This study was supported by the Intramural Research Program of the National Institutes of Health, National Institute on Aging. The authors wish to thank Myriam Gorospe and Kotb Abdelmohsen for many helpful discussions about senescence and Kotb Abdelmohsen for also critically reading the manuscript. We also thank our laboratory members, especially Douglas Dluzen for critically reading the manuscript.

The authors have nothing to disclose.

Here, we have described methods for replicative and DNA-damage induced senescence using human diploid fibroblasts. In addition, techniques for quantifying protein and mRNA levels of various senescence-associated proteins are included, as well as staining for SA-&#946;-gal and for the DNA-damage marker &#947;-H2AX. These protocols can be widely used to assess senescent phenotypes both in vitro and in vivo, although many caveats exist for characterizing senescence in vivo20. Other cells may express senescent markers, even if they are not senescent cells. For example, cells such as osteoclasts and macrophages have higher levels of &#946;-gal activity32,33. In addition, many cancer cells have upregulated p16INK4A 34. Cells can also accumulate DNA damage (e.g., &#947;-H2AX foci) and not be senescent. SASP factors can also be upregulated by various normal physiological or pathological conditions that may or may not involve senescent cells. Therefore, multiple senescence markers should be utilized, especially when assessing senescence in vivo.
Although senescent cells were found to be increased in normal aging tissues more than 20 years ago4, it is only now that we are fully appreciating the plethora of roles that senescent cells play in both normal tissue homeostasis and in pathological conditions. The recent employment of mouse models to eliminate p16INK4A-positive senescent cells has allowed researchers to more clearly and precisely appreciate the role of senescent cells in tissues and organs35,36,37. These models have uncovered that senescent cells contribute to a multitude of age-related pathologies, tumorigenesis, and mouse lifespan35,36,37. Given these recent discoveries and the validation of the importance of senescent cells in physiology, the time is ripe for more research on these specific cells. For example, studies employing strategies to therapeutically remove senescent cells or to delay senescence could be beneficial for both healthspan and lifespan studies.
Recently, our laboratory found that metformin, a drug commonly used to treat type 2 diabetes mellitus, decreases cellular senescence38. As metformin is currently being proposed as an anti-aging therapy and has anti-cancer properties39,40, it will be interesting in the future to explore whether this drug, or other aging interventions, affect health outcomes by modulating cellular senescence.
The protocols we discuss here are common and widely accepted techniques to assess the senescent phenotype. For cells grown in vitro, it is critical to monitor cell changes from a spindle-like to a flattened morphology in order to ensure that the cells are senescent (See Figures 1 &#38; 2). If cells are not positive for SA-&#946;-gal or other markers described here, assess senescence at higher cell PDLs (for replicative senescence) or at an increased time after DNA damage-induced senescence. In addition, these protocols may need to be optimized for different cell types. For assessing SASP protein levels, it is critical to remove the serum from the cell medium, as this will cause high background levels in the ELISA or protein arrays. Therefore, keep this in mind when designing experiments, as it may not be ideal for simultaneously assessing multiple markers.
Staining for SA-&#946;-gal, as described here, is limited by the fact that it requires the fixation of the cells. In addition, cell confluence has been shown to influence SA-&#946;-gal activity. Protocols have been developed to assess SA-&#946;-Gal activity using a fluorogenic substrate for &#946;-gal activity, which allows for the quantification of this marker in live cells using flow cytometry41,42,43. SA-&#946;-gal activity can also be measured in cell lysates using a chemiluminescent method44. In addition, &#947;-H2AX can also be measured using various other methods, including flow cytometry or the immunoblotting of cell lysates45.
It should be noted that SAHF formation is cell-line dependent and is mostly associated with oncogene-induced senescence20,30,46. Therefore, SAHF may not be present in all senescence models. The utility of SAHF as a senescent marker in mouse models may also be limited by the fact that SAHF is generally not observed in mouse senescent cells30,46,47. Here, antibodies against H3K9Me2 were used, but other molecular markers of SAHF can be used, including macroH2A, high mobility group A (HMGA) proteins, and tri-methylated lysine 9 histone H3 (H3K9Me3) and bound HP1 proteins. In addition, chromatin immunoprecipitation assays can be used to assess histone marks or the association of chromatin binding proteins to E2F target genes.
One should be aware that there are various limitations to characterizing senescence, including heterogeneity for markers and the fact that these markers are not expressed exclusively in senescent cells. Multiple (in general, 2 - 3) markers should be employed to assess senescence, including markers not described here. For example, DNA-SCARS, telomere damage, and/or DNA damage signaling can also be quantified. Furthermore, as senescence and, in particular, the SASP phenotype, has recently been shown to be affected by the specific stressor or damage that induces senescence11,12,13, it is important to assess multiple markers in each experimental paradigm.

Over half a century ago, Hayflick and colleagues described how untransformed cells proliferate in culture, but for only a finite period of time1. Long-term culturing of human fibroblasts caused the cells to stop proliferating; however, they were metabolically active, and this was called cellular senescence. Senescence can be beneficial for inhibiting tumorigenesis, but it also can be detrimental, as it is thought to contribute to the loss of regenerative capacity that occurs with aging2,3. Senescent cells have been shown to accumulate in tissues as humans age4 and have been implicated in a number of biological processes, including embryonic development, wound healing, tissue repair, and age-related inflammation2.
Continual passaging of cells in culture induces replicative senescence, which has been linked to telomere attrition and genomic instability. Various cell stresses, including DNA damage and oncogenes, can also cause senescence3. Senescence caused by factors other than telomere attrition is often called stress-induced or premature senescence and generally depends on the p16INK4A/Rb pathway5. Although proliferating, untransformed cells typically appear spindle in shape, senescent cells can be identified as having certain characteristics, including a flat, large morphology and increased senescence-associated &#946;-galactosidase activity (SA-&#946;-gal) (Figures 1 &#38; 2). Senescent cells also accumulate DNA damage markers, including &#947;-H2AX (Figure 3)6, and, potentially, senescence-associated heterochromatin foci (SAHF) (Figure 4)7. Senescent cells have higher levels of cell cycle regulators, including p16 (p16INK4A) and/or p21 and p53 (Figure 5)8,9. Moreover, recent data have shown that senescent cells can have non-autonomous effects by secreting a number of pro-inflammatory cytokines and chemokines called the senescence-associated secretory phenotype (SASP)10. Although this SASP phenomenon may vary from cell type to cell type, in general, it is demonstrated by an increase in Interleukin-6 (IL-6), IL-8, granulocyte-macrophage colony stimulating factor (GM-CSF), growth-regulated oncogene &#945; (GRO-&#945;), and GRO-&#946;, among others (Figure 6). The particular stress or damage that induces senescence may also influence the secretory phenotype11,12,13. SASP can be detected by measuring the levels of secreted proteins using ELISAs or cytokine/protein arrays10,14. Although post-transcriptional mechanisms can regulate SASP protein levels11,15,16,17, changes in mRNA levels can also be detected in many cases. These changes are generally more sensitive and easier to quantify than protein level measurements. Other senescent markers can also be assessed, including persistent DNA damage nuclear foci, called DNA segments with chromatin alterations reinforcing senescence (DNA-SCARS)18, and various other markers3,19,20.
Here, we describe common techniques for inducing senescence in cells in culture and also for measuring several markers of senescence, including SA-&#946;-Gal, &#947;-H2AX, SAHF, and the protein and mRNA of senescence-associated molecules.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% Tris-glycine gels</td>
			<td>Invitrogen</td>
			<td colspan="2">XP00160BOX</td>
		</tr>
		<tr>
			<td>Acid-Phenol ChCl3</td>
			<td>Ambion</td>
			<td>AM9720</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa-Fluor 568 goat anti-mouse antibody</td>
			<td>Invitrogen</td>
			<td>A11031</td>
			<td>1:300 dilution</td>
		</tr>
		<tr>
			<td>Cell lifters</td>
			<td>Corning Inc.</td>
			<td>3008</td>
			<td>Cell scraper</td>
		</tr>
		<tr>
			<td>ECL anti-mouse HRP linked antibody</td>
			<td>Amersham</td>
			<td>NA931V</td>
			<td></td>
		</tr>
		<tr>
			<td>ECL Plus Western Blotting Substrate</td>
			<td>Pierce</td>
			<td>32132</td>
			<td>ECL</td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Molecular Probes</td>
			<td>MP01306</td>
			<td>stock 5 mg/ml in dH2O</td>
		</tr>
		<tr>
			<td>GAPDH antibody</td>
			<td>Santa Cruz</td>
			<td>sc-32233</td>
			<td>1:1,000-5,000 dilution</td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td></td>
		</tr>
		<tr>
			<td>Histone H3 dimethyl K9 monoclonal antibody</td>
			<td>Abcam</td>
			<td>1220</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>Human IL-6 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D6050</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-8 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D8000C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human GROa Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>DRG00</td>
			<td></td>
		</tr>
		<tr>
			<td>N-N-dimethylformamide&#160;</td>
			<td>Sigma</td>
			<td>D4551</td>
			<td>DMF</td>
		</tr>
		<tr>
			<td>p16 monoclonal antibody</td>
			<td>BD Biosciences</td>
			<td>51-1325gr</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>p21 monoclonal antibody</td>
			<td>Millipore</td>
			<td>05-345</td>
			<td>1:750 dilution</td>
		</tr>
		<tr>
			<td>p53 monoclonal antibody</td>
			<td>Santa Cruz</td>
			<td>sc-126</td>
			<td>1:500 dilution clone DO-1</td>
		</tr>
		<tr>
			<td>phospho-H2AX (Ser139) FITC conjugate antibody</td>
			<td>Cell Signaling</td>
			<td>9719</td>
			<td>1:2000 dilution</td>
		</tr>
		<tr>
			<td>POWER SYBR-green PCR master mix&#160;</td>
			<td>Applied Biosystems</td>
			<td>4367659</td>
			<td></td>
		</tr>
		<tr>
			<td>Pre-stained molecular weight markers</td>
			<td>Biorad</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade&#160;</td>
			<td>Invitrogen</td>
			<td>P36930</td>
			<td></td>
		</tr>
		<tr>
			<td>PVDF membrane&#160;</td>
			<td>Thermo Scientific</td>
			<td>88518</td>
			<td></td>
		</tr>
		<tr>
			<td>Senescence b-Galactosidase Staining Kit</td>
			<td>Cell Signaling</td>
			<td>9860</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Ambion/Life Tech</td>
			<td>10296028</td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques to induce and quantify cellular senescence

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed cellular senescence. Accumulation of senescent cells occurs with organismal aging and through continual culturing in vitro. Senescent cells influence many biological processes, including embryonic development, tissue repair and regeneration, tumor suppression, and aging. Hallmarks of senescent cells include, but are not limited to, increased senescence-associated &#946;-galactosidase activity (SA-&#946;-gal); p16INK4A, p53, and p21 levels; higher levels of DNA damage, including &#947;-H2AX; the formation of Senescence-associated Heterochromatin Foci (SAHF); and the acquisition of a Senescence-associated Secretory Phenotype (SASP), a phenomenon characterized by the secretion of a number of pro-inflammatory cytokines and signaling molecules. Here, we describe protocols for both replicative and DNA damage-induced senescence in cultured cells. In addition, we highlight techniques to monitor the senescent phenotype using several senescence-associated markers, including SA-&#946;-gal, &#947;-H2AX and SAHF staining, and to quantify protein and mRNA levels of cell cycle regulators and SASP factors. These methods can be applied to the assessment of senescence in various models and tissues.

Figures 2 - 6 show representative results from SA-&#946;-gal staining; staining for &#947;-H2AX and SAHF; assessment of protein levels of p16INK4A, p21, and p53; and mRNA and protein levels of senescent-associated molecules. Increased SA-&#946;-gal staining occurs with replicative and DNA damage-induced senescence. Also, observe the morphological changes that occur with senescence. Cells become enlarged and flat compared to the spindle appearance of proliferating fibroblasts. For this experimental paradigm, cells were stained and RNA/protein were isolated 7 d after IR exposure. More robust results may occur by waiting longer after IR exposure (i.e.&#160;10 d). Conditions need to be determined for each condition and experimental setup. These results are representative and these markers can also be detected when senescence is induced using other methods.
For Figure 6, gene names are listed and correspond to CXCL1 (GRO&#945;), CXCL2 (GRO&#946;), and CSF2 (GM-CSF). The upregulation of mRNA levels of some, but not all, of the SASP factors were observed after IR-induced senescence in WI-38 cells. Other senescence-associated mRNAs, including CDKN1A (encodes p21) and CDKN2A (encodes p16INK4A), were upregulated. Other mRNAs (EDN1 and ANKRD1) have also been included and have previously been shown to be higher in senescent cells15. Primers are listed in Table 1.
<img alt="Figure 1" src="/files/ftp_upload/55533/55533fig1.jpg" /> 
Figure 1: Proliferating and Senescent Fibroblasts. A schematic representation of proliferating (left) and senescent (right) fibroblasts. Examples of senescence inducers are shown in the yellow box. Senescence is associated with higher levels of the indicated markers. SA-&#946;-gal, senescence-associated &#946;-galactosidase activity; SASP, senescence-associated secretory phenotype; SAHF, senescence-associated heterochromatin foci; DDR, DNA-damage response. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig1large.jpg" target="_blank">Please click here to view a larger version of this figure</a>
<img alt="Figure 2" src="/files/ftp_upload/55533/55533fig2.jpg" /> 
Figure 2. Morphological Characteristics and Increased SA-&#946;-gal Activity of Senescent Cells. WI-38 cells, either proliferating &#34;young&#34; (PDL 27), replicative senescent (PDL 40), or those exposed to ionizing radiation (IR), were stained for SA-&#946;-gal activity. IMR-90 cells, either proliferating &#34;young&#34; (PDL 30), replicative senescent (PDL 52), or those exposed to ionizing radiation (IR), were stained for SA-&#946;-gal activity. Sections 1 - 2 describe inducing replicative and DNA damage-induced senescence, and Section 3 explains staining for SA-&#946;-gal. Cells were stained 7 d after IR. Con, control. Scale bar = 50 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55533/55533fig3.jpg" /> 
Figure 3. Increased &#947;-H2AX Foci in Senescent Cells. WI-38 cells, either proliferating &#34;young&#34; (PDL 30) or replicative senescent (PDL 53), were fixed and stained with anti-&#947;-H2AX antibodies and DAPI. Note the increase in the number of &#947;-H2AX foci in senescent cells. Images were obtained on a confocal microscope. Z-sections were taken, and the maximum intensity projection was used to obtain a single plane image to visualize all detectable foci. Scale bar = 20 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/55533/55533fig4.jpg" /> 
Figure 4. Fluorescent Staining of SAHF in Senescent Cells. (A) Proliferating WI-38 cells (PDL 27) were untreated or exposed to ionizing radiation (IR). After 10 days, the cells were stained with DAPI to visualize SAHF (note dense/punctate DAPI staining in IR-treated cells) (B) IDH4 were grown in the presence of dexamethasone (proliferating) or in charcoal-stripped FBS to induce senescence (senescent). After 10 d, the cells were stained with antibodies against H3K9Me2 and DAPI. Images were obtained on a confocal microscope. Z-sections were taken, and the maximum-intensity projection was used to obtain a single-plane image. Proliferating cells in (A) and (B) have diffuse DAPI staining, whereas senescent cells have punctate DAPI staining. In (B), control cells have diffuse, very light staining for H3K9Me2, whereas H3K9Me2 staining is more robust and colocalizes with DAPI-stained foci in senescent cells. Scale bar = 20 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/55533/55533fig5.jpg" /> 
Figure 5. Quantification of Senescence-associated Proteins. Protein was isolated from either proliferating &#34;young&#34; (PDL 30) IMR-90 cells (-) or IMR-90 cells that were exposed to 10 Gy of ionizing radiation (IR). The medium was changed every 48 h and the cells were lysed 7 d after IR. Samples were analyzed by SDS-PAGE, immunoblotted with anti-p16INK4A antibodies, and re-probed with anti-p21 and then anti-p53 antibodies. GAPDH was used as a protein loading control. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/55533/55533fig6.jpg" /> 
Figure 6. Quantification of Senescence-associated mRNAs and SASP Proteins. (A) RNA was isolated from either proliferating &#34;young&#34; (PDL 27 or 34) WI-38 cells (-) or WI-38 cells that were exposed to 10 Gy of ionizing radiation (IR). The medium was changed every 48 h and RNA isolation was performed 7 d after IR. RT-qPCR was used to quantify the levels of the indicated senescence-associated mRNAs using the gene-specific primers listed in Table 1. 18S levels were used for normalization. The histograms represent the mean normalized to untreated &#177;SEM from 5 independent experiments. (B) WI-38 cells (PDL 26) were exposed to 10 Gy of IR; 10 d later, the medium was changed to serum-free medium (see Section 7). After 24 h, conditioned medium was collected and IL-6, IL-8, and GRO&#945; levels were quantified using ELISA assays. The histogram represents the mean &#177;SEM from 3 experiments. * P&#160;&#60; 0.05 and *** P&#160;&#60; 0.001 by Student&#39;s t-test. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Human Primers</td>
			<td>Forward</td>
			<td>Reverse</td>
		</tr>
		<tr>
			<td>18S</td>
			<td>CCCTATCAACTTTCGATGGTAGTCG</td>
			<td>CCAATGGATCCTCGTTAAAGGATTT</td>
		</tr>
		<tr>
			<td>ANKRD1</td>
			<td>AGT AGA GGA ACT GGT CACTGG</td>
			<td>TGG GCT AGA AGT GTCTTC AGA T</td>
		</tr>
		<tr>
			<td>CDKN1A (p21)</td>
			<td>GAC ACCACT GGA GGG TGA CT</td>
			<td>CAGGTC CAC ATG GTC TTC CT</td>
		</tr>
		<tr>
			<td>CDKN2A (p16)</td>
			<td>CCAACGCACCGAATAGTTACG</td>
			<td>GCGCTGCCCATCATCATG</td>
		</tr>
		<tr>
			<td>CSF2 (GM-CSF)</td>
			<td>GGCCCCTTGACCATGATG</td>
			<td>TCTGGGTTGCACAGGAAGTTT</td>
		</tr>
		<tr>
			<td>CXCL1</td>
			<td>GAAAGCTTGCCTCAATCCTG</td>
			<td>CACCAGTGAGCTTCCTCCTC</td>
		</tr>
		<tr>
			<td>CXCL2</td>
			<td>AACTGCGCTGCCAGTGCT</td>
			<td>CCCATTCTTGAGTGTGGCTA</td>
		</tr>
		<tr>
			<td>EDN1</td>
			<td>CAG CAGTCT TAG GCG CTG AG</td>
			<td>ACTCTT TAT CCA TCA GGG ACG AG</td>
		</tr>
		<tr>
			<td>IL6</td>
			<td>CCGGGAACGAAAGAGAAGCT</td>
			<td>GCGCTTGTGGAGAAGGAGTT</td>
		</tr>
		<tr>
			<td>IL7</td>
			<td>CTCCAGTTGCGGTCATCATG</td>
			<td>GAGGAAGTCCAAAGATATACCTAAAAGAA</td>
		</tr>
		<tr>
			<td>IL8</td>
			<td>CTTTCCACCCCAAATTTATCAAAG</td>
			<td>CAGACAGAGCTCTCTTCCATCAGA</td>
		</tr>
	</tbody>
</table>
Table 1: RT-qPCR Primers for Senescence-associated mRNAs. Forward and reverse primers for RT-qPCR using SYBR-green technology are indicated.

Watch this Scientific Journal Video about Techniques to Induce and Quantify Cellular Senescence at JoVE.com

Techniques to Induce and Quantify Cellular Senescence

Cellular senescence, the irreversible state of cell-cycle arrest, can be induced by various cellular stresses. Here, we describe protocols to induce cellular senescence and methods to assess markers of senescence.

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed ...

techniques-to-induce-and-quantify-cellular-senescence

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Cell Proliferation

SCIENTISTS IN ACTION

32.9K Views.  National Institute on Aging, National Institutes of Health. Cellular senescence, the irreversible state of cell-cycle arrest, can be induced by various cellular stresses. Here, we describe protocols to induce cellular senescence and methods to assess markers of senescence.

Video: Techniques to Induce and Quantify Cellular Senescence

BioMEMS and Cellular Biology: Perspectives and Applications

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in drug screening, toxicology, and clinical assays, and is increasingly used in regenerative medicine. However, the traditional cell culture methodology   essentially consisting of the immersion of a large population of cells in a homogeneous fluid medium and on a homogeneous flat substrate   has become increasingly limiting both from a fundamental and practical perspective. Microfabrication technologies have enabled researchers to design, with micrometer control, the biochemical composition and topology of the substrate, and the medium composition, as well as the neighboring cell type in the surrounding cellular microenvironment. Additionally, microtechnology is conceptually well-suited for the development of fast, low-cost in vitro systems that allow for high-throughput culturing and analysis of cells under large numbers of conditions. In this interview, Albert Folch explains these limitations, how they can be overcome with soft lithography and microfluidics, and describes some relevant examples of research in his lab and future directions.

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in ...

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution of existing proteins, and the assembly of new protein complexes can be stimulated by a variety of DNA lesions and mismatched DNA base pairs. Fluorescence microscopy has been used as a powerful experimental tool for visualizing and quantifying these and other responses to DNA lesions and to monitor DNA replication status within the complex subcellular architecture of a living cell. Translational fusions between fluorescent reporter proteins and components of the DNA replication and repair machinery have been used to determine the cues that target DNA repair proteins to their cognate lesions in vivo and to understand how these proteins are organized within bacterial cells. In addition, transcriptional and translational fusions linked to DNA damage inducible promoters have revealed which cells within a population have activated genotoxic stress responses. In this review, we provide a detailed protocol for using fluorescence microscopy to image the assembly of DNA repair and DNA replication complexes in single bacterial cells. In particular, this work focuses on imaging mismatch repair proteins, homologous recombination, DNA replication and an SOS-inducible protein in Bacillus subtilis. All of the procedures described here are easily amenable for imaging protein complexes in a variety of bacterial species.

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

A detailed protocol is described for imaging the real time formation of DNA repair complexes in Bacillus subtilis cells.

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution ...

Aseptic Laboratory Techniques: Plating Methods

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: 
 
&#9679; Perform plating procedures without contaminating media. 
&#9679; Isolate single bacterial colonies by the streak-plating method. 
&#9679; Use pour-plating and spread-plating methods to determine the concentration of bacteria. 
&#9679; Perform soft agar overlays when working with phage. 
&#9679; Transfer bacterial cells from one plate to another using the replica-plating procedure. 
&#9679; Given an experimental task, select the appropriate plating method.

When working with media and reagents used to culture microorganisms, aseptic technique must be practiced to ensure contamination is minimized. A variety of plating methods are routinely used to isolate, propagate, or enumerate bacteria and phage, all of which incorporate procedures that maintain the sterility of experimental materials.

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies ...

Telomere Length and Telomerase Activity; A Yin and Yang of Cell Senescence

Telomeres are repeating DNA sequences at the tip ends of the chromosomes that are diverse in length and in humans can reach a length of 15,000 base pairs. The telomere serves as a bioprotective mechanism of chromosome attrition at each cell division. At a certain length, telomeres become too short to allow replication, a process that may lead to chromosome instability or cell death. Telomere length is regulated by two opposing mechanisms: attrition and elongation. Attrition occurs as each cell divides. In contrast, elongation is partially modulated by the enzyme telomerase, which adds repeating sequences to the ends of the chromosomes. In this way, telomerase could possibly reverse an aging mechanism and rejuvenates cell viability. These are crucial elements in maintaining cell life and are used to assess cellular aging. In this manuscript we will describe an accurate, short, sophisticated and cheap method to assess telomere length in multiple tissues and species. This method takes advantage of two key elements, the tandem repeat of the telomere sequence and the sensitivity of the qRT-PCR to detect differential copy numbers of tested samples. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

An accurate, short, sophisticated and cheap method is described that assesses telomere length in multiple tissues and species using qRT-PCR. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

Telomeres  are repeating DNA sequences at the tip ends of the chromosomes that are diverse  in length and in humans can reach a length of 15,000 base ...

Simple and Effective Administration and Visualization of Microparticles in the Circulatory System of Small Fishes Using Kidney Injection

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, implantation of transgenic cells and tiny optical sensors. However, intravenous microinjections into small animals, which are mostly used in biological and veterinary laboratories, are very difficult and require trained personnel. Herein, we demonstrate a robust and efficient method for the introduction of microparticles into the circulatory system of adult zebrafish (Danio rerio) by injection into the fish kidney. To visualize the introduced microparticles in the vasculature, we propose a simple intravital imaging technique in fish gills. In vivo monitoring of the zebrafish blood pH was accomplished using an injected microencapsulated fluorescent probe, SNARF-1, to demonstrate one of the possible applications of the described technique. This article provides a detailed description of the encapsulation of pH-sensitive dye and demonstrates the principles of the quick injection and visualization of the obtained microcapsules for in vivo recording of the fluorescent signal. The proposed method of injection is characterized by a low mortality rate (0-20%) and high efficiency (70-90% success), and it is easy to institute using commonly available equipment. All described procedures can be performed on other small fish species, such as guppies and medaka.

This article demonstrates the principles of a quick, minimally invasive injection of fluorescent microparticles into the circulatory system of small fishes and the in vivo visualization of the microparticles in fish blood.

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, ...

Nasal Potential Difference to Quantify Trans-epithelial Ion Transport in Mice

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful in cases of attenuated, oligo- or mono-symptomatic forms of CF usually diagnosed later in life, and of CF-related disorders such as congenital bilateral absence of vas deferens, idiopathic chronic pancreatitis, allergic bronchopulmonary aspergillosis, and bronchiectasis. In both clinical and preclinical settings, the test has been used as a biomarker to quantify responses to targeted therapeutic strategies for CF. Adapting the test to a mouse is challenging and can entail an associated mortality. This paper describes the adequate depth of anesthesia required to maintain a nasal catheter in situ for continuous perfusion. It lists measures to avoid broncho-aspiration of solutions perfused in the nose. It also describes the animal care at the end of the test, including administration of a combination of antidotes of the anesthetic drugs, leading to rapidly reversing the anesthesia with full recovery of the animals. Representative data obtained from a CF and a wild-type mouse show that the test discriminates between CF and non-CF. Altogether, the protocol described here allows reliable measurements of the functional status of trans-epithelial chloride and sodium transporters in spontaneously breathing mice, as well as multiple tests in the same animal while reducing test-related mortality.

Here, we present a protocol to measure nasal potential difference in mice. The test quantifies the function of transmembrane ion transporters such as the cystic fibrosis transmembrane conductance regulator and the epithelial sodium channel. It is valuable to evaluate the efficacy of novel therapies for cystic fibrosis.

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful ...

Bovine Mammary Gland Biopsy Techniques

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, signaling pathways, and protein translation. This article describes two techniques for biopsy of the bovine mammary gland (MG). Three healthy Holstein dairy cows were the subjects. Before biopsies, cows were milked and subsequently restrained in a cattle chute. An analgesic (flunixin meglumine, 1.1 to 2.2 mg/kg of body weight) was administered via jugular intravenous [IV] injection 15-20 min prior to biopsy. For standing sedation, xylazine hydrochloride (0.01-0.05 mg/kg of body weight) was injected via the coccygeal vessels 5-10 min before the procedure. Once adequately sedated, the biopsy site was aseptically prepared and locally anaesthetized with 6 mL of 2% lidocaine hydrochloride via subcutaneous injection. Using aseptic technique, a 2 to 3 cm vertical incision was made using a number 10 scalpel. Core and needle biopsy tools were used. The core biopsy tool was attached to a cordless drill and inserted into the MG tissue through the incision using a clock-wise drill action. The needle biopsy tool was manually inserted into the incision site. Immediately after the procedure, an assistant applied pressure on the incision site for 20 to 25 min using a sterile towel to achieve hemostasis. Stainless steel surgical staples were used to oppose the skin incision. The staples were removed 10 days post-procedure. The main advantages of core and needle biopsies is that both approaches are minimally invasive procedures that can be safely performed in healthy cows. Milk yield following the biopsy was unaffected. These procedures require a short recovery time and result in fewer risks of complications. Specific limitations may include bleeding after the biopsy and infection on the biopsy site. Applications of these techniques include tissue collection for clinical diagnosis and research purposes, such as primary cell culture.

This article presents a bovine mammary gland biopsy using core and needle biopsy tools. Harvested tissue can be used for cell culture or to assess mammary physiology and metabolism including gene expression, protein expression, protein modifications, immunohistochemistry, and metabolite concentrations.

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, ...

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires careful and in-depth analyses and quantification to capture as much information about the underlying events as possible. Spatial, temporal and intensity parameters intrinsic to Ca2+ signals such as frequency, duration, propagation, velocity and amplitude may provide some biological information required for intracellular signalling. High-resolution Ca2+ imaging typically results in the acquisition of large data files that are time consuming to process in terms of translating the imaging information into quantifiable data, and this process can be susceptible to human error and bias. Analysis of Ca2+ signals from cells in situ typically relies on simple intensity measurements from arbitrarily selected regions of interest (ROI) within a field of view (FOV). This approach ignores much of the important signaling information contained in the FOV. Thus, in order to maximize recovery of information from such high-resolution recordings obtained with Ca2+dyes or optogenetic Ca2+ imaging, appropriate spatial and temporal analysis of the Ca2+ signals is required. The protocols outlined in this paper will describe how a high volume of data can be obtained from Ca2+ imaging recordings to facilitate more complete analysis and quantification of Ca2+ signals recorded from cells using a combination of spatiotemporal map (STM)-based analysis and particle-based analysis. The protocols also describe how different patterns of Ca2+ signaling observed in different cell populations in situ can be analyzed appropriately. For illustration, the method will examine Ca2+ signaling in a specialized population of cells in the small intestine, interstitial cells of Cajal (ICC), using GECIs.

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Genetically encoded Ca2+ indicators (GECIs) have radically changed how in situ Ca2+ imaging is performed. To maximize data recovery from such recordings, appropriate analysis of Ca2+ signals is required. The protocols in this paper facilitate the quantification of Ca2+ signals recorded in situ using spatiotemporal mapping and particle-based analysis.

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires ...

Immunohistochemistry Techniques to Analyze Cellular Proliferation and Neurogenesis in Rats Using the Thymidine Analog BrdU

One of the most important things in the field of adult hippocampal neurogenesis (AHN) is the identification of the newly generated cells. The immunodetection of thymidine analogs (such as 5-Bromo-2&#39;-deoxyuridine (BrdU)) is a standard technique used for visualizing these newly generated cells. Therefore, BrdU is usually injected in small animals intraperitoneally, so the thymidine analog gets incorporated into dividing cells during DNA synthesis. Detection is performed by immunohistochemical analysis of brain slices. Every research group that has been using this technique can appreciate that it requires special attention to minute details to achieve a successful stain. For instance, an important step is DNA denaturation with HCl, which allows it to reach the cell nucleus to stain it. However, the existing scientific reports describe very few of such steps in detail. Therefore, standardizing the technique is challenging for new laboratories as it can take several months to yield positive and successful outcomes. The purpose of this work is to describe and elaborate the steps to obtain positive and successful outcomes of the immunostaining technique in detail when working with the thymidine analog BrdU. The protocol includes the reagent preparation and setup, administration of thymidine analog in a rodent, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, use of avidin-biotin complex, immunofluorescence, counterstaining, microscopy imaging, and cell analysis.

This paper presents four of the most common techniques for visualizing BrdU positive cells to measure adult neurogenesis in rats. This work includes instructions for reagent preparation, thymidine analog administration, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, immunofluorescence, signal amplification, counterstaining, microscopy imaging, and cell analysis.