>Final isotonic enzyme solution &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M CaCl2</td>
			<td>Chem-Lab NV</td>
			<td>CL00.0317.1000</td>
			<td>Final isotonic enzyme solution, 
			W5 buffer &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>1M NaCl</td>
			<td>Fisher Chemical</td>
			<td>S/3160/60</td>
			<td>W5 buffer</td>
		</tr>
		<tr>
			<td>2M MgCl2</td>
			<td>Sigma</td>
			<td>M8266-100G</td>
			<td>MMg solution</td>
		</tr>
		<tr>
			<td>1M LiCl 
			(Lithium Chloride)</td>
			<td>Acros</td>
			<td>199885000</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2 &#38; 
			Low salt buffer</td>
		</tr>
		<tr>
			<td>5% (w/v) LiDS 
			(Lithium Dodecyl Sulphate)</td>
			<td>Sigma-aldrich</td>
			<td>L4632-25G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1 &#38; 
			Filtration sterilization</td>
		</tr>
		<tr>
			<td>1M DTT 
			(Dithiothreitol)</td>
			<td>Thermo Fisher Scientific 
			Wash buffer 1 &#38; 
			Wash buffer 2</td>
			<td>307866</td>
			<td>Lysis/binding buffer,</td>
		</tr>
		<tr>
			<td>1M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td>
			<td>Acros &#38; 
			Fisher Chemical</td>
			<td>167620010 &#38; 
			H/1200/PB15</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>ED-500G</td>
			<td>Lysis/binding buffer, 
			Wash buffer 1, 
			Wash buffer 2, 
			Low salt buffer &#38; 
			Elution buffer</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>MERCK</td>
			<td>8.22184.0500</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>0.1 M NaOH</td>
			<td>VWR PROLABO CHEMICALS</td>
			<td>28244.295</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>1X PBS (pH 7.4) 
			(Phosphate Buffered Saline) 
			containing 
			(NaCl; KCl; Na2HPO4; KH2PO4)</td>
			<td>Fisher Chemical, MERCK, 
			Sigma-aldrich &#38; SAFC</td>
			<td>S/3160/60, 
			Art. 4935, 
			71640-250G &#38; 
			60230</td>
			<td>Regeneration of oligo-d(T)25 beads</td>
		</tr>
		<tr>
			<td>Proteinase K solution (2 &#956;g/&#956;L)</td>
			<td>Thermo Fisher Scientific</td>
			<td>11789020</td>
			<td>Protein digestion</td>
		</tr>
		<tr>
			<td>Loading dye</td>
			<td>Invitrogen</td>
			<td>LC5925</td>
			<td>SDS-PAGE</td>
		</tr>
		<tr>
			<td>qPCR master mix</td>
			<td>Promega</td>
			<td>A6001</td>
			<td>qRT-PCR assay</td>
		</tr>
		<tr>
			<td>RNase Cocktail</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM2286</td>
			<td>RNA digestion</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Sigma-aldrich</td>
			<td>322415</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Sigma-aldrich</td>
			<td>537020</td>
			<td>Gel fixation and gel destaining</td>
		</tr>
		<tr>
			<td>Coomassie Brilliant Blue R-250</td>
			<td>Thermo Fisher Scientific</td>
			<td>20278</td>
			<td>Gel staining</td>
		</tr>
		<tr>
			<td>1M NH4HCO3 
			(Ammonium bicarbonate) 
			&#160;</td>
			<td>Sigma-aldrich</td>
			<td>09830-500G</td>
			<td>Gel hydration &#38; 
			Digestion buffer</td>
		</tr>
		<tr>
			<td>CH3CN 
			(Acetonitrile)</td>
			<td>Sigma-aldrich</td>
			<td>34851-100ML</td>
			<td>Gel dehydration &#38; 
			Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>IAA 
			(Iodoacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>I4386-10G</td>
			<td>Alkylating agent</td>
		</tr>
		<tr>
			<td>TFA 
			(Trifluoroacetic acid)</td>
			<td>Sigma-aldrich</td>
			<td>302031-10X1ML</td>
			<td>Peptide dissolving solution</td>
		</tr>
		<tr>
			<td>FA 
			(Formic acid)</td>
			<td>Sigma-aldrich</td>
			<td>06554-5G</td>
			<td>Peptide extraction</td>
		</tr>
		<tr>
			<td>Trypsin solution (6 ng/&#956;L)</td>
			<td>Promega</td>
			<td>V5280</td>
			<td>Digestion buffer</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td colspan="4">EQUIPMENT</td>
		</tr>
		<tr>
			<td>Soil</td>
			<td>Peltracom</td>
			<td>LP2D</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Vermiculite 3</td>
			<td>Sibli AS</td>
			<td>05VERMICULIET</td>
			<td>Plant growth</td>
		</tr>
		<tr>
			<td>Petri dish (150 x 20 mm)</td>
			<td>Sarstedt</td>
			<td>82.1184.500</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>0.22 &#956;m filter</td>
			<td>Millipore</td>
			<td>SE2M229104</td>
			<td>Homogenization of final isotonic enzyme solution</td>
		</tr>
		<tr>
			<td>Razorblade</td>
			<td>Agar Scientific</td>
			<td>T585</td>
			<td>Rosette leaf strips</td>
		</tr>
		<tr>
			<td>35-75 &#956;m nylon mesh</td>
			<td>SEFAR NITEX</td>
			<td>74010</td>
			<td>Protoplast suspension filtration</td>
		</tr>
		<tr>
			<td>50 mL round bottom tubes</td>
			<td>Sigma-aldrich</td>
			<td>T1918-10EA</td>
			<td>Carrier for protoplast suspension</td>
		</tr>
		<tr>
			<td>Hemocytometer 
			(B&#252;rker hemocytometer)</td>
			<td>MARIENFELD</td>
			<td>650030</td>
			<td>Protoplast cell counting</td>
		</tr>
		<tr>
			<td>UV crosslinking apparatus 
			(HL-2000 HybriLinker)</td>
			<td>UVP, LLC</td>
			<td>UVP95003101</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>UV lamp 
			(Sankyo-Denki G8T5)</td>
			<td>SANKYO 
			DENKI</td>
			<td>SD G8T5</td>
			<td>in vivo UV crosslinking</td>
		</tr>
		<tr>
			<td>50 mL glass syringe</td>
			<td>FORTUNA Optima</td>
			<td>Z314560</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Narrow needle (0.9 x 25 mm)</td>
			<td>Becton Dickinson microlance 3</td>
			<td>2021-04</td>
			<td>Homogenization of protoplast lysate</td>
		</tr>
		<tr>
			<td>Rotator Model L26</td>
			<td>Labinco BV</td>
			<td>26110912</td>
			<td>Sample incubation by rotating</td>
		</tr>
		<tr>
			<td>Oligo-d(T)25 magnetic beads 
			(5 mg/mL)</td>
			<td>New England BioLabs</td>
			<td>S1419S</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Magnetic rack</td>
			<td>Invitrogen</td>
			<td>CS15000</td>
			<td>mRNPs and mRNAs binding and pull-down</td>
		</tr>
		<tr>
			<td>Centrifugal filter units 
			(Amicon Ultra-4 centrifugal filter units)</td>
			<td>EMD Millipore</td>
			<td>UFC800308</td>
			<td>mRBP concentration</td>
		</tr>
		<tr>
			<td>Pierce Silver Stain Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>24612</td>
			<td>Silver-staining assay</td>
		</tr>
		<tr>
			<td>RNA purification kit 
			(InviTrap Spin Plant RNA Mini Kit)</td>
			<td>STRATEC Molecular</td>
			<td>1064100300</td>
			<td>RNA purification</td>
		</tr>
		<tr>
			<td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-1000</td>
			<td>RNA quality and quantity</td>
		</tr>
		<tr>
			<td>Real-Time PCR cycler 
			(StepOne Real-Time PCR cycler)</td>
			<td>Thermo Fisher Scientific</td>
			<td>4376600</td>
			<td>cDNA quantification</td>
		</tr>
		<tr>
			<td>&#181;-C18 columns 
			(Millipore Zip Tip &#181;-C18 columns)</td>
			<td>Sigma-aldrich</td>
			<td>720046-960EA</td>
			<td>Peptide purification</td>
		</tr>
		<tr>
			<td>Mass spectrometer 
			(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td>
			<td>Thermo Fisher Scientific</td>
			<td>IQLAAEGAAPFALGMAZR</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ULTIM3000RSLCNANO</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 column 
			(Easy Spray Pepmap RSLC C18 column)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ES800</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>C18 precolumn 
			(Acclaim Pepmap 100 C18 precolumn)</td>
			<td>Thermo Fisher Scientific</td>
			<td>160321</td>
			<td>Mass spectrometry-based proteomics</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers for qRT-PCR assay</td>
			<td colspan="3">Sequences</td>
		</tr>
		<tr>
			<td>UBQ10 mRNA 
			(Li et al., 2014)</td>
			<td colspan="3">Fw: AACTTTGGTGGTTTGTGTTTTGG 
			Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td>
		</tr>
		<tr>
			<td>18S rRNA 
			(Durut et al., 2014)</td>
			<td colspan="3">Fw: CGTAGTTGAACCTTGGGATG 
			Rv: CACGACCCGGCCAATTA</td>
		</tr>
	</tbody>
</table>

mrna interactome capture from plant protoplasts

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called &#34;mRNA interactome capture,&#34; which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (107 cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (109 cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

We observed a characteristic halo, which surrounds the bead pellet in the CL sample, in wash step 4.3 with wash buffer 2 (Figure 1B). Although it has not been investigated, this phenomenon can probably be explained by the interference of crosslinked mRNP complexes with bead aggregation during the magnetic capture, causing a more diffuse aggregate to form. It indicates that the oligo-d(T)25 bead capture was effective14.
The significantly higher UBQ10 reference mRNA levels than 18S rRNA in both non-CL control and CL samples are shown in Figure 1C. This indicates that mRNAs are enriched in the eluent due to the capture by oligo-d(T)25 beads, which can only bind to poly(A)-tailed mRNAs. The efficiency of the oligo-d(T)25 bead capture was further supported by SDS-PAGE and silver staining (step 8), as shown in Figure 1D after RNase treatment and mRBP concentration (step 7). A difference in protein band pattern between non-CL control and CL sample lanes can clearly be observed, and the protein bands present in the non-CL control sample lane can be explained by the presence of RNase. This illustrates the strong enrichment of mRBPs in the CL sample.
The efficiency of crosslinking can be controlled by varying the time duration of UV irradiation. Sufficient crosslinking but the avoidance of protoplast damage and RNA degradation is optimal. In Figure 1D, specific protein band patterns in all CL samples were obtained when comparing different UV irradiation times (1, 3, and 5 min). Under the same UV intensity (0.00875 W/cm2), the most optimal conditions were found to be 1 or 3 min, due to the indistinguishable protein band intensities. Weaker band intensities were observed with the longer crosslinking time (5 min). We considered 1 min as the optimal condition because a shorter duration of crosslinking has the additional advantage of easier transfer and collection of protoplasts from the Petri dish. Protoplasts can be rapidly precipitated to the bottom of the Petri dish during UV irradiation because they stick to the dish bottom. This makes it more difficult to collect and transfer them to the tubes after longer UV irradiation duration.
Based on the optimized conditions, the identification of proteins from three biological replicates was subsequently achieved by qualitative and quantitative proteomics, which was described in steps 9 and 10. In the analysis by qualitative proteomics (Figure 1E, right), a total of 341 proteins were identified in CL samples, of which 36 were found both in non-CL control and CL samples, and only 8 proteins were detected in the non-CL control sample. This enormous difference in identified protein numbers between both samples is consistent with the different protein band patterns (Figure 1D), supporting the idea that the SDS-PAGE and silver-staining assay are good tools to validate the efficiency of oligo-d(T)25 bead capture. In the analysis by quantitative proteomics (Figure 1E, left), a total of 325 proteins (blue- and green-colored) showed a log2-fold change greater than 2. Among these proteins, 100 proteins (blue-colored) had small p-values above the significance level. Therefore, they were also defined as positive hits. It is notable that the p-values of another 225 proteins (green-colored) were greater than 0.05, below the significance level due to data sparsity. In other words, there were lowly abundant peptides present for each protein, with high variability of peptide intensities. However, because all of them were qualitatively detected only in CL samples, they were considered positive.
Based on the GO and InterPro databases50 (step 11), these 325 proteins were further classified into category I (ribosomal proteins), category II (main RBPs), and category III (candidate RBPs) (Figure 1F). There were 123 ribosomal proteins in category I, while in category II, 70 annotated classical RBPs were observed. These two categories&#8212;which contain most annotated proteins linking to molecular RNA binding and RNA biology (Figure 1F, right) and which occupy approximately 38% and 22% of the whole mRNA-bound proteome, respectively&#8212;indicate the high efficiency of optimized mRNA interactome capture. The last 40% (132 candidate RBPs) were classified in category III due to the lack of conventional RBDs. Furthermore, most of their roles in RNA binding and RNA biological processes have not been validated (Figure 1F, left). We suppose that proteins from this category could reveal novel functions in RNA regulations.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56011/56011fig1.jpg" /> 
Figure 1: Flowchart and Results of the Optimized Method for Discovering the mRNA-bound Proteome from Arabidopsis Leaf Mesophyll Protoplasts. (A) Major steps of the whole method are listed from 1 to 11. Putative cellular and molecular processes are illustrated by the photo and cartoons. Details for each step have been intensively described in the Protocol. (B) A halo was observed surrounding the beads pellet in the CL sample, but not in the non-CL control sample, during wash step 4.3. (C) Comparison of relative UBQ10 mRNA and 18S rRNA levels in non-CL control and CL samples by qRT-PCR (values are mean &#177; SD (n = 3); * and **: significant differences with p &#60;0.05 and &#60;0.01). (D) Concentrated protein eluent of non-CL control sample compared with CL samples irradiated by a continuous-wave UV source for 1, 3, and 5 min, with the UV intensity at 0.00875 W/cm2. (E) Identification of mRNA-bound proteome by proteomics. In the quantitative proteomics performed by the Progenesis software package (left), the volcano plot displays the average log2-fold changes (CL/non-CL) and the related adjusted p-values (-log10 (adj. p-values)) of all proteins. In the qualitative proteomics performed by the Peaks software package (right), the proteins in the samples are illustrated in Venn diagrams. The quantity of the proteins is listed in numbers. The FDR at the peptide and protein levels is below 5%. The numbers of proteins inside the light-brown frames are considered positive hits. (F) Classification of three categories from the mRNA-bound proteome. The quantity of identified proteins is listed in numbers in each category. Green-colored regions are annotated proteins linked to RNA binding, while blue-colored regions refer to annotated proteins linked to RNA biology. The blank region indicates proteins with unknown functions linked to RNA binding or RNA biology. All figures above were modified from Zhang et al., 2016. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56011/56011fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

mrna-interactome-capture-from-plant-protoplasts

Nanyang Technological University

Research

JoVE Journal

Biochemistry

9.0K Views.  KU Leuven. Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

Video: mRNA Interactome Capture from Plant Protoplasts

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Experimental Design for Laser Microdissection RNA-Seq: Lessons from an Analysis of Maize Leaf Development

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not detected or are not identified as differentially expressed (DE) in transcriptomic analyses of whole plant organs. Laser Microdissection RNA-Seq (LM RNA-Seq) is a powerful tool to identify genes that are DE in specific developmental domains. However, the choice of cellular domains to microdissect and compare, and the accuracy of the microdissections are crucial to the success of the experiments. Here, two examples illustrate design considerations for transcriptomics experiments; a LM RNA-seq analysis to identify genes that are DE along the maize leaf proximal-distal axis, and a second experiment to identify genes that are DE in liguleless1-R (lg1-R) mutants compared to wild-type. Key elements that contributed to the success of these experiments were detailed histological and in situ hybridization analyses of the region to be analyzed, selection of leaf primordia at equivalent developmental stages, the use of morphological landmarks to select regions for microdissection, and microdissection of precisely measured domains. This paper provides a detailed protocol for the analysis of developmental domains by LM RNA-Seq. The data presented here illustrate how the region selected for microdissection will affect the results obtained.

Many developmentally important genes have cell- or tissue-specific expression patterns. This paper describes LM RNA-seq experiments to identify genes that are differentially expressed at the maize leaf blade-sheath boundary and in lg1-R mutants compared to wild-type. The experimental considerations discussed here apply to transcriptomic analyses of other developmental phenomena.

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not ...

A Simple Fractionated Extraction Method for the Comprehensive Analysis of Metabolites, Lipids, and Proteins from a Single Sample

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually determined by transcriptomic, proteomic, metabolomics and lipidomic measurements. In this protocol, we introduce a simple method for the reproducible extraction of metabolites, lipids and proteins from biological tissues using a single aliquot per sample. The extraction method is based on a methyl tert-butyl ether: methanol: water system for liquid: liquid partitioning of hydrophobic and polar metabolites into two immiscible phases along with the precipitation of proteins and other macromolecules as a solid pellet. This method, therefore, provides three different fractions of specific molecular composition, which are fully compatible with common high throughput 'omics' technologies such as liquid chromatography (LC) or gas chromatography (GC) coupled to mass spectrometers. Even though the method was initially developed for the analysis of different plant tissue samples, it has proved to be fully compatible for the extraction and analysis of biological samples from systems as diverse as algae, insects, and mammalian tissues and cell cultures.

A protocol for comprehensive extraction of lipids, metabolites and proteins from biological tissues using one sample is presented.

Understanding of complex biological systems requires the measurement, analysis and integration of multiple compound classes of the living cell, usually ...

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from the oxidation of reduced compounds such as nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2). The complete annotation of the Arabidopsis thaliana genome has established it as the most widely used plant model system, and thus the need to purify mitochondria from a variety of organs (leaf, root, or flower) is necessary to fully utilize the tools that are now available for Arabidopsis to study mitochondrial biology. Mitochondria are isolated by homogenization of the tissue using a variety of approaches, followed by a series of differential centrifugation steps producing a crude mitochondrial pellet that is further purified using continuous colloidal density gradient centrifugation. The colloidal density material is subsequently removed by multiple centrifugation steps. Starting from 100 g of fresh leaf tissue, 2 - 3 mg of mitochondria can be routinely obtained. Respiratory experiments on these mitochondria display typical rates of 100 - 250 nmol O2 min-1 mg total mitochondrial protein-1 (NADH-dependent rate) with the ability to use various substrates and inhibitors to determine which substrates are being oxidized and the capacity of the alternative and cytochrome terminal oxidases. This protocol describes an isolation method of mitochondria from Arabidopsis thaliana leaves using continuous colloidal density gradients and an efficient respiratory measurements of purified plant mitochondria.

Isolation and Respiratory Measurements of Mitochondria from Arabidopsis thaliana

As mitochondria are only a small percentage of the plant cell, they need to be purified for a range of studies. Mitochondria can be isolated from a variety of plant organs by homogenization, followed by differential and density gradient centrifugation to obtain a highly purified mitochondrial fraction.

Mitochondria are essential organelles involved in numerous metabolic pathways in plants, most notably the production of adenosine triphosphate (ATP) from ...

Leaf Spray Mass Spectrometry: A Rapid Ambient Ionization Technique to Directly Assess Metabolites from Plant Tissues

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing plant metabolites because it provides molecular weights with high sensitivity and specificity. Leaf spray MS is an ambient ionization technique where plant tissue is used for direct chemical analysis via electrospray, eliminating chromatography from the process. This approach to sampling metabolites allows for a wide range of chemical classes to be detected simultaneously from intact plant tissues, minimizing the amount of sample preparation needed. When used with a high-resolution, accurate mass MS, leaf spray MS facilitates the rapid detection of metabolites of interest. It is also possible to collect tandem mass fragmentation data with this technique to facilitate a compound identification. The combination of accurate mass measurements and fragmentation is beneficial in confirming compound identities. The leaf spray MS technique requires only minor modifications to a nanospray ionization source and is a useful tool to further expand the capabilities of a mass spectrometer. Here, fresh leaf tissue from Sceletium tortuosum (Aizoaceae), a traditional medicinal plant from South Africa, is analyzed; numerous mesembrine alkaloids are detected with leaf spray MS.

Leaf spray mass spectrometry is a direct chemical analysis technique that minimizes the sample preparation and eliminates chromatography, allowing for the rapid detection of small molecules from plant tissues.

Plants produce thousands of small molecules that are diverse in their chemical properties. Mass spectrometry (MS) is a powerful technique for analyzing ...

Caffeine Extraction, Enzymatic Activity and Gene Expression of Caffeine Synthase from Plant Cell Suspensions

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a chemical defense because it has antimicrobial activity and is considered a natural insecticide. Caffeine can also produce negative allelopathic effects that prevent the growth of surrounding plants. In addition, people around the world consume caffeine for its analgesic and stimulatory effects. Due to interest in the technological applications of caffeine, research on the biosynthetic pathway of this compound has grown. These studies have primarily focused on understanding the biochemical and molecular mechanisms that regulate the biosynthesis of caffeine. In vitro tissue culture has become a useful system for studying this biosynthetic pathway. This article will describe a step-by-step protocol for the quantification of caffeine and for measuring the transcript levels of the gene (CCS1) encoding caffeine synthase (CS) in cell suspensions of C. arabica L. as well as its activity.

This protocol describes an efficient methodology for the extraction and quantification of caffeine in cell suspensions of C. arabica L. and an experimental process for evaluating the enzymatic activity of caffeine synthase with the expression level of the gene that encodes this enzyme.

Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in popular drinks such as coffee and tea. This secondary metabolite is regarded as a ...

Studying Protein Import into Chloroplasts Using Protoplasts

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many secondary metabolites and lipids. Chloroplasts require a large number of proteins for these various physiological processes. Over 95% of chloroplast proteins are nucleus-encoded and imported into chloroplasts from the cytosol after translation on cytosolic ribosomes. Thus, the proper import or targeting of these nucleus-encoded chloroplast proteins to chloroplasts is essential for the proper functioning of chloroplasts as well as the plant cell. Nucleus-encoded chloroplast proteins contain signal sequences for specific targeting to chloroplasts. Molecular machinery localized to the chloroplast or cytosol recognize these signals and carry out the import process. To investigate the mechanisms of protein import or targeting to chloroplasts in vivo, we developed a rapid, efficient protoplast-based method to analyze protein import into chloroplasts of Arabidopsis. In this method, we use protoplasts isolated from leaf tissues of Arabidopsis. Here, we provide a detailed protocol for using protoplasts to investigate the mechanism by which proteins are imported into chloroplasts.

Here we describe a protocol to express proteins into protoplasts by using PEG-mediated transformation method. The method provides easy expression of proteins of interest, and efficient investigation of protein localization and the import process for various experimental conditions in vivo.

The chloroplast is an essential organelle that is responsible for various cellular processes in plants, such as photosynthesis and the production of many ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Using In Vitro Fluorescence Resonance Energy Transfer to Study the Dynamics Of Protein Complexes at a Millisecond Time Scale

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological functions. Such interactions can be highly dynamic, meaning the interacting subunits are constantly associated and dissociated at certain rates. While measuring the binding affinity using techniques such as quantitative pull-down reveals the strength of the interaction, studying the binding kinetics provides insights on how fast the interaction occurs and how long each complex can exist. Furthermore, measuring the kinetics of an interaction in the presence of an additional factor, such as a protein exchange factor or a drug, helps reveal the mechanism by which the interaction is regulated by the other factor, providing important knowledge for the advancement of biological and medical research. Here, we describe a protocol for measuring the binding kinetics of a protein complex that has a high intrinsic association rate and can be dissociated quickly by another protein. The method uses fluorescence resonance energy transfer to report the formation of the protein complex in vitro, and it enables monitoring the fast association and dissociation of the complex in real time on a stopped-flow fluorimeter. Using this assay, the association and dissociation rate constants of the protein complex are quantified.

Protein-protein interactions are critical for biological systems, and studies of the binding kinetics provide insights into the dynamics and function of protein complexes. We describe a method that quantifies the kinetic parameters of a protein complex using fluorescence resonance energy transfer and the stopped-flow technique. &#160;

Proteins are the primary operators of biological systems, and they usually interact with other macro- or small molecules to carry out their biological ...

Label-Free Immunoprecipitation Mass Spectrometry Workflow for Large-scale Nuclear Interactome Profiling

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This publication presents a complete interaction proteomics workflow designed for identifying low abundance protein-protein interactions from the nucleus that could also be applied to other subcellular compartments. This workflow includes subcellular fractionation, immunoprecipitation, sample preparation, offline cleanup, single-shot label-free mass spectrometry, and downstream computational analysis and data visualization. Our protocol is optimized for detecting compartmentalized, low abundance interactions that are difficult to identify from whole cell lysates (e.g., transcription factor interactions in the nucleus) by immunoprecipitation of endogenous proteins from fractionated subcellular compartments. The sample preparation pipeline outlined here provides detailed instructions for the preparation of HeLa cell nuclear extract, immunoaffinity purification of endogenous bait protein, and quantitative mass spectrometry analysis. We also discuss methodological considerations for performing large-scale immunoprecipitation in mass spectrometry-based interaction profiling experiments and provide guidelines for evaluating data quality to distinguish true positive protein interactions from nonspecific interactions. This approach is demonstrated here by investigating the nuclear interactome of the CMGC kinase, DYRK1A, a low abundance protein kinase with poorly defined interactions within the nucleus.

Described is a proteomics workflow for identifying protein interaction partners from a nuclear subcellular fraction using immunoaffinity enrichment of a given protein of interest and label-free mass spectrometry. The workflow includes subcellular fractionation, immunoprecipitation, filter aided sample preparation, offline cleanup, mass spectrometry, and a downstream bioinformatics pipeline.

Immunoaffinity purification mass spectrometry (IP-MS) has emerged as a robust quantitative method of identifying protein-protein interactions. This ...