Diese Studie wurde von der Intramural Research Program der National Institutes of Health, National Institute on Aging. Die Autoren möchten Myriam Gorospe und Kotb Abdelmohsen für viele hilfreiche Diskussionen über die Seneszenz und Kotb Abdelmohsen für auch kritisch Lesen des Manuskripts. Wir danken auch unser Labor Mitglieder, vor allem Douglas Dluzen für kritisch, das Manuskript zu lesen.

Die Autoren haben nichts zu offenbaren.

unter Verwendung von humanen diploiden Fibroblasten Hier haben wir Methoden zur replikativen und DNA-Schädigung induzierte Seneszenz beschrieben. Zusätzlich sind Techniken zum Protein- und mRNA-Mengen verschiedenen Seneszenz-assoziierte Proteine ​​Quantifizieren enthalten sind, sowie Färbung für SA-β-gal und für den DNA-Schädigung Marker γ-H2AX. Diese Protokolle können weit seneszenten Phänotypen verwendet werden , sowohl in vitro zu bewerten und in vivo, obwohl viele Einschränkungen bestehen für die Charakterisierung von Seneszenz in vivo 20. Andere Zellen können seneszenten Marker exprimieren, auch wenn sie nicht seneszenten Zellen sind. Beispielsweise können Zellen, wie Osteoklasten und Makrophagen haben höhere β-gal - Aktivität 32, 33. Darüber hinaus haben viele Krebszellen p16 INK4A 34 nach oben reguliert. Die Zellen können akkumulieren auch DNA - Schäden (zB γ-H2AX Foci) und nicht seneszenten sein. SASP Faktoren können auch von oben reguliert werdenverschiedene normale physiologische oder pathologische Zustände, die oder nicht seneszenten Zellen beinhalten kann. Daher sollten mehrere Seneszenz Marker verwendet werden, vor allem , wenn Seneszenz in vivo zu bewerten. Obwohl seneszenten Zellen gefunden wurden vor 4 in normalen Alterungs Geweben mehr als 20 Jahren erhöht werden sollen, ist es erst jetzt , dass wir voll und ganz die Fülle von Rollen zu schätzen , dass alternde Zellen sowohl in normalen Gewebe Homöostase und bei pathologischen Zuständen spielen. Die kürzliche Beschäftigung von Mausmodellen p16 INK4A -positiver seneszenten Zellen zu eliminieren , hat Forscher deutlicher erlaubt und schätzt genau die Rolle der seneszenten Zellen in Geweben und Organen 35, 36, 37. Diese Modelle haben aufgedeckt , dass alternde Zellen zu einer Vielzahl von altersbedingten Krankheiten, Tumorentstehung beitragen und Maus Lebensdauer 35 &lt;/ sup&gt;, 36, 37. In Anbetracht dieser jüngsten Entdeckungen und die Validierung der Bedeutung von seneszenten Zellen in der Physiologie, ist die Zeit für mehr Forschung über diese speziellen Zellen reifen. Zum Beispiel unter Verwendung von Studien Strategien zum therapeutischen seneszenten Zellen zu entfernen oder Seneszenz zu verzögern sowohl für Gesundheitsspanne und Lebensdauer Studien von Nutzen sein könnte. Kürzlich fand unser Labor , dass Metformin, ein Medikament häufig verwendet , um Typ - 2 - Diabetes mellitus zu behandeln, nimmt zelluläre Seneszenz 38. Da Metformin derzeit als Anti-Aging - Therapie vorgeschlagen und hat Anti-Krebs - Eigenschaften 39, 40, wird es in Zukunft interessant sein , zu untersuchen , ob dieses Medikament oder andere Alterungs Interventionen, Gesundheitsergebnisse beeinflussen durch zelluläre Seneszenz zu modulieren. Die Protokolle wir hier diskutieren, sind häufig und weit verbreitet einccepted Techniken, um die seneszenten Phänotyp zu bewerten. Für Zellen in vitro gezüchtet, ist es entscheidend Zelle wechselt von einer spindelartigen auf eine abgeflachte Morphologie, um sicherzustellen , dass die Zellen , seneszenten sind (siehe Abbildungen 1 und 2) zu überwachen. Wenn Zellen nicht positiv sind für SA-β-gal oder anderen hier beschriebenen Marker, bewerten Seneszenz bei höheren Zell PDLs (für replikative Seneszenz) oder bei einem erhöhten Zeit nach DNA-Schädigung induzierte Seneszenz. Darüber hinaus müssen diese Protokolle können für verschiedene Zelltypen optimiert werden. SASP Proteinspiegel für die Bewertung ist es kritisch, das Serum aus dem Zellmedium zu entfernen, da diese hohe Hintergrundwerte in den ELISA oder Protein-Arrays verursacht. Deshalb denken Sie daran, wenn Experimente entwerfen, da es nicht für die gleichzeitige Beurteilung mehrerer Marker ideal sein kann. Die Färbung für SA-β-gal, wie hier beschrieben ist, wird durch die Tatsache, dass es die Fixierung der Zellen erfordert.Darüber hinaus wurde Zellkonfluenz gezeigt SA-β-gal-Aktivität zu beeinflussen. Protokolle wurden entwickelt , SA-β-Gal - Aktivität unter Verwendung eines fluorogenen Substrat für β-gal - Aktivität zu bewerten, die unter Verwendung von Flow Cytometry 41 für die Quantifizierung dieses Markers in lebenden Zellen ermöglicht, 42, 43. SA-β-Gal - Aktivität kann auch in Zell - Lysaten gemessen werden , 44 ein chemilumineszentes Verfahren. Darüber hinaus kann auch γ-H2AX verschiedene andere Methoden gemessen werden, einschließlich der Durchflusszytometrie oder Immunoblotting von Zelllysaten 45. Es soll beachtet werden , dass die Bildung SAHF Zelllinie abhängig ist , und wird meist in Verbindung mit Onkogen-induzierter Seneszenz 20, 30, 46. Daher kann nicht SAHF in allen Seneszenz Modellen vorhanden sein. Die NützlichkeitSAHF als seneszenten Marker in Mausmodellen auch dadurch begrenzt werden, dass SAHF wird im Allgemeinen nicht in Maus - seneszenten Zellen 30, 46, 47 beobachtet. Dabei werden Antikörper gegen H3K9Me2 wurden verwendet, aber auch andere molekulare Marker von SAHF können verwendet werden, einschließlich macroH2A, High Mobility Group A (HMGA) Proteine ​​und tri-methylierten Lysin 9 Histon H3 (H3K9me3) und gebundene HP1-Proteine. Bindungsproteine ​​zu E2F Zielgen Zusätzlich kann Chromatinimmunpräzipitation Assays verwendet werden, um Histon-Markierungen oder die Assoziation von Chromatin zu beurteilen. Man sollte sich darüber im Klaren sein, dass es verschiedene Einschränkungen Seneszenz Charakterisierung einschließlich Heterogenität für Marker und die Tatsache, dass diese Marker nicht ausschließlich in seneszenten Zellen exprimiert wird. Mehrere (in der Regel 2 - 3) Marker sollte Seneszenz zu beurteilen, verwendet werden, einschließlich Markierungen hier nicht beschrieben. Zum Beispiel, DNA-SCARS, telomereSchäden und / oder Signalisierungs DNA-Schäden können auch quantifiziert werden. Ferner ist , wie Seneszenz und insbesondere, der Phänotyp SASP, wurde vor kurzem gezeigt worden , durch den spezifischen Stressor oder Beschädigung beeinträchtigt werden , die 11 Seneszenz induziert, 12, 13, ist es wichtig , mehrere Marker in jedem experimentellen Paradigma zu bewerten.

Mehr als vor einem halben Jahrhundert, Hayflick und Kollegen beschrieben , wie nicht - transformierten Zellen in Kultur vermehren, aber nur für einen begrenzten Zeitraum 1. Langzeitkultivierung von humanen Fibroblasten verursacht die Zellen vermehren zu stoppen; jedoch waren sie metabolisch aktiv, und wurde dieser zelluläre Seneszenz bezeichnet. Seneszenz können zur Hemmung der Tumorgenese von Vorteil sein, sie kann aber auch nachteilig sein, wie es angenommen wird , auf den Verlust der Regenerationsfähigkeit beizutragen , die mit dem Altern auftritt , 2, 3. Seneszenten Zellen wurden in Geweben akkumulieren gezeigt , wie Menschen im Alter von 4 und in einer Reihe von biologischen Prozessen, einschließlich der Embryonalentwicklung, Wundheilung, Gewebereparatur und altersbedingte Entzündung 2 in Verbindung gebracht. Kontinuierliche Passagierung der Zellen in Kultur induziert replikative Seneszenz, die in Verbindung gebracht wurdezu der Telomere Abrieb und genomische Instabilität. Verschiedene Zellspannungen, einschließlich DNA - Schädigung und Onkogenen, können auch Seneszenz 3 verursachen. Seneszenz verursacht durch andere Faktoren als Telomer Abrieb wird oft spannungsinduzierte oder vorzeitige Seneszenz bezeichnet und hängt im Allgemeinen von der p16 INK4A / Rb - Weg 5. Obwohl proliferierenden, typischerweise nicht - transformierten Zellen spindelförmig erscheinen, können seneszenten Zellen mit bestimmten Merkmalen identifiziert werden, einschließlich einer flache, große Morphologie und erhöhte Seneszenz-assoziierte β-Galactosidase - Aktivität (SA-β-gal) (Abbildungen 1 und 2). Seneszenten Zellen akkumulieren auch DNA - Schädigung Marker, einschließlich γ-H2AX (Abbildung 3) 6, und möglicherweise Seneszenz-assoziierte Heterochromatin Foci (SAHF) (4) 7. Seneszenten Zellen höhere Zellzyklusregulatoren, einschließlich p<html> 16 (p16 INK4A) und / oder p21 und p53 (Figur 5) 8, 9. Darüber hinaus haben jüngste Daten gezeigt , dass seneszenten Zellen nicht autonome Wirkungen durch eine Reihe von pro-inflammatorischen Zytokinen und Chemokinen sezer die Seneszenz-assoziierte sekretorischen Phänotyp (SASP) 10 genannt haben. Obwohl dieses Phänomen SASP von Zelltyp zu Zelltyp, im allgemeinen unterschiedlich sein kann, ist es durch eine Erhöhung der Interleukin-6 (IL-6), IL-8, Granulozyten-Makrophagen-Kolonie-stimulierender Faktor (GM-CSF) gezeigt, wachstums- regulierter Onkogen α (GRO-α) und GRO-β, unter anderem (Abbildung 6). Die besondere Beanspruchung oder Schäden , die Seneszenz induziert können auch Einfluss auf die sekretorischen Phänotyp 11, 12, 13. SASP kann durch Messung der Mengen an sezernierten Proteinen unter Verwendung von ELISAs oder Zytokin / Protein-Arrays detektiert werdens = &quot;xref&quot;&gt; 10, 14. Obwohl posttranskriptionale Mechanismen können SASP Proteinspiegel 11 regulieren, 15, 16, 17, Veränderungen in der mRNA - Spiegel können auch in vielen Fällen nachgewiesen werden. Diese Änderungen sind in der Regel empfindlicher und leichter zu quantifizieren als Proteinebene Messungen. Andere seneszenten Marker können auch beurteilt werden, einschließlich DNA - Schädigung persistent Kern Foci, genannt DNA - Segmente mit Chromatin Veränderungen Verstärkungs Seneszenz (DNA-SCARS) 18, und verschiedene andere Marker 3, 19, 20. Hier beschreiben wir gemeinsame Techniken für die Seneszenz in Zellen in Kultur zu induzieren und auch für mehrere Marker die Seneszenz zu messen, einschließlich SA-β-Gal, γ-H2AX, SAHF, und das Protein und mRNA von alternNOA-assoziierte Moleküle.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% Tris-glycine gels</td>
			<td>Invitrogen</td>
			<td colspan="2">XP00160BOX</td>
		</tr>
		<tr>
			<td>Acid-Phenol ChCl3</td>
			<td>Ambion</td>
			<td>AM9720</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa-Fluor 568 goat anti-mouse antibody</td>
			<td>Invitrogen</td>
			<td>A11031</td>
			<td>1:300 dilution</td>
		</tr>
		<tr>
			<td>Cell lifters</td>
			<td>Corning Inc.</td>
			<td>3008</td>
			<td>Cell scraper</td>
		</tr>
		<tr>
			<td>ECL anti-mouse HRP linked antibody</td>
			<td>Amersham</td>
			<td>NA931V</td>
			<td></td>
		</tr>
		<tr>
			<td>ECL Plus Western Blotting Substrate</td>
			<td>Pierce</td>
			<td>32132</td>
			<td>ECL</td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Molecular Probes</td>
			<td>MP01306</td>
			<td>stock 5 mg/ml in dH2O</td>
		</tr>
		<tr>
			<td>GAPDH antibody</td>
			<td>Santa Cruz</td>
			<td>sc-32233</td>
			<td>1:1,000-5,000 dilution</td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td></td>
		</tr>
		<tr>
			<td>Histone H3 dimethyl K9 monoclonal antibody</td>
			<td>Abcam</td>
			<td>1220</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>Human IL-6 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D6050</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-8 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D8000C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human GROa Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>DRG00</td>
			<td></td>
		</tr>
		<tr>
			<td>N-N-dimethylformamide&#160;</td>
			<td>Sigma</td>
			<td>D4551</td>
			<td>DMF</td>
		</tr>
		<tr>
			<td>p16 monoclonal antibody</td>
			<td>BD Biosciences</td>
			<td>51-1325gr</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>p21 monoclonal antibody</td>
			<td>Millipore</td>
			<td>05-345</td>
			<td>1:750 dilution</td>
		</tr>
		<tr>
			<td>p53 monoclonal antibody</td>
			<td>Santa Cruz</td>
			<td>sc-126</td>
			<td>1:500 dilution clone DO-1</td>
		</tr>
		<tr>
			<td>phospho-H2AX (Ser139) FITC conjugate antibody</td>
			<td>Cell Signaling</td>
			<td>9719</td>
			<td>1:2000 dilution</td>
		</tr>
		<tr>
			<td>POWER SYBR-green PCR master mix&#160;</td>
			<td>Applied Biosystems</td>
			<td>4367659</td>
			<td></td>
		</tr>
		<tr>
			<td>Pre-stained molecular weight markers</td>
			<td>Biorad</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade&#160;</td>
			<td>Invitrogen</td>
			<td>P36930</td>
			<td></td>
		</tr>
		<tr>
			<td>PVDF membrane&#160;</td>
			<td>Thermo Scientific</td>
			<td>88518</td>
			<td></td>
		</tr>
		<tr>
			<td>Senescence b-Galactosidase Staining Kit</td>
			<td>Cell Signaling</td>
			<td>9860</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Ambion/Life Tech</td>
			<td>10296028</td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques to induce and quantify cellular senescence

In Reaktion auf zellulärem Stress oder Schädigung, proliferierenden Zellen kann ein spezifisches Programm induzieren, die einen Zustand der Langzeit-Zellzyklusarrest einleitet, zelluläre Seneszenz bezeichnet. Akkumulation von seneszenten Zellen erfolgt mit organismal Altern und durch kontinuierliche Kultivierung in vitro. Seneszenten Zellen beeinflussen zahlreiche biologische Prozesse, einschließlich der embryonalen Entwicklung, Gewebereparatur und -regeneration, Tumorunterdrückung und Alterung. Kennzeichnend für seneszenten Zellen umfassen, sind aber nicht darauf beschränkt, erhöhte Seneszenz-assoziierte β-Galactosidase-Aktivität (SA-β-gal); p16 INK4A, p53, p21 und Ebene; höhere Niveaus von DNA-Schäden, einschließlich γ-H2AX; die Bildung der Seneszenz-assoziierte Heterochromatin Foci (SAHF); und der Erwerb eines Seneszenz-assoziierte Sekretorische Phenotype (PUSA), ein Phänomen, das durch die Sekretion einer Anzahl von pro-inflammatorischen Cytokinen und Signalmolekülen charakterisiert. Hier beschreiben wir Protokolle sowohl für replikativen undDNA Seneszenz in kultivierten Zellen-Schädigung induziert. Außerdem markieren Techniken, die wir den seneszenten Phänotyp mit mehreren Seneszenz-assoziierte Marker, einschließlich SA-β-gal, γ-H2AX und SAHF Färbung und zu quantifizieren Protein und mRNA-Spiegel von Zellzyklusregulatoren und SASP Faktoren zu überwachen. Diese Methoden können zur Beurteilung der Seneszenz in verschiedenen Modellen und Geweben angewandt werden.

Die Figuren 2 - 6 repräsentative Ergebnisse von SA-β-gal - Färbung zeigen; Anfärben für γ-H2AX und SAHF; Beurteilung der Proteinspiegel von p16 INK4A, p21 und p53; und mRNA und Protein-Ebene von seneszenten-assoziierte Moleküle. Erhöhter SA-β-gal-Färbung erfolgt mit replikativen und DNA-Schädigung induzierte Seneszenz. Auch beachten Sie die morphologischen Veränderungen, die mit Seneszenz auftreten. Die Zellen werden vergrößert und flach im Vergleich zu den Spindel Auftreten von wuchernden Fibroblasten. Aus diesem experimentellen Paradigma wurden die Zellen gefärbt und RNA / Protein wurde 7 d nach dem IR-Bestrahlung isoliert. Robustere Ergebnisse durch das Warten mehr nach IR - Bestrahlung (dh 10 d) auftreten können. Bedingungen müssen für jede Bedingung und Versuchsaufbau bestimmt werden. Diese Ergebnisse sind repräsentativ und diese Markierungen können auch nachgewiesen werden, wenn Seneszenz wird mit anderen Methoden induziert. 6 sind Gen - Namen aufgelistet und entsprechen CXCL1 (GRO &amp; agr;), CXCL2 (GRO) und CSF2 (GM-CSF). Die Hochregulation von mRNA-Konzentrationen von einigen, aber nicht alle der SASP Faktoren wurden nach IR-induzierter Seneszenz in WI-38-Zellen beobachtet. Andere Seneszenz-assoziierte mRNAs, einschließlich CDKN1A (kodiert p21) und CDKN2A (p16 kodiert INK4A) wurden nach oben reguliert. Andere mRNAs (EDN1 und ANKRD1) werden ebenfalls berücksichtigt und werden zuvor in seneszenten Zellen 15 höher sein gezeigt. Primer sind in Tabelle 1 aufgelistet. <img alt="Abbildung 1" src="/files/ftp_upload/55533/55533fig1.jpg" /> Abbildung 1: Proliferierende und Seneszente Fibroblasts. Eine schematische Darstellung (links) und seneszenten (rechts) Fibroblasten proliferieren. Beispiele für Seneszenz Induktoren sind in der gezeigten yellow Box. Seneszenz mit höheren Ebenen des angegebenen Markers zugeordnet ist. SA-β-gal, Seneszenz-assoziierte β-Galactosidase-Aktivität; SASP, Seneszenz-assoziierte sekretorischen Phänotyp; SAHF, Seneszenz-assoziierte Heterochromatin Foci; DDR, DNA-Schadensantwort. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig1large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen</a> <img alt="Figur 2" src="/files/ftp_upload/55533/55533fig2.jpg" /> Abbildung 2. Morphologische Merkmale und erhöhte SA-β-gal Aktivität von alternden Zellen. WI-38-Zellen, entweder &quot;jung&quot; (PDL 27), replikative seneszenten (PDL 40), oder solche, ionisierender Strahlung ausgesetzt (IR) proliferierende, wurden gefärbt für SA-β-gal-Aktivität. IMR-90-Zellen, entweder &quot;jung&quot; (PDL 30), replikative seneszenten (PDL 52) proliferierende, oder solche, ionisierender Strahlung ausgesetzt (IR) wurden die stained für SA-β-gal Aktivität. Abschnitte 1 bis 2 beschreibt induzierende replikativen und DNA-Schädigung induzierte Seneszenz, und Abschnitt 3 erläutert Färbung für SA-β-gal. Die Zellen wurden gefärbt 7 d nach der IR. Con, Kontrolle. Maßstabsbalken = 50 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 3" src="/files/ftp_upload/55533/55533fig3.jpg" /> Abbildung 3. Erhöhte γ-H2AX Foci in seneszenten Zellen. WI-38-Zellen, entweder &quot;jung&quot; (PDL 30) oder replikative seneszenten (PDL 53), wurden fixiert und mit anti-γ-H2AX Antikörper und DAPI proliferierenden. Beachten Sie die Erhöhung der Anzahl von γ-H2AX Foci in seneszenten Zellen. Bilder wurden auf einem konfokalen Mikroskop erhalten. Z-Schnitte wurden genommen, und die maximale Intensitätsprojektion wurde verwendet, um eine einzelne Ebene Bild zu erhalten, alle DETEC zur VisualisierungTabelle Brennpunkte. Maßstabsbalken = 20 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig3large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 4" src="/files/ftp_upload/55533/55533fig4.jpg" /> Abbildung 4. Fluoreszierende Anfärbung von SAHF in seneszenten Zellen. (A) Proliferierende WI-38 - Zellen (PDL 27) waren unbehandelt oder ionisierender Strahlung ausgesetzt (IR). Nach 10 Tagen wurden die Zellen mit DAPI gefärbt SAHF ( man beachte , dichte / punctata DAPI - Färbung in IR-behandelten Zellen) (B) IDH4 in Gegenwart von Dexamethason (proliferierende) oder in charcoal-stripped FBS gezüchtet Seneszenz zu induzieren , wurden sichtbar zu machen ( seneszenten). Nach 10 d wurden die Zellen mit Antikörpern gegen H3K9Me2 und DAPI gefärbt. Bilder wurden auf einem konfokalen Mikroskop erhalten. Z-Schnitte wurden genommen, und die Maximalintensitätsprojektion verwendet, wurde eine einzelne Ebene zu erhalten,Bild. Proliferierenden Zellen in (A) und (B) haben diffuse DAPI-Färbung, während seneszenten Zellen punctata DAPI-Färbung aufweisen. In (B) haben Kontrollzellen diffuse, sehr leichte Färbung für H3K9Me2, während H3K9Me2 Anfärbung robuster ist und kolokalisiert mit DAPI-gefärbten Foci in seneszenten Zellen. Maßstabsbalken = 20 um. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig4large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig4large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 5" src="/files/ftp_upload/55533/55533fig5.jpg" /> Abbildung 5 : Quantifizierung der Seneszenz-assoziierte Proteine. Das Protein wurde isoliert aus entweder wuchernden &quot;jung&quot; (PDL 30) IMR-90-Zellen (-) oder IMR-90-Zellen, die mit 10 Gy ausgesetzt wurden ionisierender Strahlung (IR). Das Medium wurde alle 48 Stunden gewechselt und die Zellen 7 d nach dem IR lysiert. Die Proben wurden durch SDS-PAGE analysiert, einem Immunoblotting mit anti-p16 INK4A Antibostirbt und wieder sondiert mit anti-p21 und dann anti-p53-Antikörper. GAPDH wurde als Proteinbeladung Kontrolle verwendet. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig5large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig5large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 6" src="/files/ftp_upload/55533/55533fig6.jpg" /> Abbildung 6. Quantifizierung der Seneszenz-assoziierte mRNAs und Proteine SASP. (-) oder WI-38 - Zellen, die mit 10 Gy ionisierender Strahlung (IR) ausgesetzt wurden (A) RNA wurde entweder aus proliferierenden &quot;jung&quot; (PDL 27 oder 34) , WI-38 - Zellen isoliert. Das Medium wurde alle 48 h und RNA-Isolierung geändert wurde 7 d nach der IR durchgeführt. RT-qPCR wurde verwendet , um die Pegel des angegebenen Seneszenz-assoziierte mRNAs unter Verwendung der genspezifischen in Tabelle 1 aufgelisteten Primer zu quantifizieren. 18S - Spiegel wurden für die Normalisierung eingesetzt. Die Histogramme stellen den Mittelwert normalisiert to unbehandelter ± SEM von 5 unabhängigen Experimenten. (B) WI-38 - Zellen (PDL 26) wurden zu 10 Gy von IR ausgesetzt; 10 d später wurde das Medium auf serumfreies Medium gewechselt (siehe Abschnitt 7). Nach 24 h wurde konditionierte Medium gesammelt und IL-6, IL-8, GRO &amp; agr und Spiegel wurde unter Verwendung eines ELISA-Assays quantifiziert. Das Histogramm stellt den Mittelwert ± SEM von 3 Experimenten. * P &lt;0,05 und *** P &lt;0,001 durch t-Test nach Student. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig6large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig6large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> menschliche Grundierungen </td><td> Vorwärts </td><td> Umkehren </td></tr><tr><td> 18S </td><td> CCCTATCAACTTTCGATGGTAGTCG </td><td> CCAATGGATCCTCGTTAAAGGATTT </td></tr><tr><td> ANKRD1 </td><td> AGT AGA GGA ACT GGT CACTGG </td><td> TGG GCT AGA AGT GTCTTC AGA T </td></tr><tr><td> CDKN1A (P21) </td><td> GAC ACCACT GGA GGG TGA CT </td><td> CAGGTC CAC ATG GTC TTC CT </td></tr><tr><td> CDKN2A (p16) </td><td> CCAACGCACCGAATAGTTACG </td><td> GCGCTGCCCATCATCATG </td></tr><tr><td> CSF2 (GM-CSF) </td><td> GGCCCCTTGACCATGATG </td><td> TCTGGGTTGCACAGGAAGTTT </td></tr><tr><td> CXCL1 </td><td> GAAAGCTTGCCTCAATCCTG </td><td> CACCAGTGAGCTTCCTCCTC </td></tr><tr><td> CXCL2 </td><td> AACTGCGCTGCCAGTGCT </td><td> CCCATTCTTGAGTGTGGCTA </td></tr><tr><td> EDN1 </td><td> CAG CAGTCT TAG GCG CTG AG </td><td> ACTCTT TAT CCA TCA GGG ACG AG </td></tr><tr><td> IL - 6 </td><td> CCGGGAACGAAAGAGAAGCT </td><td> GCGCTTGTGGAGAAGGAGTT </td></tr><tr><td> IL7 </td><td> CTCCAGTTGCGGTCATCATG </td><td> GAGGAAGTCCAAAGATATACCTAAAAGAA </td&gt; </tr><tr><td> IL8 </td><td> CTTTCCACCCCAAATTTATCAAAG </td><td> CAGACAGAGCTCTCTTCCATCAGA </td></tr></tbody></table> Tabelle 1: RT-qPCR Primer für Seneszenz-assoziierten mRNAs. Vorwärts- und Rückwärtsprimer für die RT-qPCR SYBR-Grün-Technologie angezeigt.

Watch this Scientific Journal Video about Techniques to Induce and Quantify Cellular Senescence at JoVE.com

Techniques to Induce and Quantify Cellular Senescence

Zelluläre Seneszenz, der irreversible Zustand der Zellzyklusarrest, kann durch verschiedene Zellspannungen induziert werden. Hier beschreiben wir Protokolle zelluläre Seneszenz und Methoden zu induzieren Marker für Seneszenz zu beurteilen.

Techniken zur Induktion und Quantify Zelluläre Seneszenz

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed ...

techniques-to-induce-and-quantify-cellular-senescence

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Cell Proliferation

SCIENTISTS IN ACTION

32.9K Aufrufe.  National Institute on Aging, National Institutes of Health.  Zelluläre Seneszenz, der irreversible Zustand der Zellzyklusarrest, kann durch verschiedene Zellspannungen induziert werden. Hier beschreiben wir Protokolle zelluläre Seneszenz und Methoden zu induzieren Marker für Seneszenz zu beurteilen. 

Serie: Techniques to Induce and Quantify Cellular Senescence

BioMEMS and Cellular Biology: Perspectives and Applications

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in drug screening, toxicology, and clinical assays, and is increasingly used in regenerative medicine. However, the traditional cell culture methodology   essentially consisting of the immersion of a large population of cells in a homogeneous fluid medium and on a homogeneous flat substrate   has become increasingly limiting both from a fundamental and practical perspective. Microfabrication technologies have enabled researchers to design, with micrometer control, the biochemical composition and topology of the substrate, and the medium composition, as well as the neighboring cell type in the surrounding cellular microenvironment. Additionally, microtechnology is conceptually well-suited for the development of fast, low-cost in vitro systems that allow for high-throughput culturing and analysis of cells under large numbers of conditions. In this interview, Albert Folch explains these limitations, how they can be overcome with soft lithography and microfluidics, and describes some relevant examples of research in his lab and future directions.

BioMEMS and Cellular Biology: Perspektiven und Anwendungen

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in ...

Forschung

Biologie

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Mikroinjektion Techniken zur Untersuchung Mitose in der Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution of existing proteins, and the assembly of new protein complexes can be stimulated by a variety of DNA lesions and mismatched DNA base pairs. Fluorescence microscopy has been used as a powerful experimental tool for visualizing and quantifying these and other responses to DNA lesions and to monitor DNA replication status within the complex subcellular architecture of a living cell. Translational fusions between fluorescent reporter proteins and components of the DNA replication and repair machinery have been used to determine the cues that target DNA repair proteins to their cognate lesions in vivo and to understand how these proteins are organized within bacterial cells. In addition, transcriptional and translational fusions linked to DNA damage inducible promoters have revealed which cells within a population have activated genotoxic stress responses. In this review, we provide a detailed protocol for using fluorescence microscopy to image the assembly of DNA repair and DNA replication complexes in single bacterial cells. In particular, this work focuses on imaging mismatch repair proteins, homologous recombination, DNA replication and an SOS-inducible protein in Bacillus subtilis. All of the procedures described here are easily amenable for imaging protein complexes in a variety of bacterial species.

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

A detailed protocol is described for imaging the real time formation of DNA repair complexes in Bacillus subtilis cells.

Imaging Mismatch Reparatur und zellulären Reaktionen auf DNA-Schäden in Bacillus subtilis</em

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution ...

Aseptic Laboratory Techniques: Plating Methods

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: 
 
&#9679; Perform plating procedures without contaminating media. 
&#9679; Isolate single bacterial colonies by the streak-plating method. 
&#9679; Use pour-plating and spread-plating methods to determine the concentration of bacteria. 
&#9679; Perform soft agar overlays when working with phage. 
&#9679; Transfer bacterial cells from one plate to another using the replica-plating procedure. 
&#9679; Given an experimental task, select the appropriate plating method.

When working with media and reagents used to culture microorganisms, aseptic technique must be practiced to ensure contamination is minimized. A variety of plating methods are routinely used to isolate, propagate, or enumerate bacteria and phage, all of which incorporate procedures that maintain the sterility of experimental materials.

Aseptische Labortechnik: Überzug Methoden

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies ...

Telomere Length and Telomerase Activity; A Yin and Yang of Cell Senescence

Telomeres are repeating DNA sequences at the tip ends of the chromosomes that are diverse in length and in humans can reach a length of 15,000 base pairs. The telomere serves as a bioprotective mechanism of chromosome attrition at each cell division. At a certain length, telomeres become too short to allow replication, a process that may lead to chromosome instability or cell death. Telomere length is regulated by two opposing mechanisms: attrition and elongation. Attrition occurs as each cell divides. In contrast, elongation is partially modulated by the enzyme telomerase, which adds repeating sequences to the ends of the chromosomes. In this way, telomerase could possibly reverse an aging mechanism and rejuvenates cell viability. These are crucial elements in maintaining cell life and are used to assess cellular aging. In this manuscript we will describe an accurate, short, sophisticated and cheap method to assess telomere length in multiple tissues and species. This method takes advantage of two key elements, the tandem repeat of the telomere sequence and the sensitivity of the qRT-PCR to detect differential copy numbers of tested samples. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

An accurate, short, sophisticated and cheap method is described that assesses telomere length in multiple tissues and species using qRT-PCR. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

Telomere und Telomerase-Aktivität Länge; Ein Yin und Yang der Zellalterung

Telomeres  are repeating DNA sequences at the tip ends of the chromosomes that are diverse  in length and in humans can reach a length of 15,000 base ...

Simple and Effective Administration and Visualization of Microparticles in the Circulatory System of Small Fishes Using Kidney Injection

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, implantation of transgenic cells and tiny optical sensors. However, intravenous microinjections into small animals, which are mostly used in biological and veterinary laboratories, are very difficult and require trained personnel. Herein, we demonstrate a robust and efficient method for the introduction of microparticles into the circulatory system of adult zebrafish (Danio rerio) by injection into the fish kidney. To visualize the introduced microparticles in the vasculature, we propose a simple intravital imaging technique in fish gills. In vivo monitoring of the zebrafish blood pH was accomplished using an injected microencapsulated fluorescent probe, SNARF-1, to demonstrate one of the possible applications of the described technique. This article provides a detailed description of the encapsulation of pH-sensitive dye and demonstrates the principles of the quick injection and visualization of the obtained microcapsules for in vivo recording of the fluorescent signal. The proposed method of injection is characterized by a low mortality rate (0-20%) and high efficiency (70-90% success), and it is easy to institute using commonly available equipment. All described procedures can be performed on other small fish species, such as guppies and medaka.

This article demonstrates the principles of a quick, minimally invasive injection of fluorescent microparticles into the circulatory system of small fishes and the in vivo visualization of the microparticles in fish blood.

Einfache und effektive Verwaltung und Visualisierung von Mikropartikeln im Herz-Kreislauf-System von kleinen Fischen mit Niere Injektion

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, ...

Nasal Potential Difference to Quantify Trans-epithelial Ion Transport in Mice

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful in cases of attenuated, oligo- or mono-symptomatic forms of CF usually diagnosed later in life, and of CF-related disorders such as congenital bilateral absence of vas deferens, idiopathic chronic pancreatitis, allergic bronchopulmonary aspergillosis, and bronchiectasis. In both clinical and preclinical settings, the test has been used as a biomarker to quantify responses to targeted therapeutic strategies for CF. Adapting the test to a mouse is challenging and can entail an associated mortality. This paper describes the adequate depth of anesthesia required to maintain a nasal catheter in situ for continuous perfusion. It lists measures to avoid broncho-aspiration of solutions perfused in the nose. It also describes the animal care at the end of the test, including administration of a combination of antidotes of the anesthetic drugs, leading to rapidly reversing the anesthesia with full recovery of the animals. Representative data obtained from a CF and a wild-type mouse show that the test discriminates between CF and non-CF. Altogether, the protocol described here allows reliable measurements of the functional status of trans-epithelial chloride and sodium transporters in spontaneously breathing mice, as well as multiple tests in the same animal while reducing test-related mortality.

Here, we present a protocol to measure nasal potential difference in mice. The test quantifies the function of transmembrane ion transporters such as the cystic fibrosis transmembrane conductance regulator and the epithelial sodium channel. It is valuable to evaluate the efficacy of novel therapies for cystic fibrosis.

Nasale Potentialdifferenz, Trans-epithelialen Ionentransport bei Mäusen zu quantifizieren

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful ...

Bovine Mammary Gland Biopsy Techniques

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, signaling pathways, and protein translation. This article describes two techniques for biopsy of the bovine mammary gland (MG). Three healthy Holstein dairy cows were the subjects. Before biopsies, cows were milked and subsequently restrained in a cattle chute. An analgesic (flunixin meglumine, 1.1 to 2.2 mg/kg of body weight) was administered via jugular intravenous [IV] injection 15-20 min prior to biopsy. For standing sedation, xylazine hydrochloride (0.01-0.05 mg/kg of body weight) was injected via the coccygeal vessels 5-10 min before the procedure. Once adequately sedated, the biopsy site was aseptically prepared and locally anaesthetized with 6 mL of 2% lidocaine hydrochloride via subcutaneous injection. Using aseptic technique, a 2 to 3 cm vertical incision was made using a number 10 scalpel. Core and needle biopsy tools were used. The core biopsy tool was attached to a cordless drill and inserted into the MG tissue through the incision using a clock-wise drill action. The needle biopsy tool was manually inserted into the incision site. Immediately after the procedure, an assistant applied pressure on the incision site for 20 to 25 min using a sterile towel to achieve hemostasis. Stainless steel surgical staples were used to oppose the skin incision. The staples were removed 10 days post-procedure. The main advantages of core and needle biopsies is that both approaches are minimally invasive procedures that can be safely performed in healthy cows. Milk yield following the biopsy was unaffected. These procedures require a short recovery time and result in fewer risks of complications. Specific limitations may include bleeding after the biopsy and infection on the biopsy site. Applications of these techniques include tissue collection for clinical diagnosis and research purposes, such as primary cell culture.

This article presents a bovine mammary gland biopsy using core and needle biopsy tools. Harvested tissue can be used for cell culture or to assess mammary physiology and metabolism including gene expression, protein expression, protein modifications, immunohistochemistry, and metabolite concentrations.

Bovine Brustdrüse Biopsie-Techniken

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, ...

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires careful and in-depth analyses and quantification to capture as much information about the underlying events as possible. Spatial, temporal and intensity parameters intrinsic to Ca2+ signals such as frequency, duration, propagation, velocity and amplitude may provide some biological information required for intracellular signalling. High-resolution Ca2+ imaging typically results in the acquisition of large data files that are time consuming to process in terms of translating the imaging information into quantifiable data, and this process can be susceptible to human error and bias. Analysis of Ca2+ signals from cells in situ typically relies on simple intensity measurements from arbitrarily selected regions of interest (ROI) within a field of view (FOV). This approach ignores much of the important signaling information contained in the FOV. Thus, in order to maximize recovery of information from such high-resolution recordings obtained with Ca2+dyes or optogenetic Ca2+ imaging, appropriate spatial and temporal analysis of the Ca2+ signals is required. The protocols outlined in this paper will describe how a high volume of data can be obtained from Ca2+ imaging recordings to facilitate more complete analysis and quantification of Ca2+ signals recorded from cells using a combination of spatiotemporal map (STM)-based analysis and particle-based analysis. The protocols also describe how different patterns of Ca2+ signaling observed in different cell populations in situ can be analyzed appropriately. For illustration, the method will examine Ca2+ signaling in a specialized population of cells in the small intestine, interstitial cells of Cajal (ICC), using GECIs.

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Genetically encoded Ca2+ indicators (GECIs) have radically changed how in situ Ca2+ imaging is performed. To maximize data recovery from such recordings, appropriate analysis of Ca2+ signals is required. The protocols in this paper facilitate the quantification of Ca2+ signals recorded in situ using spatiotemporal mapping and particle-based analysis.

Anwendungen der räumlich-zeitliche Zuordnung und Partikel-Analyse-Techniken zu quantifizieren, intrazellulären Ca2 + Signalisierung In Situ

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires ...

Immunohistochemistry Techniques to Analyze Cellular Proliferation and Neurogenesis in Rats Using the Thymidine Analog BrdU

One of the most important things in the field of adult hippocampal neurogenesis (AHN) is the identification of the newly generated cells. The immunodetection of thymidine analogs (such as 5-Bromo-2&#39;-deoxyuridine (BrdU)) is a standard technique used for visualizing these newly generated cells. Therefore, BrdU is usually injected in small animals intraperitoneally, so the thymidine analog gets incorporated into dividing cells during DNA synthesis. Detection is performed by immunohistochemical analysis of brain slices. Every research group that has been using this technique can appreciate that it requires special attention to minute details to achieve a successful stain. For instance, an important step is DNA denaturation with HCl, which allows it to reach the cell nucleus to stain it. However, the existing scientific reports describe very few of such steps in detail. Therefore, standardizing the technique is challenging for new laboratories as it can take several months to yield positive and successful outcomes. The purpose of this work is to describe and elaborate the steps to obtain positive and successful outcomes of the immunostaining technique in detail when working with the thymidine analog BrdU. The protocol includes the reagent preparation and setup, administration of thymidine analog in a rodent, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, use of avidin-biotin complex, immunofluorescence, counterstaining, microscopy imaging, and cell analysis.

This paper presents four of the most common techniques for visualizing BrdU positive cells to measure adult neurogenesis in rats. This work includes instructions for reagent preparation, thymidine analog administration, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, immunofluorescence, signal amplification, counterstaining, microscopy imaging, and cell analysis.