Geleneksel UV lamba ile donatılmış UV çapraz bağlama cihazını sağlayan Prof. Joris Winderickx&#39;in laboratuvarını kabul ediyoruz. KG, KU Leuven araştırma fonu tarafından desteklenmekte ve FWO hibe G065713N&#39;den destek aldığını onaylamaktadır.

Yazarların açıklayacak bir şeyi yok.

Mayalar ve insan hücreleri için geliştirilmiş mRNA etkileşim yakalamasını yaprak mezofil protoplastlarına başarılı bir şekilde uyguladık. Yaprak yapraklarındaki başlıca zımpara türü mezofil hücreleridir. Bu yöntemin en büyük avantajı, fizyolojik bir ortamdan proteinleri keşfetmek için in vivo çapraz bağlamayı kullanmasıdır. Bu protokolde, esas olarak birtakım optimize edilmiş deneysel koşulları ( örn., Başlangıç ​​materyali olarak kullanılacak protoplastların sayısı ve UV ışınlarının süresi) 50 olarak sunuyoruz. 10 7 protoplast (orta ölçekli) minimum (adım 1.5.5) kullanıldığında CL örnekleri yakalanan proteinler, sadece SDS-PAGE ve gümüş boyama ile saptanabilir. Düşük konsantrasyonlar, SDS-PAGE üzerinde gözlemlenebilir bir mRBP paterni oluşturmaz ve muhtemelen proteomiklerin daha ileri analizleri için kullanılmamalıdır. Gerçekten de, 10&#39;dan fazla 7 hücrenin kullanılması ( örneğin, 10 9 inBüyük ölçekli bir deney) mümkündür 20 . Gümüş boyama tahlillerinden elde edilen sonuçlar 0,00875 W / bir sürekli-dalga UV kaynağı tarafından oluşturulan yoğunluğu cm2 ile 1 dakika boyunca UV-ışını uygun (Şekil 1D) olduğunu göstermektedir. Kritik basamaktaki yüksek verimlilik ( yani, oligo-d (T) 25 boncuklar, adım 4) ile mRNP&#39;nin açılması ve saflaştırılması, RT-qPCR, gümüş boyama ve MS deneylerinin sonuçları tarafından desteklenmektedir ( Şekil 1C ; 1D ve 1E , sağ). Niteliksel ve kantitatif proteomik kombinasyonu, CL olmayan kontrol ve CL örnekleri arasındaki örtüşme bölgesindeki pozitif RBP&#39;lerin tanımlanmasına yardımcı olabilir ( Şekil 1E ). Tanımlanmış proteinlerin çoğu, daha önce veri kümelerinde belirtilmeyen RBP&#39;lerdir ( Şekil 1F ). Daha önce bilinmeyen bu RNA bağlayıcı proteinleri, kategori III&#39;te, aday RBP&#39;ler olarak sunduk &lt;Sup class = &quot;xref&quot;&gt; 50 ( Şekil 1F ). Bu aday RBPS bağlanma spesifitelerini keşfetmek, daha önce sözü edilen CLIP yöntemleri 23 gibi diğer yöntemler kullanılarak yapılmalıdır. Bir RBP&#39;nin, Arabidopsis&#39;teki hedef mRNA transkriptini CLIP 51&#39;in kullanımı yoluyla düzenlemek için bağlanma spesifıkliğini araştıran bir örnek, Zhang ve diğerleri , 2015&#39;de bulunabilir. Ayrıca, PAR-CLIP&#39;den, fotoaktivasyon yapılabilir- Maya ve insan hücrelerinden 14 , 23 mRNA&#39;ya bağlı proteomların araştırılması için ribonükleosit ile güçlendirilmiş çapraz bağlanma (PAR-CL, 365-nm UV-A) önerilmiştir. PAR-CL, RNA metabolizması sırasında hücreler tarafından alınır ve gelişmekte olan RNA&#39;lara dahil edilmiş 4Su&#39;ya ihtiyaç duyar ve UV-A (365 nm) ışınım altında amino asitler 52 ile kovalent bağlar oluşturan oldukça reaktif olabilirtirme. Halen, 4sU&#39;nun bitki hücrelerine toksisitesi ve ekzojen 4SÜ&#39;nin mezofil protoplastlara etkili bir şekilde alınması üzerine odaklanan hiçbir çalışma yoktur 53 . Bununla birlikte, çeşitli RBP&#39;lerin fizyolojik açıdan keşfedilmesine ve onaylanmasına katkıda bulunacak bitkiler üzerinde hem klasik CL (254-nm UV-C) hem de PAR-CL (365 nm UV-A) kullanılmasının mümkün olacağına inanıyoruz Gelecekte bir çevre.

Ökaryotlar, hücresel biyolojik süreçleri korumak için çoklu RNA biyogenez düzenleyici yollarını kullanır. Bilinen RNA türleri arasında mRNA çok çeşitlidir ve proteinlerin ve izoformlarının kodlama kapasitesini taşır 1. PTGR yolu, pre-mRNA&#39;ların 2 , 3&#39;ün kaderini yönlendirir. Farklı gen ailelerinden RBP&#39;ler RNA regülasyonunu kontrol eder ve PTGR&#39;da spesifik mRBPler mRNA&#39;ları doğrudan fiziksel etkileşimler yoluyla yönlendirerek fonksiyonel mRNA&#39;ları oluştururlar. Bu nedenle, tanımlanması ve mRBPs karakterize ve mRNPs son üç yıl .Over hücresel mRNA metabolizması 2 düzenleme anlamak için kritiktir, çeşitli in vitro yöntemler - RNA elektroforetik mobilite kayma (Remsa) analizleri, üstel zenginleştirme deneyleri ile ligandların sistematik evrimi dahil olmak üzere (SELEX), kütüphane türevli yapılara, RNA Bind-n-Seq (RBNS), radyoaktif işaretlenmiş veya nicelikselFloresan RNA bağlama deneyleri, X-ışını kristalografisi ve NMR spektroskopisi 4 , 5 , 6 , 7 , 8 , 9 - esas olarak memeli hücrelerinden RBP çalışmalarına uygulanmıştır. Bu memeli RBP çalışmalarının sonuçları, yayınlanmış gözlemleri toplayan RNA-bağlayıcı Protein Veri Tabanı (RBPDB) vasıtasıyla aranabilir ( 10) . Bu in vitro yaklaşımlar güçlü araçlar olmasına rağmen, belirli bir RNA dizisi havuzundan bağlı RNA motiflerini belirler ve bu nedenle yeni hedef RNA&#39;ları keşfetme yetenekleri sınırlıdır. Aynı şey, protein dizisinin ve yapısının 15 korunmasına dayanan genom çapında RBP&#39;leri öngörmek için hesaplama stratejileri için de geçerlidir. Bunun üstesinden gelmek için, yeni bir deneysel yöntem haBir RBP&#39;nin etkileşime girdiği RNA motiflerinin tanımlanmasına ve bağlanmanın tam yerinin belirlenmesine izin veren bir dizi kurulmuştur. &quot;Çapraz bağlama ve immüno çökeltme&quot; (CLIP) adı verilen bu yöntem, in vivo UV çapraz bağlanma ve ardından immüno çökeltme 11&#39;den oluşur . Erken yapılan çalışmalar, DNA ve RNA nükleotidlerinin fotoaktifleşmesinin, 245 nm&#39;den daha yüksek uyaran UV dalga boylarında oluşabileceğini göstermiştir. 12: timidin ile reaksiyonu (dT ≥ dC&gt; rU&gt; Re, dA, dG azalma photoreactivity sırasına göre sıralama) tercih görünüyor. 254 nm dalga boyunda (UV-C) UV ışığı kullanarak RNA nükleotidleri ve protein kalıntıları arasındaki kovalent bağların sadece birkaç Angstrom (Å) aralığında oluştuğu gözlemlendi. Dolayısıyla fenomen, RNA ve RBP&#39;nin &quot;sıfır uzunluklu&quot; çapraz bağlanması olarak adlandırılır. Bunu takiben katı bir arındırma işlemi izlenebilir<html> Az arka planla dür 13 , 14 . CLIP&#39;i tamamlayan bir strateji, RBP&#39;lerin manzarasını tanımlamak için protein tanımlaması ile in vivo UV çapraz bağlamayı birleştirmektir. &quot;MRNA etkileşimli yakalama&quot; adı verilen bu yeni deneysel yaklaşımı kullanarak maya hücrelerinden, embriyonik kök hücrelerden (ESC&#39;ler) ve insan hücre çizgilerinden ( örn., HEK293 ve HeLa) izole edilmiş bu tür genom çapında mRNA&#39;ya bağlı proteomlar 18 , 19 , 20 , 21 . Yöntem in vivo UV çapraz bağlanma, ardından mRNP saflaştırması ve MS tabanlı proteomiklerden oluşur. Bu stratejiyi uygulayarak, kanonik olmayan RBD&#39;ler içeren birçok yeni &quot;ay ışığı alan&quot; RBP keşfedildi ve daha fazla proteininin önceden tahmin edildiğinden daha fazla RNA bağlama kapasitesine sahip olduğu netleşti.&quot;&gt; 15 , 16 , 17. Bu yöntemin kullanılması yeni başvurulara ve RBP&#39;leri araştırırken yeni biyolojik soruları cevaplama yeteneğine izin verir Örneğin son zamanlarda yapılan bir araştırma mRNA&#39;ya bağlı proteomun (ana RBP) korunmasını araştırmıştır Proteom) maya ve insan hücreleri arasında 22 . Bitki RBP&#39;leri, büyümede ve gelişmede ( örneğin , çiçeklenme zamanının transkripsiyon sonrası düzenlenmesinde, sirkadyere ait saatte ve mitokondriyum ve kloroplastlarda gen ifadesi gibi) 24 , 25 , 26 , 27 , 28 , 29 . Dahası, abiyotik streslere ( örn. Soğuk, kuraklık, sönümlenme) yanıt veren hücresel süreçlerde işlevleri yerine getirdiği düşünülmektedirLinity ve absisik asit (ABA)) 31 , 32 , 33 , 34&#39;tür . Arabidopsis thaliana genomunda RNA tanıma motifi (RRM) ve K homoloji (KH) alan dizisi motiflerine dayanan 200&#39;den fazla tahmini RBP geni vardır; Pirinçte yaklaşık 250, 35 , 36 olarak kaydedildi. Birçok tahmin RBPS birçok yeni fonksiyonlara hizmet verdiği düşündüren 35 (RRM alanını içeren tahmin Arabidopsis RBPS yaklaşık% 50&#39;ye örneğin hiçbir metazoan ortologlarıyla) bitkilere özgü olduğu söylenemez dikkat çekicidir. Tahmini RBP&#39;lerin çoğu işlevleri tanımlanmamış halde kalır 23 . Arabidopsis etiylü fidelerden, yaprak dokusundan, kültür kök hücrelerinden ve yaprak mezofil protoplastlarından mRNA&#39;ya bağlı proteomların izolasyonu,mRNA interaktom yakalama geçenlerde, 39 38 bildirilmiştir. Bu çalışmalar, yakın gelecekte bitkilerde fonksiyonel RBP&#39;lerin sistematik olarak kataloglanmasının güçlü potansiyelini ortaya koymaktadır. Burada, bitki protoplastlarından ( yani, hücre duvarları olmayan hücrelerden) mRNA interaksiyonu yakalamak için bir protokol sunuyoruz. Arabidopsis thaliana yaprak mezofil protoplastları, en önemli yaprak hücresi türüdür. İzole edilmiş protoplastlar, UV ışığının hücrelere en iyi şekilde erişilmesine izin verir. Bu hücre tipi, fonksiyonel karakterizasyon için proteinleri geçici olarak ifade eden tahlillerde kullanılabilir 40 , 41 . Ayrıca protoplast, birkaç diğer bitki hücre türüne ve tür 42 , 43 , 44&#39;e uygulanmıştır ( örneğin, Petersson ve diğerleri , 2009; Bargmann ve Birnbaum, 2010; ve Hong ve ark ., 2012). &lt;P class = &quot;jove_content&quot;&gt; Yöntem toplam 11 basamağı kapsamaktadır ( Şekil 1A ). Arabidopsis yaprak mezofil protoplastları önce izole edilir (aşama 1) ve sonra çapraz bağlanmış mRNP&#39;leri oluşturmak için UV ışınlarına maruz bırakılır (aşama 2). Protoplastlar denatüre edici şartlar altında parçalandığında (basamak 3), çapraz bağlanmış mRNPler liziz / bağlama tamponunda serbest bırakılır ve oligo-d (T) 25 boncuklar tarafından çekilir (adım 4). Sıkı yıkamalar birkaç tur sonra, mRNPs saflaştırılmış ve daha da analiz edilir. MRBP&#39;lerin denatüre peptitleri, çapraz bağlı mRNA&#39;lar saflaştırılmadan ve RNA kalitesi qRT-PCR ile doğrulanmadan önce proteinaz K ile sindirilir (adımlar 5 ve 6). RNaz işlemi ve protein konsantrasyonundan (7. adım) sonra, protein kalitesi SDS poliakrilamid jel elektroforezi (SDS-PAGE) ve gümüş boyama (adım 8) ile kontrol edilir. Protein band örüntülerindeki fark, çapraz bağlı bir numune (CL) ile çapraz bağlanmamış bir numune (CL olmayan;UV ışınlamasına tabi tutulmayan protoplastlardan gelen negatif kontrol örneği). Proteinlerin tanımlanması, MS tabanlı proteomikler aracılığıyla gerçekleştirilir. CL örneğinden gelen proteinler olası arka plan kontaminasyonunu gidermek için tek boyutlu poliakrilamid jel elektroforezi (1D-PAGE) ile ayrılır, tripsin kullanılarak kısa peptidlere &quot;in-jel ile sindirilir&quot; ve saflaştırılır (adım 9). Nano ters faz sıvı kromatografisi, kütle spektrometrisine (nano-LC-MS) bağlı olarak, mRNA&#39;ya bağlı proteomdaki kesin protein miktarının belirlenmesine olanak tanır (basamak 10). Son olarak tanımlanan mRNA&#39;lar, biyoenformatik analiz (adım 11) kullanılarak karakterize edilir ve kataloglanır.

<table><tbody><tr><td>&lt;strong&gt;REAGENTS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>0.8 M Mannitol</td><td>Sigma</td><td>M1902-500G</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; MMg solution</td></tr><tr><td>2 M KCl</td><td>MERCK</td><td>Art. 4935</td><td>Primary isotonic Enzyme solution &amp;amp;&lt;br/&gt; W5 buffer</td></tr><tr><td>0.2 M MES (pH 5.7)&lt;br/&gt; (4-morpholineethanesulfonic acid)</td><td>Sigma-aldrich</td><td>M2933</td><td>Primary isotonic Enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; MMg solution,&lt;br/&gt; Filtration sterilization</td></tr><tr><td>Cellulase R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>CELLULASE&lt;br/&gt; &amp;ldquo;ONOZUKA&amp;rdquo;&lt;br/&gt; R-10, 10 g</td><td>Final isotonic enzyme solution</td></tr><tr><td>Macerozyme R10</td><td>Yakult Pharmaceutical Industry Co., Ltd.</td><td>MACEROZYME R-10, 10g</td><td>Final isotonic enzyme solution</td></tr><tr><td>10% (&lt;em&gt;w/v&lt;/em&gt;) BSA&lt;br/&gt; (Bovine Serum Albumin)</td><td>Sigma-aldrich</td><td>A7906-100G</td><td>Final isotonic enzyme solution &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M CaCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Chem-Lab NV</td><td>CL00.0317.1000</td><td>Final isotonic enzyme solution,&lt;br/&gt; W5 buffer &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>1 M NaCl</td><td>Fisher Chemical</td><td>S/3160/60</td><td>W5 buffer</td></tr><tr><td>2 M MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>M8266-100G</td><td>MMg solution</td></tr><tr><td>1 M LiCl&lt;br/&gt; (Lithium Chloride)</td><td>Acros</td><td>199885000</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2 &amp;amp;&lt;br/&gt; Low salt buffer</td></tr><tr><td>5% (&lt;em&gt;w/v&lt;/em&gt;) LiDS&lt;br/&gt; (Lithium Dodecyl Sulphate)</td><td>Sigma-aldrich</td><td>L4632-25G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Filtration sterilization</td></tr><tr><td>1 M DTT&lt;br/&gt; (Dithiothreitol)</td><td>Thermo Fisher Scientific&lt;br/&gt; Wash buffer 1 &amp;amp;&lt;br/&gt; Wash buffer 2</td><td>307866</td><td>Lysis/binding buffer,</td></tr><tr><td>1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))</td><td>Acros &amp;amp;&lt;br/&gt; Fisher Chemical</td><td>167620010 &amp;amp;&lt;br/&gt; H/1200/PB15</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)</td><td>Sigma-aldrich</td><td>ED-500G</td><td>Lysis/binding buffer,&lt;br/&gt; Wash buffer 1,&lt;br/&gt; Wash buffer 2,&lt;br/&gt; Low salt buffer &amp;amp;&lt;br/&gt; Elution buffer</td></tr><tr><td>Tween 20</td><td>MERCK</td><td>8.22184.0500</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>0.1 M NaOH</td><td>VWR PROLABO CHEMICALS</td><td>28244.295</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>1x PBS (pH 7.4)&lt;br/&gt; (Phosphate Buffered Saline)&lt;br/&gt; containing&lt;br/&gt; (NaCl; KCl; Na&lt;sub&gt;2&lt;/sub&gt;HPO&lt;sub&gt;4&lt;/sub&gt;; KH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Fisher Chemical, MERCK,&lt;br/&gt; Sigma-aldrich &amp;amp; SAFC</td><td>S/3160/60,&lt;br/&gt; Art. 4935,&lt;br/&gt; 71640-250G &amp;amp;&lt;br/&gt; 60230</td><td>Regeneration of oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; beads</td></tr><tr><td>Proteinase K solution (2 &amp;mu;g/&amp;mu;L)</td><td>Thermo Fisher Scientific</td><td>11789020</td><td>Protein digestion</td></tr><tr><td>Loading dye</td><td>Invitrogen</td><td>LC5925</td><td>SDS-PAGE</td></tr><tr><td>qPCR master mix</td><td>Promega</td><td>A6001</td><td>qRT-PCR assay</td></tr><tr><td>RNase Cocktail</td><td>Thermo Fisher Scientific</td><td>AM2286</td><td>RNA digestion</td></tr><tr><td>Methanol</td><td>Sigma-aldrich</td><td>322415</td><td>Gel fixation and gel destaining</td></tr><tr><td>Acetic acid</td><td>Sigma-aldrich</td><td>537020</td><td>Gel fixation and gel destaining</td></tr><tr><td>Coomassie Brilliant Blue R-250</td><td>Thermo Fisher Scientific</td><td>20278</td><td>Gel staining</td></tr><tr><td>1 M NH&lt;sub&gt;4&lt;/sub&gt;HCO&lt;sub&gt;3&lt;/sub&gt;&lt;br/&gt; (Ammonium bicarbonate)&lt;br/&gt; &amp;nbsp;</td><td>Sigma-aldrich</td><td>09830-500G</td><td>Gel hydration &amp;amp;&lt;br/&gt; Digestion buffer</td></tr><tr><td>CH&lt;sub&gt;3&lt;/sub&gt;CN&lt;br/&gt; (Acetonitrile)</td><td>Sigma-aldrich</td><td>34851-100ML</td><td>Gel dehydration &amp;amp;&lt;br/&gt; Peptide dissolving solution</td></tr><tr><td>IAA&lt;br/&gt; (Iodoacetic acid)</td><td>Sigma-aldrich</td><td>I4386-10G</td><td>Alkylating agent</td></tr><tr><td>TFA&lt;br/&gt; (Trifluoroacetic acid)</td><td>Sigma-aldrich</td><td>302031-10X1ML</td><td>Peptide dissolving solution</td></tr><tr><td>FA&lt;br/&gt; (Formic acid)</td><td>Sigma-aldrich</td><td>06554-5G</td><td>Peptide extraction</td></tr><tr><td>Trypsin solution (6 ng/&amp;mu;L)</td><td>Promega</td><td>V5280</td><td>Digestion buffer</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;EQUIPMENT&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Soil</td><td>Peltracom</td><td>LP2D</td><td>Plant growth</td></tr><tr><td>Vermiculite 3</td><td>Sibli AS</td><td>05VERMICULIET</td><td>Plant growth</td></tr><tr><td>Petri dish (150 x 20 mm)</td><td>Sarstedt</td><td>82.1184.500</td><td>Carrier for protoplast suspension</td></tr><tr><td>0.22 &amp;mu;m filter</td><td>Millipore</td><td>SE2M229104</td><td>Homogenization of final isotonic enzyme solution</td></tr><tr><td>Razorblade</td><td>Agar Scientific</td><td>T585</td><td>Rosette leaf strips</td></tr><tr><td>35-75 &amp;mu;m nylon mesh</td><td>SEFAR NITEX</td><td>74010</td><td>Protoplast suspension filtration</td></tr><tr><td>50 mL round bottom tubes</td><td>Sigma-aldrich</td><td>T1918-10EA</td><td>Carrier for protoplast suspension</td></tr><tr><td>Hemocytometer&lt;br/&gt; (B&amp;uuml;rker hemocytometer)</td><td>MARIENFELD</td><td>650030</td><td>Protoplast cell counting</td></tr><tr><td>UV crosslinking apparatus&lt;br/&gt; (HL-2000 HybriLinker)</td><td>UVP, LLC</td><td>UVP95003101</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>UV lamp&lt;br/&gt; (Sankyo-Denki G8T5)</td><td>SANKYO&lt;br/&gt; DENKI</td><td>SD G8T5</td><td>&lt;em&gt;in vivo&lt;/em&gt; UV crosslinking</td></tr><tr><td>50 mL glass syringe</td><td>FORTUNA Optima</td><td>Z314560</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Narrow needle (0.9 x 25 mm)</td><td>Becton Dickinson microlance 3</td><td>2021-04</td><td>Homogenization of protoplast lysate</td></tr><tr><td>Rotator Model L26</td><td>Labinco BV</td><td>26110912</td><td>Sample incubation by rotating</td></tr><tr><td>Oligo-d(T)&lt;sub&gt;25&lt;/sub&gt; magnetic beads&lt;br/&gt; (5 mg/mL)</td><td>New England BioLabs</td><td>S1419S</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Magnetic rack</td><td>Invitrogen</td><td>CS15000</td><td>mRNPs and mRNAs binding and pull-down</td></tr><tr><td>Centrifugal filter units&lt;br/&gt; (Amicon Ultra-4 centrifugal filter units)</td><td>EMD Millipore</td><td>UFC800308</td><td>mRBP concentration</td></tr><tr><td>Pierce Silver Stain Kit</td><td>Thermo Fisher Scientific</td><td>24612</td><td>Silver-staining assay</td></tr><tr><td>RNA purification kit&lt;br/&gt; (InviTrap Spin Plant RNA Mini Kit)</td><td>STRATEC Molecular</td><td>1064100300</td><td>RNA purification</td></tr><tr><td>Spectrophotometer device (NanoDrop 1000 Spectrophotometer)</td><td>Thermo Fisher Scientific</td><td>ND-1000</td><td>RNA quality and quantity</td></tr><tr><td>Real-Time PCR cycler&lt;br/&gt; (StepOne Real-Time PCR cycler)</td><td>Thermo Fisher Scientific</td><td>4376600</td><td>cDNA quantification</td></tr><tr><td>&amp;micro;-C18 columns&lt;br/&gt; (Millipore Zip Tip &amp;micro;-C18 columns)</td><td>Sigma-aldrich</td><td>720046-960EA</td><td>Peptide purification</td></tr><tr><td>Mass spectrometer&lt;br/&gt; (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)</td><td>Thermo Fisher Scientific</td><td>IQLAAEGAAPFALGMAZR</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)</td><td>Thermo Fisher Scientific</td><td>ULTIM3000RSLCNANO</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 column&lt;br/&gt; (Easy Spray Pepmap RSLC C18 column)</td><td>Thermo Fisher Scientific</td><td>ES800</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>C18 precolumn&lt;br/&gt; (Acclaim Pepmap 100 C18 precolumn)</td><td>Thermo Fisher Scientific</td><td>160321</td><td>Mass spectrometry-based proteomics</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Primers for qRT-PCR assay&lt;/strong&gt;</td><td>&lt;strong&gt;Sequences&lt;/strong&gt;</td><td></td><td></td></tr><tr><td>&lt;em&gt;UBQ10&lt;/em&gt; mRNA&lt;br/&gt; (Li &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: AACTTTGGTGGTTTGTGTTTTGG&lt;br/&gt; Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA</td><td></td><td></td></tr><tr><td>18S rRNA&lt;br/&gt; (Durut &lt;em&gt;et al.&lt;/em&gt;, 2014)</td><td>Fw: CGTAGTTGAACCTTGGGATG&lt;br/&gt; Rv: CACGACCCGGCCAATTA</td><td></td><td></td></tr></tbody></table>

mrna interactome capture from plant protoplasts

RNA bağlayıcı proteinler (RBPler) RNA&#39;ların kaderini belirler. Bütün RNA biyogenez yollarına katılırlar ve özellikle haberci RNA&#39;ların (mRNA&#39;lar) post-transkripsiyonel gen regülasyonuna (PTGR) katkıda bulunurlar. Son birkaç yılda, maya ve memeli hücresi soylarından elde edilen bir dizi mRNA&#39;ya bağlı proteom, &quot;mRNA etkileşimli yakalama&quot; adı verilen ve mRNA&#39;ya bağlanan proteinlerin (mRBP&#39;lerin) tanımlanmasına izin veren yeni bir yöntem kullanılarak başarıyla izole edilmiştir. Doğrudan bir fizyolojik ortamdan. Yöntem in vivo ultraviyole (UV) çapraz bağlama, oligon (dT) boncuklar ile haberci ribonükleoprotein komplekslerinin (mRNPs) aşağı çekilmesi ve saflaştırılması ve ardından kütle spektrometresi (MS) ile çapraz bağlanmış proteinlerin tanımlanmasından oluşur. Çok yakın bir tarihte, aynı yöntemi uygulayarak, çeşitli Arabidopsis doku kaynaklarına eşzamanlı olarak birkaç bitki mRNA&#39;ya bağlı proteom rapor edilmiştir: etiyole edilmiş fideler, yaprak dokusu,Yaprak mezofil protoplastları ve kültür kökü hücreleri. Burada, Arabidopsis thaliana yaprak mezofil protoplastları için optimize edilmiş mRNA etkileşimli yakalama yöntemini sunuyoruz. Bu hücre türü, çeşitli hücresel tahliller içeren deneyler için çok yönlü bir araç olarak hizmet etmektedir. Optimum protein verimi için koşullar, başlangıç ​​dokusu miktarını ve UV ışınlama süresini içerir. Orta ölçekli bir deneyden (10 7 hücre) elde edilen mRNA&#39;ya bağlı proteomda, RNA bağlama kapasitesine sahip olduğu kaydedilen RBP&#39;lerin aşırı temsil edildiği bulundu ve birçok yeni RBP tespit edildi. Deney ölçeklenebilir (10 9 hücre) ve optimize yöntem, bitkilerdeki mRNA bağlı proteomları geniş ölçüde izole etmek, kataloglamak ve karşılaştırmak için diğer bitki hücre tiplerine ve türüne uygulanabilir.

CL örneğinde boncuk taneciklerini çevreleyen, yıkama basamağı 4.3&#39;de yıkama tamponu 2 ile ( Şekil 1B ) karakteristik bir halo gözlemledik. Araştırılmamış olmasına rağmen, bu fenomen manyetik yakalama esnasında boncuk agregasyonu ile çapraz bağlanmış mRNP komplekslerinin etkileşimi ile muhtemelen açıklanabilir ve daha yaygın bir agreganın oluşmasına neden olur. Oligo-d (T) 25 boncuk yakalama etkisinin 14 olduğunu gösterir . Olmayan CL kontrol ve CL örnekleri hem de 18S rRNA önemli ölçüde daha yüksek UBQ10 referans mRNA seviyeleri Şekil 1C &#39;de gösterilmiştir. Bu mRNA&#39;ların sadece poli (A) -tailli mRNA&#39;lara bağlanabilen oligo-d (T) 25 boncukların yakalanması nedeniyle eluent içinde zengin olduğunu gösterir. Oligo-d (T) 25 boncuk yakalama verimliliği,RNaz muamelesinden ve mRBP konsantrasyonundan (adım 7) sonra Şekil 1D&#39;de gösterildiği gibi SDS-PAGE ve gümüş boyama (adım 8) ile ortonize edildi. CL olmayan kontrol ve CL örnek şeritleri arasındaki protein bandı modelinde bir fark gözlemlenebilir ve CL kontrol edilmeyen örnek şeritte bulunan protein bantları RNaz&#39;ın varlığı ile açıklanabilir. Bu, CL örneklemindeki mRBP&#39;lerin zenginleşmesini göstermektedir. Çapraz bağlama verimliliği, UV ışınlama süresinin değiştirilmesiyle kontrol edilebilir. Yeterli çapraz bağlanma, ancak protoplast hasarından ve RNA bozunumundan kaçınılması en iyisidir. Şekil 1D&#39;de farklı UV ışınlama süreleri (1, 3 ve 5 dakika) karşılaştırıldığında tüm CL örneklerinde spesifik protein bandı desenleri elde edilmiştir. Aynı UV yeğinliğinde (0,00875 W / cm2) altında, en uygun şartlar nedeniyle ayırt, özellikle 1 veya 3 dakika olduğu bulunmuşturProtein band yoğunlukları. Daha uzun çapraz bağlanma süresi (5 dakika) ile zayıf bant yoğunlukları gözlenmiştir. Çabuk çapraz bağlanma süresinin daha kısa olması, Petri kabından protoplastların daha kolay transferi ve toplanması gibi ek bir avantaja sahip olduğu için 1 dakika optimum koşul olarak düşünülmüştür. Protoplastlar, UV ışınlaması sırasında, tabağın tabanına yapıştığı için Petri kabının tabanına hızla çökebilir. Bu, daha uzun UV ışınlama süresinden sonra tüpleri toplamak ve onları tüplere aktarmak daha zor hale getirir. Optimize edilmiş şartlara dayanarak, üç biyolojik replikasyondan proteinlerin tanımlanması, daha sonra 9. ve 10. basamaklarda anlatılan nitel ve kantitatif proteomikler ile gerçekleştirildi. Nitel proteomik analizde ( Şekil 1E , sağda) toplam 341 protein CL örneklerinde tanımlandı; bunlardan 36&#39;sı hem CL kontrolü olmayan hem deD CL örnekleri ve sadece 8 protein CL kontrol edilmeyen örnekte tespit edildi. Her iki numune arasındaki tanımlanan protein sayılarındaki bu muazzam fark, SDS-PAGE ve gümüş boyama testinin, oligo-d (T) randımanının etkinliğini doğrulamak için iyi araçlar olduğu fikrini destekleyen farklı protein bandı modelleriyle tutarlıdır ( Şekil 1D ) 25 boncuk yakalama. Kantitatif proteomik analizde ( Şekil 1E , solda) toplam 325 protein (mavi ve yeşil renkli) log2 katlı bir değişim gösterdi. Bu proteinlerin arasında, 100 protein (mavi renkli) küçük p&#39;ye sahipti Değerler anlamlılık düzeyinin üstünde. Bu nedenle, onlar da pozitif isabet olarak tanımlandı. Dikkat çeken bir başka 225 protein (yeşil renkli) p-değerlerinin, veri seyir sayısına bağlı olarak anlamlılık seviyesinin 0,05&#39;in altında olduğunu göstermektedir. Başka bir deyişle, her protein için düşük miktarda peptit mevcuttu ve peptid intensitenin değişkenliği yüksekties. Bununla birlikte, hepsi nitel olarak sadece CL örneklerinde tespit edildiğinden, bunlar pozitif olarak kabul edildi. GO ve InterPro veritabanları 50&#39;ye (adım 11) dayanan bu 325 proteinler, kategori I (ribozomal proteinler), kategori II (ana RBP&#39;ler) ve kategori III (aday RBP&#39;ler) olarak sınıflandırılmıştır ( Şekil 1F ). Kategori I&#39;de 123 ribozomal protein vardı, kategori II&#39;de ise 70 asimetrik klasik RBP gözlemlendi. Sırasıyla moleküler RNA bağlanması ve RNA biyolojisi ( Şekil 1F , sağ) ile bağlantılı olan ve tüm mRNA&#39;ya bağlı proteomun yaklaşık% 38&#39;ini ve% 22&#39;sini işgal eden en dikkat çekici proteinleri içeren bu iki kategori, optimize edilmiş mRNA etkileşiminin yüksek verimliliğini göstermektedir ele geçirmek. Son 40% (132 aday RBP), klasik RBD&#39;lerin bulunmaması nedeniyle kategori III&#39;de sınıflandırılmıştır. Dahası, çoğuRNA bağlama ve RNA biyolojik süreçlerinde eir rolleri geçerli değildir ( Şekil 1F , solda). Bu kategorideki proteinlerin RNA düzenlemelerinde yeni fonksiyonları açığa çıkardığını varsayıyoruz. <img alt="Şekil 1" class="xfigimg" src="/files/ftp_upload/56011/56011fig1.jpg" /> Şekil 1: Arabidopsis Yaprak Mezofil Protoplastlarından mRNA&#39;ya bağlı Proteomun Bulunması için Akış Şeması ve Optimize Edilmiş Yöntemin Sonuçları. ( A ) Bütün yöntemin başlıca basamakları 1 ila 11 arasında listelenmiştir. Putative hücresel ve moleküler süreçler fotoğraf ve çizgi filmlerle gösterilmiştir. Her adım için detaylar Protokol&#39;de yoğun olarak tanımlanmıştır. ( B ) yıkama adımı 4.3 sırasında, CL örneğinde boncuk taneciklerini çevreleyen ancak CL kontrollü olmayan numunede olmayan bir halo gözlemlendi. ( C ) göreceli UBQ10 mRNA ve 18S rRNA leve karşılaştırılmasıQRT-PCR ile CL olmayan kontrollerde ve CL örneklerinde ls&#39;dir (değerler ortalama ± SD (n = 3); * ve **: p &lt;0.05 ve &lt;0.01 ile anlamlı farklar). 0,00875 W / cm2 UV yoğunluğu ile 1, 3 ve 5 dakika için bir sürekli-dalga UV kaynağı tarafından aydınlatılan CL örnekleri ile karşılaştırıldığında olmayan CL kontrol numunesi (D) Konsantre proteini yıkama sıvısı. ( E ) Proteomiklere göre mRNA&#39;ya bağlı proteomun tanımlanması. Progenesis yazılım paketi (solda) tarafından gerçekleştirilen kantitatif proteomiklerde, yanardağ grafiği ortalama log2 katlı değişiklikleri (CL / non-CL) ve ilgili ayarlanmış p-değerlerini (-log10 (adj. P-değerleri) gösterir Tüm proteinler. Peaks yazılım paketi (sağda) tarafından gerçekleştirilen kalitatif proteomiklerde, örneklerdeki proteinler Venn şemalarında gösterilmektedir. Proteinlerin miktarı sayılar halinde listelenmiştir. Peptid ve protein seviyelerinde FDR,% 5&#39;in altındadır. Açık kahverengi çerçevelerin içindeki proteinlerin sayısı pozitif isabet sayılır. ( <stRong&gt; F) mRNA&#39;ya bağlı proteomdan üç kategorinin sınıflandırılması. Tanımlanan proteinlerin miktarı, her kategorideki sayılarda listelenmiştir. Yeşil renkli bölgeler RNA bağlanmasına bağlı olarak açıklanan proteinlerdir, mavi renkli bölgeler ise RNA biyolojisine bağlı olan açıklamalı proteinleri ifade eder. Boş bölge RNA bağlama veya RNA biyolojisine bağlı bilinmeyen fonksiyonları olan proteinleri belirtir. Yukarıdaki tüm rakamlar Zhang ve diğerleri , 2016&#39;dan değiştirildi. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56011/56011fig1large.jpg" target="_blank">Bu rakamın daha büyük bir sürümünü görmek için lütfen tıklayınız.</a>

Watch this Scientific Journal Video about mRNA Interactome Capture from Plant Protoplasts at JoVE.com

mRNA Interactome Capture from Plant Protoplasts

Burada, Arabidopsis thaliana yaprak mezofil protoplastlarına uygulanan bir etkileşimli yakalama protokolünü sunuyoruz. Bu yöntem kritik olarak in vivo UV çapraz bağlanmaya dayanır ve fizyolojik bir ortamdan bitki mRNA&#39;ya bağlanan proteinlerin izole edilmesine ve tanımlanmasına izin verir.

Bitki Protoplastlarından mRNA İnteraktom Yakalama

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional ...

mrna-interactome-capture-from-plant-protoplasts

Nanyang Technological University

Research

JoVE Journal

Biochemistry

9.1K Görüntüleme.  KU Leuven.  Burada, Arabidopsis thaliana yaprak mezofil protoplastlarına uygulanan bir etkileşimli yakalama protokolünü sunuyoruz. Bu yöntem kritik olarak in vivo UV çapraz bağlanmaya dayanır ve fizyolojik bir ortamdan bitki mRNA'ya bağlanan proteinlerin izole edilmesine ve tanımlanmasına izin verir. 

Video: mRNA Interactome Capture from Plant Protoplasts

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

Yüksek verim Protoplast İzolasyonu ve Dönüşüm için Robotik Platformu

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

Genetik

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of protein-protein interactions (PPI) is no novelty, experimental approaches aiming to characterize endogenous protein-metabolite interactions (PMI) constitute a rather recent development. Herein, we present a protocol that allows simultaneous characterization of the PPI and PMI of a protein of choice, referred to as bait. Our protocol was optimized for Arabidopsis cell cultures and combines affinity purification (AP) with mass spectrometry (MS)-based protein and metabolite detection. In short, transgenic Arabidopsis lines, expressing bait protein fused to an affinity tag, are first lysed to obtain a native cellular extract. Anti-tag antibodies are used to pull down protein and metabolite partners of the bait protein. The affinity-purified complexes are extracted using a one-step methyl tert-butyl ether (MTBE)/methanol/water method. Whilst metabolites separate into either the polar or the hydrophobic phase, proteins can be found in the pellet. Both metabolites and proteins are then analyzed by ultra-performance liquid chromatography-mass spectrometry (UPLC-MS or UPLC-MS/MS). Empty-vector (EV) control lines are used to exclude false positives. The major advantage of our protocol is that it enables identification of protein and metabolite partners of a target protein in parallel in near-physiological conditions (cellular lysate). The presented method is straightforward, fast, and can be easily adapted to biological systems other than plant cell cultures.

Protein-protein and protein-metabolite interactions are crucial for all cellular functions. Herein, we describe a protocol that allows parallel analysis of these interactions with a protein of choice. Our protocol was optimized for plant cell cultures and combines affinity purification with mass spectrometry-based protein and metabolite detection.

2 in 1: tek adımlı benzeşme arıtma paralel analizi için Protein-Protein ve Protein-metaboliti kompleksleri

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Biyokimya

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

Bitki protoplast Floresan Aktif Hücre Ayırma

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

Biyoloji

Translating Ribosome Affinity Purification (TRAP) to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome affinity purification (TRAP) method and consecutive optimized low-input library preparation.
As starting material, we employ plant lines that express GFP-tagged ribosomal protein RPL18 in a cell type-specific manner by use of adequate promoters. Prior to immunopurification and RNA extraction, the tissue is snap frozen, which preserves tissue integrity and simultaneously allows execution of time series studies with high temporal resolution. Notably, cell wall structures remain intact, which is a major drawback in alternative procedures such as fluorescence-activated cell sorting-based approaches that rely on tissue protoplasting to isolate distinct cell populations. Additionally, no tissue fixation is necessary as in laser capture microdissection-based techniques, which allows high-quality RNA to be obtained.
However, sampling from subpopulations of cells and only isolating polysome-associated RNA severely limits RNA yields. It is, therefore, necessary to apply sufficiently sensitive library preparation methods for successful data acquisition by RNA-seq.
TRAP offers an ideal tool for plant research as many developmental processes involve cell wall-related and mechanical signaling pathways. The use of promoters to target specific cell populations is bridging the gap between organ and single-cell level that in turn suffer from little resolution or very high costs. Here, we apply TRAP to study cell-cell communication in lateral root formation.

Translating Ribosome Affinity Purification TRAP to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

Translating ribosome affinity purification (TRAP) offers the possibility to dissect developmental programs with minimal processing of organs and tissues. The protocol yields high-quality RNA from cells targeted with a green fluorescent protein (GFP)-labeled ribosomal subunit. Downstream analysis tools, such as qRT-PCR or RNA-seq, reveal tissue and cell type-specific expression profiles.

Bir Hücre Tipine Özel Ölçekte Arabidopsis thaliana Kök Gelişimini Araştırmak Için Ribozom Affinity Arınma (TRAP) Çevirisi

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome ...

Gelişim Biyolojisi

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation (BiFC) System

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein (YFP) into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest. These constructs can then be co-transformed into Nicotiana benthamiana via Agrobacterium mediated transformation, allowing the transit expression of fusion proteins. The reconstitution of YFP signal only occurs when the inquest proteins interact 1-7. To test and validate the protein-protein interactions, BiFC can be used together with yeast two hybrid (Y2H) assay. This may detect indirect interactions which can be overlooked in the Y2H. Gateway technology is a universal platform that enables researchers to shuttle the gene of interest (GOI) into as many expression and functional analysis systems as possible8,9. Both the orientation and reading frame can be maintained without using restriction enzymes or ligation to make expression-ready clones. As a result, one can eliminate all the re-sequencing steps to ensure consistent results throughout the experiments. We have created a series of Gateway compatible BiFC and Y2H vectors which provide researchers with easy-to-use tools to perform both BiFC and Y2H assays10. Here, we demonstrate the ease of using our BiFC system to test protein-protein interactions in N. benthamiana plants.

Detection of Protein Interactions in Plant using a Gateway Compatible Bimolecular Fluorescence Complementation BiFC System

We have developed a technique to test protein-protein interactions in plant. A yellow fluorescent protein (YFP) is split into two non-overlapping fragments. Each fragment is cloned in-frame to a gene of interest via Gateway system, enabling expression of fusion proteins. Reconstitution of YFP signal only occurs when the inquest proteins interact.

Ağ Geçidi Uyumlu Bimoleküler Floresan tamamlama (BiFC) kullanarak Bitki Protein Etkileşimleri Tespiti

We have developed a BiFC technique to test the interaction between two proteins in vivo. This is accomplished by splitting a yellow fluorescent protein ...

TurboID-Based Proximity Labeling for In Planta Identification of Protein-Protein Interaction Networks

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been successfully used for identification of protein-protein interactions (PPIs) in mammalian cells. However, requirements of toxic hydrogen peroxide (H2O2) in APEX-based PL, longer incubation time with biotin (16&#8211;24 h), and higher incubation temperature (37 &#176;C) in BioID-based PL severely limit their applications in plants. The recently described TurboID-based PL addresses many limitations of BioID and APEX. TurboID allows rapid proximity labeling of proteins in just 10&#8201;min under room temperature (RT) conditions. Although the utility of TurboID has been demonstrated in animal models, we recently showed that TurboID-based PL performs better in plants compared to BioID for labeling of proteins that are proximal to a protein of interest. Provided here is a step-by-step protocol for the identification of protein interaction partners using the N-terminal Toll/interleukin-1 receptor (TIR) domain of the nucleotide-binding leucine-rich repeat (NLR) protein family as a model. The method describes vector construction, agroinfiltration of protein expression constructs, biotin treatment, protein extraction and desalting, quantification, and enrichment of the biotinylated proteins by affinity purification. The protocol described here can be easily adapted to study other proteins of interest in Nicotiana and other plant species.

Described here is a proximity labeling method for identification of interaction partners of the TIR domain of the NLR immune receptor in Nicotiana benthamiana leaf tissue. Also provided is a detailed protocol for the identification of interactions between other proteins of interest using this technique in Nicotiana and other plant species.

Protein-Protein Etkileşim Ağlarının Planta Özdeşleştirilmesinde TurboID Tabanlı Yakınlık Etiketlemesi

Proximity labeling (PL) techniques using engineered ascorbate peroxidase (APEX) or Escherichia coli biotin ligase BirA (known as BioID) have been ...

İmmünoloji ve Enfeksiyon

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Plant protein kompleksleri, çevirim sonrası değişikliklerin belirlenmesi

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Protein-protein Interactions Visualized by Bimolecular Fluorescence Complementation in Tobacco Protoplasts and Leaves

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular fluorescence complementation (BiFC) is an in vivo method to monitor such interactions in plant cells. In the presented protocol the investigated candidate proteins are fused to complementary halves of fluorescent proteins and the respective constructs are introduced into plant cells via agrobacterium-mediated transformation. Subsequently, the proteins are transiently expressed in tobacco leaves and the restored fluorescent signals can be detected with a confocal laser scanning microscope in the intact cells. This allows not only visualization of the interaction itself, but also the subcellular localization of the protein complexes can be determined. For this purpose, marker genes containing a fluorescent tag can be coexpressed along with the BiFC constructs, thus visualizing cellular structures such as the endoplasmic reticulum, mitochondria, the Golgi apparatus or the plasma membrane. The fluorescent signal can be monitored either directly in epidermal leaf cells or in single protoplasts, which can be easily isolated from the transformed tobacco leaves. BiFC is ideally suited to study protein-protein interactions in their natural surroundings within the living cell. However, it has to be considered that the expression has to be driven by strong promoters and that the interaction partners are modified due to fusion of the relatively large fluorescence tags, which might interfere with the interaction mechanism. Nevertheless, BiFC is an excellent complementary approach to other commonly applied methods investigating protein-protein interactions, such as coimmunoprecipitation, in vitro pull-down assays or yeast-two-hybrid experiments.

Formation of protein complexes in vivo can be visualized by bimolecular fluorescence complementation. Interaction partners are fused to complementary parts of fluorescent tags and transiently expressed in tobacco leaves, resulting in a reconstituted fluorescent signal upon close proximity of the two proteins.

Tütün protoplastlarında ve Yapraklar Bimoleküler Floresan tamamlama tarafından Visualized protein-protein etkileşimleri

Many proteins interact transiently with other proteins or are integrated into multi-protein complexes to perform their biological function. Bimolecular ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Arabidopsis Protein-DNA Etkileşimleri Tespiti için Kromatin Immunoprecipitation Deneyi<em&gt; İn Vivo</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel protein-protein interaction pairs and monitoring protein interaction dynamics are of particular interest for revealing how plants respond to environmental factors and/or developmental signals. A plethora of approaches have been developed to examine protein-protein interactions, either in vitro or in vivo. Among them, the recently established luciferase complementation imaging (LCI) assay is the simplest and fastest method for demonstrating in vivo protein-protein interactions. In this assay, protein A or protein B is fused with the amino-terminal or carboxyl-terminal half of luciferase, respectively. When protein A interacts with protein B, the two halves of luciferase will be reconstituted to form a functional and active luciferase enzyme. Luciferase activity can be recorded with a luminometer or CCD-camera. Compared with other approaches, the LCI assay shows protein-protein interactions both qualitatively and quantitatively. Agrobacterium infiltration in Nicotiana benthamiana leaves is a widely used system for transient protein expression. With the combination of LCI and transient expression, these approaches show that the physical interaction between COP1 and SPA1 was gradually reduced after jasmonate treatment.

Luciferase Complementation Imaging Assay in Nicotiana benthamiana Leaves for Transiently Determining Protein-protein Interaction Dynamics

This manuscript describes an easy and rapid experimental procedure for determining protein-protein interactions based on the measurement of luciferase activity.

Luciferase tamamlayıcı Imaging tahlil Nicotiana benthamiana yaprakları Protein-protein etkileşim Dynamics geçici belirlenmesi için

Protein-protein interactions are fundamental mechanisms for relaying signal transduction in most cellular processes; therefore, identification of novel ...