Este estudo foi apoiado pelo Programa de Pesquisa Intramural dos Institutos Nacionais de Saúde, Instituto Nacional sobre Envelhecimento. Os autores agradecem a Myriam Gorospe e Kotb Abdelmohsen para muitas discussões úteis sobre senescência e Kotb Abdelmohsen para também leitura crítica do manuscrito. Agradecemos também a nossos membros de laboratório, especialmente Douglas Dluzen pela leitura crítica do manuscrito.

Os autores não têm nada a revelar.

Aqui, nós descrevemos métodos para replicativa e a DNA-danos senesccia induzida utilizando fibroblastos diplóides humanos. Além disso, as técnicas para quantificar os níveis de mRNA de várias proteínas associadas com a senescência proteína e estão incluídos, bem como a coloração para SA-β-gal e para a ADN-danos marcador γ-H2AX. Estes protocolos podem ser amplamente utilizada para avaliar os fenótipos senescentes tanto in vitro como in vivo, embora existam muitas advertências para a caracterização in vivo senescência 20. Outras células podem expressar marcadores senescentes, mesmo que eles não são células senescentes. Por exemplo, as células, tais como os osteoclastos e macróf agos têm níveis mais elevados de actividade β-gal 32, 33. Além disso, muitas células cancerosas têm upregulated p16 INK4A 34. As células também podem acumular-se danos no ADN (por exemplo, γ-H2AX focos) e não ser senescente. factores SASP também pode ser regulada positivamente pelavários fisiológico normal ou condições patológicas que podem ou não envolvem células senescentes. Portanto, vários marcadores de senescência devem ser utilizados, especialmente quando se avalia a senescência in vivo. Embora as células senescentes foram encontrados para ser aumentada em tecidos envelhecimento normal mais de 20 anos atrás 4, é apenas agora que estamos a apreciar plenamente a multiplicidade de papéis que as células senescentes desempenhar tanto na homeostase do tecido normal e em condições patológicas. A recente emprego de modelos de ratinhos para eliminar p16 ink4a células senescentes -positivas permitiu a investigadores mais claramente e precisamente apreciar a função de células senescentes, em tecidos e órgãos 35, 36, 37. Estes modelos têm descoberto que as células senescentes contribuir para uma multidão de patologias relacionadas com a idade, tumorigênese e mouse vida útil 35 &lt;/ sup&gt;, 36, 37. Dadas estas recentes descobertas e a validação da importância das células senescentes na fisiologia, o momento é propício para mais pesquisas sobre essas células específicas. Por exemplo, estudos utilizando estratégias para remover terapeuticamente células senescentes ou para atrasar a senesccia poderia ser benéfico para ambos os estudos Healthspan e vida útil. Recentemente, o nosso laboratório, foi observado que a metformina, uma droga utilizada para o tratamento de diabetes mellitus tipo 2, diminui a senescência celular 38. Como a metformina está actualmente a ser propostos como uma terapia anti-envelhecimento e tem propriedades anti-cancerosas 39, 40, será interessante no futuro para explorar se esta droga, ou outras intervenções envelhecimento, afecta os resultados de saúde através da modulação senescência celular. Os protocolos que discutimos aqui são comuns e amplamente umaccepted técnicas para avaliar o fenótipo senescente. Para as células cultivadas in vitro, que é crítico para monitorizar as alterações celulares a partir de um fuso semelhante a uma morfologia achatada, a fim de assegurar que as células são senescentes (Ver Figuras 1 e 2). Se as células não são positivas para SA-β-gal ou outros marcadores descritos aqui, avaliar a senescência no PDLs celulares mais elevadas (por senesccia replicativa) ou a um aumento do tempo depois de ADN senesccia induzida por danos. Além disso, esses protocolos pode precisar de ser optimizada para diferentes tipos de células. Para avaliar os níveis de proteína SASP, é crítico para remover o soro a partir do meio celular, como isso vai fazer com que elevados níveis de fundo no ELISA ou matrizes de proteínas. Portanto, manter isso em mente ao projetar experimentos, pois pode não ser ideal para avaliar simultaneamente vários marcadores. A coloração para SA-β-gal, como descrito aqui, é limitada pelo facto de que ele requer a fixação das células.Além disso, confluência celular foi mostrado para influenciar a actividade SA-β-gal. Protocolos foram desenvolvidas para avaliar a actividade de SA-β-Gal utilizando um substrato fluorogico para a actividade β-gal, o que permite a quantificação do marcador, em células vivas, utilizando citometria de fluxo 41, 42, 43. Actividade SA-β-gal também pode ser medido nos lisados celulares utilizando um método de quimioluminescência 44. Além disso, γ-H2AX também pode ser medida utilizando vários outros métodos, incluindo citometria de fluxo ou a imunotransferência de lisados de células 45. Deve notar-se que a formação é SAHF linha celular dependente e é geralmente associada com induzida por oncogene senescência 20, 30, 46. Portanto, SAHF pode não estar presente em todos os modelos de senescência. O utilitário deSAHF como um marcador senescentes em modelos de ratinho pode também ser limitada pelo facto de que SAHF geralmente não é observado no rato células senescentes 30, 46, 47. Aqui, foram utilizados anticorpos contra H3K9Me2, mas outros marcadores moleculares de SAHF pode ser utilizado, incluindo macroH2A, grupo de alta mobilidade A (HMGA) proteínas, e tri-metilado lisina 9 histona H3 (H3K9Me3) e proteínas ligadas HP1. Além disso, ensaios de imunoprecipitao da cromatina pode ser utilizada para avaliar sinais de histona ou a associação de proteínas de ligação da cromatina de genes alvo de E2F. Um deve estar ciente de que existem várias limitações para caracterizar a senescência, incluindo heterogeneidade para os marcadores e o fato de que estes marcadores não são expressos exclusivamente em células senescentes. Múltipla (em geral, 2 - 3) marcadores deve ser empregada para avaliar a senescência, incluindo marcadores não são descritos aqui. Por exemplo, ADN-CICATRIZES, telomeresinalização de danos, e / ou dano de DNA também pode ser quantificado. Além disso, como a senescência e, em particular, o fenótipo de SASP, foi recentemente mostrado para ser afectada pela estressor ou dano específico que induz a senescência 11, 12, 13, é importante para avaliar os vários marcadores em cada paradigma experimental.

Mais de meio século atrás, Hayflick e colegas descreveram como células não transformadas proliferar em cultura, mas apenas por um período limitado de tempo 1. cultura de longo prazo de fibroblastos humanos causado as células para parar a proliferar; no entanto, eles foram metabolicamente ativo, e este foi chamado senescência celular. Senescência pode ser benéfica para inibir tumorigênese, mas também pode ser prejudicial, como é pensado para contribuir para a perda de capacidade de regeneração que ocorre com o envelhecimento 2, 3. As células senescentes foram mostrados a acumular-se em tecidos como os seres humanos 4 anos de idade e têm sido implicadas num certo número de processos biológicos, incluindo o desenvolvimento embrionário, a cicatrização de feridas, reparação de tecidos, e inflamação relacionada com a idade 2. passagem contínua de células em cultura induz a senescência replicativa, que tem sido associadapara telômero atrito e instabilidade genômica. Várias tensões de células, incluindo danos no DNA e oncogenes, pode também causar a senescência 3. Senescência causada por outros que o atrito dos telómeros factores é muitas vezes chamado induzida pelo stress ou senescência prematura e geralmente depende da INK4A p16 / Rb via da 5. Embora a proliferação, as células não transformadas geralmente aparecem eixo em forma, as células senescentes pode ser identificado como tendo certas características, incluindo um, grande morfologia plana e aumento da actividade β-galactosidase associada à senescência (SA-β-gal) (Figuras 1 e 2). As células senescentes também acumular marcadores de dano de ADN, incluindo γ-H2AX (Figura 3) 6, e, potencialmente, associada à senescência heterocromatina focos (SAHF) (Figura 4) 7. As células senescentes tem níveis mais elevados de reguladores do ciclo celular, incluindo p<html> 16 (INK4A p16) e / ou p21 e p53 (Figura 5) 8, 9. Além disso, dados recentes têm mostrado que as células senescentes pode ter efeitos não autónomos através da secreção de uma série de citoquinas pró-inflamatórias e quimiocinas chamado o associada à senescência secretora fenótipo (SASP) 10. Embora este fenómeno SASP pode variar de tipo de célula para tipo de célula, em geral, é demonstrado por um aumento da interleucina-6 (IL-6), IL-8, factor de estimulação de colónias de granulócitos-macrófagos (GM-CSF), growth- α regulado oncogene (GRO-α), e GRO-β, entre outros (Figura 6). O esforço particular ou danos que induz senescência também pode influenciar o fenótipo secretor 11, 12, 13. SASP pode ser detectada através da medição dos níveis de proteínas segregadas utilizando ELISA ou matrizes de citoquinas / proteínass = &quot;xref&quot;&gt; 10, 14. Apesar de mecanismos de pós-transcricional pode regular os níveis de proteína SASP 11, 15, 16, 17, as alterações nos níveis de ARNm pode também ser detectada em muitos casos. Estas alterações são, geralmente, mais sensível e mais fácil de quantificar do que as medições de nível de proteína. Outros marcadores senescentes também pode ser avaliada, incluindo danos no DNA focos nuclear persistente, chamados segmentos de ADN com alterações na cromatina de reforço senescência (ADN-CICATRIZES) 18, e vários outros marcadores de 3, 19, 20. Aqui, nós descrevemos técnicas comuns para induzir a senescência em células em cultura e também para a medição de vários marcadores de senescência, incluindo SA-β-Gal, γ-H2AX, SAHF, e a proteína e ARNm de senescemoléculas dno-associado.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% Tris-glycine gels</td>
			<td>Invitrogen</td>
			<td colspan="2">XP00160BOX</td>
		</tr>
		<tr>
			<td>Acid-Phenol ChCl3</td>
			<td>Ambion</td>
			<td>AM9720</td>
			<td></td>
		</tr>
		<tr>
			<td>Alexa-Fluor 568 goat anti-mouse antibody</td>
			<td>Invitrogen</td>
			<td>A11031</td>
			<td>1:300 dilution</td>
		</tr>
		<tr>
			<td>Cell lifters</td>
			<td>Corning Inc.</td>
			<td>3008</td>
			<td>Cell scraper</td>
		</tr>
		<tr>
			<td>ECL anti-mouse HRP linked antibody</td>
			<td>Amersham</td>
			<td>NA931V</td>
			<td></td>
		</tr>
		<tr>
			<td>ECL Plus Western Blotting Substrate</td>
			<td>Pierce</td>
			<td>32132</td>
			<td>ECL</td>
		</tr>
		<tr>
			<td>DAPI</td>
			<td>Molecular Probes</td>
			<td>MP01306</td>
			<td>stock 5 mg/ml in dH2O</td>
		</tr>
		<tr>
			<td>GAPDH antibody</td>
			<td>Santa Cruz</td>
			<td>sc-32233</td>
			<td>1:1,000-5,000 dilution</td>
		</tr>
		<tr>
			<td>GlycoBlue</td>
			<td>Ambion</td>
			<td>AM9515</td>
			<td></td>
		</tr>
		<tr>
			<td>Histone H3 dimethyl K9 monoclonal antibody</td>
			<td>Abcam</td>
			<td>1220</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>Human IL-6 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D6050</td>
			<td></td>
		</tr>
		<tr>
			<td>Human IL-8 Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>D8000C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human GROa Quantikine ELISA assay</td>
			<td>R&#38;D systems</td>
			<td>DRG00</td>
			<td></td>
		</tr>
		<tr>
			<td>N-N-dimethylformamide&#160;</td>
			<td>Sigma</td>
			<td>D4551</td>
			<td>DMF</td>
		</tr>
		<tr>
			<td>p16 monoclonal antibody</td>
			<td>BD Biosciences</td>
			<td>51-1325gr</td>
			<td>1:500 dilution</td>
		</tr>
		<tr>
			<td>p21 monoclonal antibody</td>
			<td>Millipore</td>
			<td>05-345</td>
			<td>1:750 dilution</td>
		</tr>
		<tr>
			<td>p53 monoclonal antibody</td>
			<td>Santa Cruz</td>
			<td>sc-126</td>
			<td>1:500 dilution clone DO-1</td>
		</tr>
		<tr>
			<td>phospho-H2AX (Ser139) FITC conjugate antibody</td>
			<td>Cell Signaling</td>
			<td>9719</td>
			<td>1:2000 dilution</td>
		</tr>
		<tr>
			<td>POWER SYBR-green PCR master mix&#160;</td>
			<td>Applied Biosystems</td>
			<td>4367659</td>
			<td></td>
		</tr>
		<tr>
			<td>Pre-stained molecular weight markers</td>
			<td>Biorad</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade&#160;</td>
			<td>Invitrogen</td>
			<td>P36930</td>
			<td></td>
		</tr>
		<tr>
			<td>PVDF membrane&#160;</td>
			<td>Thermo Scientific</td>
			<td>88518</td>
			<td></td>
		</tr>
		<tr>
			<td>Senescence b-Galactosidase Staining Kit</td>
			<td>Cell Signaling</td>
			<td>9860</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol</td>
			<td>Ambion/Life Tech</td>
			<td>10296028</td>
			<td></td>
		</tr>
	</tbody>
</table>

techniques to induce and quantify cellular senescence

Em resposta ao stress celular ou dano, as células em proliferação podem induzir um programa específico que inicia um estado de paragem do ciclo celular a longo prazo, denominado senescência celular. A acumulação de células senescentes ocorre com o envelhecimento do organismo e por meio de cultura contínua in vitro. As células senescentes influenciam diversos processos biológicos, incluindo o desenvolvimento embrionário, reparação e regeneração de tecidos, supressão de tumores, e o envelhecimento. Características das células senescentes incluem, mas não estão limitados a, um aumento da actividade β-galactosidase associada à senescência (SA-β-gal); p16 ink4a, p53, e p21 níveis; níveis mais elevados de danos no ADN, incluindo γ-H2AX; a formação de senesccia associada Heterocromatina Focos (SAHF); e a aquisição de um associado com a senescência secretora Fenótipo (SASP), um fenómeno caracterizado pela secreção de um número de citocinas pró-inflamatórias e as moléculas de sinalização. Aqui, descrevemos os protocolos tanto para replicativo esenescência danificam o ADN induzida em células de cultura. Além disso, podemos destacar as técnicas de controlo do fenótipo senescente utilizando vários marcadores associada com a senescência, incluindo SA-β-gal, γ-H2AX e coloração SAHF, e para quantificar os níveis de proteína e ARNm de reguladores do ciclo celular e factores de SASP. Estes métodos podem ser aplicados para a avaliação da senescência em vários modelos e tecidos.

As Figuras 2-6 mostram resultados representativos de colorao SA-β-gal; coloração para γ-H2AX e SAHF; avaliação dos níveis de proteína de INK4A p16, p21, e p53; e o ARNm e os níveis proteicos de moléculas senescentes-associado. O aumento da coloração SA-β-gal ocorre com replicativo e ADN senesccia induzida por danos. Além disso, observe as alterações morfológicas que ocorrem com a senescência. As células tornam-se alargada e plana em relação ao eixo aparência de fibroblastos em proliferação. Para este paradigma experimental, as células foram coradas e ARN / proteína foram isoladas sete d após a exposição ao IV. Resultados mais robustos pode ocorrer por espera mais longo após a exposição IV (isto é, 10 d). Condições precisa ser determinado para cada condição e configuração experimental. Estes resultados são representativos e estes marcadores também podem ser detectados quando senescência é induzida através de outros métodos. a Figura 6, os nomes de genes estão listados e correspondem a CXCL1 (GRO), CXCL2 (GRO), e QCA 2 (GM-CSF). A regulação positiva dos níveis de ARNm de alguns, mas não todos, dos factores de SASP foram observados depois de senesccia induzida por IR em células WI-38. Outros ARNm associado com a senescência, incluindo CDKN1A (codifica p21) e CDKN2A (codifica p16 INK4A), foram regulados positivamente. Outros ARNm (EDN1 e ANKRD1) também foram incluídos e foram previamente demonstrado ser mais elevada em células senescentes 15. Os iniciadores estão listadas na Tabela 1. <img alt="figura 1" src="/files/ftp_upload/55533/55533fig1.jpg" /> Figura 1: Proliferating e senescentes fibroblastos. Uma representação esquemática de proliferar (esquerda) e (direita) fibroblastos senescentes. Exemplos de indutores de senescência são mostrados no voscaixa lLow. Senescência está associada com níveis mais elevados dos marcadores indicados. SA-β-gal, actividade β-galactosidase associada à senescência; SASP, associada à senescência fenótipo secretor; SAHF, associada à senescência focos heterocromatina; DDR, resposta de ADN-danos. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura</a> <img alt="Figura 2" src="/files/ftp_upload/55533/55533fig2.jpg" /> Figura 2. Características morfológicas e aumento da actividade SA-β-gal das células senescentes. WI-38 células, quer a proliferar &quot;novo&quot; (PDL 27), senescência replicativa (PDL 40), ou os expostos a radiação ionizante (IR), foram coradas por actividade de SA-β-gal. IMR-90 células, quer a proliferar &quot;novo&quot; (PDL 30), senescência replicativa (PDL 52), ou os expostos a radiação ionizante (RI), foram stainada para actividade SA-β-gal. Secções 1-2 descrevem induzir replicativo e ADN senesccia induzida por dano, e Secção 3 explica coloração para SA-β-gal. As células foram coradas 7 d após IR. Con, controle. Escala da barra = 50 m. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/55533/55533fig3.jpg" /> Figura 3. Aumento γ-H2AX Focos em células senescentes. WI-38 células, quer a proliferar &quot;novo&quot; (PDL 30) ou senescente replicativa (PDL 53), foram fixadas e coradas com anticorpos anti-y-H2AX e DAPI. Notar o aumento no número de focos γ-H2AX em células senescentes. As imagens foram obtidas em um microscópio confocal. Z-secções foram tomadas, e a projecção de intensidade máxima foi usada para obter uma imagem de plano único para visualizar todos detecfocos de mesa. Escala da barra = 20 m. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/55533/55533fig4.jpg" /> Figura 4. Coloração Fluorescente de SAHF em células senescentes. (A) As células em proliferação WI-38 (PDL 27) não foram tratados ou exposto a radiação ionizante (IR). Após 10 dias, as células foram coradas com DAPI para visualizar SAHF (note ponteada DAPI coloração densa / em células tratadas com IR) (B) IDH4 foram cultivadas na presença de dexametasona (proliferação) ou em FBS separado com carvão activado a induzir a senescência ( senescente). Depois de 10 d, as células foram coradas com anticorpos contra H3K9Me2 e DAPI. As imagens foram obtidas em um microscópio confocal. Z-secções foram tomadas, e a projecção de intensidade máxima foi usada para obter um único planoimagem. Proliferação de células em (A) e (B) têm coloração DAPI difusa, enquanto que as células senescentes tem ponteada coloração DAPI. Em (B), células de controlo têm coloração difusa, muito leve para H3K9Me2, enquanto H3K9Me2 coloração é mais robusto e colocaliza com focos corados com DAPI em células senescentes. Escala da barra = 20 m. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/55533/55533fig5.jpg" /> Figura 5. A quantificação de proteínas senescência-associados. A proteína foi isolada a partir de qualquer proliferantes &quot;novo&quot; (PDL 30) IMR-90 culas (-) ou células IMR-90 que foram expostas a 10 Gy de radiação ionizante (IR). O meio foi trocado a cada 48 horas e as células foram lisadas após 7 d IR. As amostras foram analisadas por SDS-PAGE, imunotransf com anti-p16 INK4A Antibomorre, e re-sondadas com anti-p21 e, em seguida, anticorpos anti-p53. GAPDH foi usada como um controlo de carga da proteína. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig5large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 6" src="/files/ftp_upload/55533/55533fig6.jpg" /> Figura 6. A quantificação de ARNm senescência-associados e SASP Proteínas. (A) ARN foi isolado a partir de qualquer proliferantes &quot;novo&quot; (PDL 27 ou 34) de células WI-38 (-) ou WI-38 as células que foram expostas a 10 Gy de radiação ionizante (IR). O meio foi trocado a cada 48 horas e isolamento do ARN foi realizada 7 d após IR. RT-qPCR foi usada para quantificar os níveis de ARNm associado com a senescência indicados utilizando os iniciadores especicos de gene listados na Tabela 1. Níveis 18S foram usados para normalização. Os histogramas representam a média normalizada to ± SEM não tratada a partir de 5 experiências independentes. (B) As células WI-38 (PDL 26) foram expostas a 10 Gy de IR; 10 d mais tarde, o meio foi mudado para meio isento de soro (ver Secção 7). Após 24 h, o meio condicionado foi recolhido e os níveis de IL-6, IL-8, GROa e foram quantificados utilizando ensaios de ELISA. O histograma representa a média ± MEP de 3 experiências. * P &lt;0,05 e *** P &lt;0,001 pelo teste t de Student. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55533/55533fig6large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Primers humanos </td><td> progressivo </td><td> Marcha ré </td></tr><tr><td> 18S </td><td> CCCTATCAACTTTCGATGGTAGTCG </td><td> CCAATGGATCCTCGTTAAAGGATTT </td></tr><tr><td> ANKRD1 </td><td> AGT AGA GGA ACT GGT CACTGG </td><td> TGG GCT AGA AGT GTCTTC AGA T </td></tr><tr><td> CDKN1A (p21) </td><td> GAC ACCACT GGA GGG TGA CT </td><td> CAGGTC CAC ATG GTC TTC CT </td></tr><tr><td> CDKN2A (p16) </td><td> CCAACGCACCGAATAGTTACG </td><td> GCGCTGCCCATCATCATG </td></tr><tr><td> QCA 2 (GM-CSF) </td><td> GGCCCCTTGACCATGATG </td><td> TCTGGGTTGCACAGGAAGTTT </td></tr><tr><td> CXCL1 </td><td> GAAAGCTTGCCTCAATCCTG </td><td> CACCAGTGAGCTTCCTCCTC </td></tr><tr><td> CXCL2 </td><td> AACTGCGCTGCCAGTGCT </td><td> CCCATTCTTGAGTGTGGCTA </td></tr><tr><td> EDN1 </td><td> CAG CAGTCT TAG GCG CTG AG </td><td> ACTCTT TAT CCA TCA GGG ACG AG </td></tr><tr><td> IL6 </td><td> CCGGGAACGAAAGAGAAGCT </td><td> GCGCTTGTGGAGAAGGAGTT </td></tr><tr><td> IL7 </td><td> CTCCAGTTGCGGTCATCATG </td><td> GAGGAAGTCCAAAGATATACCTAAAAGAA </td&gt; </tr><tr><td> IL8 </td><td> CTTTCCACCCCAAATTTATCAAAG </td><td> CAGACAGAGCTCTCTTCCATCAGA </td></tr></tbody></table> Tabela 1: RT-qPCR Primers para mRNAs senescência-associados. iniciadores directos e inversos para RT-qPCR utilizando tecnologia de SYBR verde são indicados.

Watch this Scientific Journal Video about Techniques to Induce and Quantify Cellular Senescence at JoVE.com

Techniques to Induce and Quantify Cellular Senescence

A senescência celular, o estado irreversível de paragem do ciclo celular, pode ser induzida por vários stresses celulares. Aqui, descrevemos os protocolos para induzir a senescência e métodos celular para avaliar marcadores de senescência.

Técnicas para induzir e quantificar a senescência celular

In response to cellular stress or damage, proliferating cells can induce a specific program that initiates a state of long-term cell-cycle arrest, termed ...

techniques-to-induce-and-quantify-cellular-senescence

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 2

Cell Proliferation

SCIENTISTS IN ACTION

32.9K visualizações.  National Institute on Aging, National Institutes of Health.  A senescência celular, o estado irreversível de paragem do ciclo celular, pode ser induzida por vários stresses celulares. Aqui, descrevemos os protocolos para induzir a senescência e métodos celular para avaliar marcadores de senescência. 

Vídeo: Techniques to Induce and Quantify Cellular Senescence

BioMEMS and Cellular Biology: Perspectives and Applications

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in drug screening, toxicology, and clinical assays, and is increasingly used in regenerative medicine. However, the traditional cell culture methodology   essentially consisting of the immersion of a large population of cells in a homogeneous fluid medium and on a homogeneous flat substrate   has become increasingly limiting both from a fundamental and practical perspective. Microfabrication technologies have enabled researchers to design, with micrometer control, the biochemical composition and topology of the substrate, and the medium composition, as well as the neighboring cell type in the surrounding cellular microenvironment. Additionally, microtechnology is conceptually well-suited for the development of fast, low-cost in vitro systems that allow for high-throughput culturing and analysis of cells under large numbers of conditions. In this interview, Albert Folch explains these limitations, how they can be overcome with soft lithography and microfluidics, and describes some relevant examples of research in his lab and future directions.

BioMEMS e Biologia Celular: Perspectivas e Aplicações

The ability to culture cells has revolutionized hypothesis testing in basic cell and molecular biology research. It has become a standard methodology in ...

Biologia

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of the Drosophila melanogaster syncytial embryo for studying mitosis1. Drosophila has useful genetics with a sequenced genome, and it can be easily maintained and manipulated. Many mitotic mutants exist, and transgenic flies expressing functional fluorescently (e.g. GFP) - tagged mitotic proteins have been and are being generated. Targeted gene expression is possible using the GAL4/UAS system2. 

The Drosophila early embryo carries out multiple mitoses very rapidly (cell cycle duration, &asymp;10 min). It is well suited for imaging mitosis, because during cycles 10-13, nuclei divide rapidly and synchronously without intervening cytokinesis at the surface of the embryo in a single monolayer just underneath the cortex. These rapidly dividing nuclei probably use the same mitotic machinery as other cells, but they are optimized for speed; the checkpoint is generally believed to not be stringent, allowing the study of mitotic proteins whose absence would cause cell cycle arrest in cells with a strong checkpoint. Embryos expressing GFP labeled proteins or microinjected with fluorescently labeled proteins can be easily imaged to follow live dynamics (Fig. 1). In addition, embryos can be microinjected with function-blocking antibodies or inhibitors of specific proteins to study the effect of the loss or perturbation of their function3. These reagents can diffuse throughout the embryo, reaching many spindles to produce a gradient of concentration of inhibitor, which in turn results in a gradient of defects comparable to an allelic series of mutants. Ideally, if the target protein is fluorescently labeled, the gradient of inhibition can be directly visualized4. It is assumed that the strongest phenotype is comparable to the null phenotype, although it is hard to formally exclude the possibility that the antibodies may have dominant effects in rare instances, so rigorous controls and cautious interpretation must be applied. Further away from the injection site, protein function is only partially lost allowing other functions of the target protein to become evident.

Microinjection Techniques for Studying Mitosis in the Drosophila melanogaster Syncytial Embryo

This protocol describes the use of microinjection and high resolution imaging in the Drosophila melanogaster syncytial embryo to study mitosis.

Técnicas de microinjeção para estudar na Mitose Drosophila melanogaster Embrião Sincicial

This protocol describes the use of the Drosophila melanogaster syncytial embryo  for studying mitosis1.  Drosophila has useful genetics with a sequenced ...

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution of existing proteins, and the assembly of new protein complexes can be stimulated by a variety of DNA lesions and mismatched DNA base pairs. Fluorescence microscopy has been used as a powerful experimental tool for visualizing and quantifying these and other responses to DNA lesions and to monitor DNA replication status within the complex subcellular architecture of a living cell. Translational fusions between fluorescent reporter proteins and components of the DNA replication and repair machinery have been used to determine the cues that target DNA repair proteins to their cognate lesions in vivo and to understand how these proteins are organized within bacterial cells. In addition, transcriptional and translational fusions linked to DNA damage inducible promoters have revealed which cells within a population have activated genotoxic stress responses. In this review, we provide a detailed protocol for using fluorescence microscopy to image the assembly of DNA repair and DNA replication complexes in single bacterial cells. In particular, this work focuses on imaging mismatch repair proteins, homologous recombination, DNA replication and an SOS-inducible protein in Bacillus subtilis. All of the procedures described here are easily amenable for imaging protein complexes in a variety of bacterial species.

Imaging Mismatch Repair and Cellular Responses to DNA Damage in Bacillus subtilis

A detailed protocol is described for imaging the real time formation of DNA repair complexes in Bacillus subtilis cells.

Mismatch Repair imagem e respostas celulares a danos no DNA em Bacillus subtilis</em

Both prokaryotes and eukaryotes respond to DNA damage through a complex set of physiological changes. Alterations in gene expression, the redistribution ...

Aseptic Laboratory Techniques: Plating Methods

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies on the ability of a scientist to sterilize work surfaces and equipment as well as prevent contact of sterile instruments and solutions with non-sterile surfaces. Here we present the steps for several plating methods routinely used in the laboratory to isolate, propagate, or enumerate microorganisms such as bacteria and phage. All five methods incorporate aseptic technique, or procedures that maintain the sterility of experimental materials. Procedures described include (1) streak-plating bacterial cultures to isolate single colonies, (2) pour-plating and (3) spread-plating to enumerate viable bacterial colonies, (4) soft agar overlays to isolate phage and enumerate plaques, and (5) replica-plating to transfer cells from one plate to another in an identical spatial pattern. These procedures can be performed at the laboratory bench, provided they involve non-pathogenic strains of microorganisms (Biosafety Level 1, BSL-1). If working with BSL-2 organisms, then these manipulations must take place in a biosafety cabinet. Consult the most current edition of the Biosafety in Microbiological and Biomedical Laboratories (BMBL) as well as Material Safety Data Sheets (MSDS) for Infectious Substances to determine the biohazard classification as well as the safety precautions and containment facilities required for the microorganism in question. Bacterial strains and phage stocks can be obtained from research investigators, companies, and collections maintained by particular organizations such as the American Type Culture Collection (ATCC). It is recommended that non-pathogenic strains be used when learning the various plating methods. By following the procedures described in this protocol, students should be able to: 
 
&#9679; Perform plating procedures without contaminating media. 
&#9679; Isolate single bacterial colonies by the streak-plating method. 
&#9679; Use pour-plating and spread-plating methods to determine the concentration of bacteria. 
&#9679; Perform soft agar overlays when working with phage. 
&#9679; Transfer bacterial cells from one plate to another using the replica-plating procedure. 
&#9679; Given an experimental task, select the appropriate plating method.

When working with media and reagents used to culture microorganisms, aseptic technique must be practiced to ensure contamination is minimized. A variety of plating methods are routinely used to isolate, propagate, or enumerate bacteria and phage, all of which incorporate procedures that maintain the sterility of experimental materials.

Assépticas Técnicas de Laboratório: Métodos Plating

Microorganisms are present on all inanimate surfaces creating ubiquitous sources of possible contamination in the laboratory. Experimental success relies ...

Telomere Length and Telomerase Activity; A Yin and Yang of Cell Senescence

Telomeres are repeating DNA sequences at the tip ends of the chromosomes that are diverse in length and in humans can reach a length of 15,000 base pairs. The telomere serves as a bioprotective mechanism of chromosome attrition at each cell division. At a certain length, telomeres become too short to allow replication, a process that may lead to chromosome instability or cell death. Telomere length is regulated by two opposing mechanisms: attrition and elongation. Attrition occurs as each cell divides. In contrast, elongation is partially modulated by the enzyme telomerase, which adds repeating sequences to the ends of the chromosomes. In this way, telomerase could possibly reverse an aging mechanism and rejuvenates cell viability. These are crucial elements in maintaining cell life and are used to assess cellular aging. In this manuscript we will describe an accurate, short, sophisticated and cheap method to assess telomere length in multiple tissues and species. This method takes advantage of two key elements, the tandem repeat of the telomere sequence and the sensitivity of the qRT-PCR to detect differential copy numbers of tested samples. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

An accurate, short, sophisticated and cheap method is described that assesses telomere length in multiple tissues and species using qRT-PCR. In addition, we will describe a simple assay to assess telomerase activity as a complementary backbone test for telomere length.

Comprimento dos telômeros e da telomerase atividade; Um Yin e Yang da senescência celular

Telomeres  are repeating DNA sequences at the tip ends of the chromosomes that are diverse  in length and in humans can reach a length of 15,000 base ...

Simple and Effective Administration and Visualization of Microparticles in the Circulatory System of Small Fishes Using Kidney Injection

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, implantation of transgenic cells and tiny optical sensors. However, intravenous microinjections into small animals, which are mostly used in biological and veterinary laboratories, are very difficult and require trained personnel. Herein, we demonstrate a robust and efficient method for the introduction of microparticles into the circulatory system of adult zebrafish (Danio rerio) by injection into the fish kidney. To visualize the introduced microparticles in the vasculature, we propose a simple intravital imaging technique in fish gills. In vivo monitoring of the zebrafish blood pH was accomplished using an injected microencapsulated fluorescent probe, SNARF-1, to demonstrate one of the possible applications of the described technique. This article provides a detailed description of the encapsulation of pH-sensitive dye and demonstrates the principles of the quick injection and visualization of the obtained microcapsules for in vivo recording of the fluorescent signal. The proposed method of injection is characterized by a low mortality rate (0-20%) and high efficiency (70-90% success), and it is easy to institute using commonly available equipment. All described procedures can be performed on other small fish species, such as guppies and medaka.

This article demonstrates the principles of a quick, minimally invasive injection of fluorescent microparticles into the circulatory system of small fishes and the in vivo visualization of the microparticles in fish blood.

Administração simples e eficaz e visualização de micropartículas no sistema circulatório de peixes pequenos usando injeção de rim

The systemic administration of micro-size particles into a living organism can be applied for vasculature visualization, drug and vaccine delivery, ...

Nasal Potential Difference to Quantify Trans-epithelial Ion Transport in Mice

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful in cases of attenuated, oligo- or mono-symptomatic forms of CF usually diagnosed later in life, and of CF-related disorders such as congenital bilateral absence of vas deferens, idiopathic chronic pancreatitis, allergic bronchopulmonary aspergillosis, and bronchiectasis. In both clinical and preclinical settings, the test has been used as a biomarker to quantify responses to targeted therapeutic strategies for CF. Adapting the test to a mouse is challenging and can entail an associated mortality. This paper describes the adequate depth of anesthesia required to maintain a nasal catheter in situ for continuous perfusion. It lists measures to avoid broncho-aspiration of solutions perfused in the nose. It also describes the animal care at the end of the test, including administration of a combination of antidotes of the anesthetic drugs, leading to rapidly reversing the anesthesia with full recovery of the animals. Representative data obtained from a CF and a wild-type mouse show that the test discriminates between CF and non-CF. Altogether, the protocol described here allows reliable measurements of the functional status of trans-epithelial chloride and sodium transporters in spontaneously breathing mice, as well as multiple tests in the same animal while reducing test-related mortality.

Here, we present a protocol to measure nasal potential difference in mice. The test quantifies the function of transmembrane ion transporters such as the cystic fibrosis transmembrane conductance regulator and the epithelial sodium channel. It is valuable to evaluate the efficacy of novel therapies for cystic fibrosis.

Diferença de potencial nasal para quantificar o transporte do íon Trans-epitelial em ratos

The nasal potential difference test has been used for almost three decades to assist in the diagnosis of cystic fibrosis (CF). It has proven to be helpful ...

Bovine Mammary Gland Biopsy Techniques

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, signaling pathways, and protein translation. This article describes two techniques for biopsy of the bovine mammary gland (MG). Three healthy Holstein dairy cows were the subjects. Before biopsies, cows were milked and subsequently restrained in a cattle chute. An analgesic (flunixin meglumine, 1.1 to 2.2 mg/kg of body weight) was administered via jugular intravenous [IV] injection 15-20 min prior to biopsy. For standing sedation, xylazine hydrochloride (0.01-0.05 mg/kg of body weight) was injected via the coccygeal vessels 5-10 min before the procedure. Once adequately sedated, the biopsy site was aseptically prepared and locally anaesthetized with 6 mL of 2% lidocaine hydrochloride via subcutaneous injection. Using aseptic technique, a 2 to 3 cm vertical incision was made using a number 10 scalpel. Core and needle biopsy tools were used. The core biopsy tool was attached to a cordless drill and inserted into the MG tissue through the incision using a clock-wise drill action. The needle biopsy tool was manually inserted into the incision site. Immediately after the procedure, an assistant applied pressure on the incision site for 20 to 25 min using a sterile towel to achieve hemostasis. Stainless steel surgical staples were used to oppose the skin incision. The staples were removed 10 days post-procedure. The main advantages of core and needle biopsies is that both approaches are minimally invasive procedures that can be safely performed in healthy cows. Milk yield following the biopsy was unaffected. These procedures require a short recovery time and result in fewer risks of complications. Specific limitations may include bleeding after the biopsy and infection on the biopsy site. Applications of these techniques include tissue collection for clinical diagnosis and research purposes, such as primary cell culture.

This article presents a bovine mammary gland biopsy using core and needle biopsy tools. Harvested tissue can be used for cell culture or to assess mammary physiology and metabolism including gene expression, protein expression, protein modifications, immunohistochemistry, and metabolite concentrations.

Técnicas de biópsia da glândula mamária bovina

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, ...

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires careful and in-depth analyses and quantification to capture as much information about the underlying events as possible. Spatial, temporal and intensity parameters intrinsic to Ca2+ signals such as frequency, duration, propagation, velocity and amplitude may provide some biological information required for intracellular signalling. High-resolution Ca2+ imaging typically results in the acquisition of large data files that are time consuming to process in terms of translating the imaging information into quantifiable data, and this process can be susceptible to human error and bias. Analysis of Ca2+ signals from cells in situ typically relies on simple intensity measurements from arbitrarily selected regions of interest (ROI) within a field of view (FOV). This approach ignores much of the important signaling information contained in the FOV. Thus, in order to maximize recovery of information from such high-resolution recordings obtained with Ca2+dyes or optogenetic Ca2+ imaging, appropriate spatial and temporal analysis of the Ca2+ signals is required. The protocols outlined in this paper will describe how a high volume of data can be obtained from Ca2+ imaging recordings to facilitate more complete analysis and quantification of Ca2+ signals recorded from cells using a combination of spatiotemporal map (STM)-based analysis and particle-based analysis. The protocols also describe how different patterns of Ca2+ signaling observed in different cell populations in situ can be analyzed appropriately. For illustration, the method will examine Ca2+ signaling in a specialized population of cells in the small intestine, interstitial cells of Cajal (ICC), using GECIs.

Applications of Spatio-temporal Mapping and Particle Analysis Techniques to Quantify Intracellular Ca2+ Signaling In Situ

Genetically encoded Ca2+ indicators (GECIs) have radically changed how in situ Ca2+ imaging is performed. To maximize data recovery from such recordings, appropriate analysis of Ca2+ signals is required. The protocols in this paper facilitate the quantification of Ca2+ signals recorded in situ using spatiotemporal mapping and particle-based analysis.

Aplicações de mapeamento de espaço-temporal e técnicas de análise de partículas para quantificar intracelular Ca2 + sinalização em Situ

Ca2+ imaging of isolated cells or specific types of cells within intact tissues often reveals complex patterns of Ca2+ signaling. This activity requires ...

Immunohistochemistry Techniques to Analyze Cellular Proliferation and Neurogenesis in Rats Using the Thymidine Analog BrdU

One of the most important things in the field of adult hippocampal neurogenesis (AHN) is the identification of the newly generated cells. The immunodetection of thymidine analogs (such as 5-Bromo-2&#39;-deoxyuridine (BrdU)) is a standard technique used for visualizing these newly generated cells. Therefore, BrdU is usually injected in small animals intraperitoneally, so the thymidine analog gets incorporated into dividing cells during DNA synthesis. Detection is performed by immunohistochemical analysis of brain slices. Every research group that has been using this technique can appreciate that it requires special attention to minute details to achieve a successful stain. For instance, an important step is DNA denaturation with HCl, which allows it to reach the cell nucleus to stain it. However, the existing scientific reports describe very few of such steps in detail. Therefore, standardizing the technique is challenging for new laboratories as it can take several months to yield positive and successful outcomes. The purpose of this work is to describe and elaborate the steps to obtain positive and successful outcomes of the immunostaining technique in detail when working with the thymidine analog BrdU. The protocol includes the reagent preparation and setup, administration of thymidine analog in a rodent, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, use of avidin-biotin complex, immunofluorescence, counterstaining, microscopy imaging, and cell analysis.

This paper presents four of the most common techniques for visualizing BrdU positive cells to measure adult neurogenesis in rats. This work includes instructions for reagent preparation, thymidine analog administration, transcardial perfusion, tissue preparation, peroxidase immunohistochemical reaction, immunofluorescence, signal amplification, counterstaining, microscopy imaging, and cell analysis.