We thank Dr. Tadashi Koyama for technical help. This work was supported in part by JSPS KAKENHI Grant Numbers 23249045, 15K09211, 15K19172; a grant to the Respiratory Failure Research Group from the Ministry of Health, Labour and Welfare, Japan; a grant for research on allergic disease and immunology, Japan.

1. Preparations and Culture of Lung Epithelial Cells
<ol>
	<li>Culture A549 human lung epithelial cells (adherent cell line) in Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin, and 100 &#181;g/ml streptomycin.</li>
	<li>Remove and discard the cell culture media from culture dish, and wash once with 5 - 10 ml of phosphate buffered saline (PBS). After washing, immediately aspirate the PBS.</li>
	<li>Add 2 ml&#160;Trypsin/ethylenediaminetetraacetic acid (EDTA) (0.05%) and incubate at 37 &#176;C and 5% CO2 for 3 min.</li>
	<li>Collect the detached cells in centrifuge tubes containing cell culture medium, centrifuge the tubes at RT for 4 min at 150 &#215; g.</li>
	<li>Resuspend the cells pellet in 2 ml of cell culture medium and remove a sample for cell counting. Count the number of the cells using a hemocytometer with Trypan blue stain to check cell viability.</li>
	<li>Seed A549 cells on 10 cm polystyrene plates at a density of 0.5 - 1.0 &#215; 106 cells/dish with 10 ml of medium for gel contraction assay. Seed the cells on 6 well polystyrene plates at a density of 0.5 - 1.0 &#215; 105 cells/well with 2 ml of medium for EMT confirmation. Incubate the cells at 37 &#176;C and 5% CO2 for 24 hr.</li>
</ol>
2. EMT Procedure
<ol>
	<li>Add 10 &#181;l of TGF-&#946;1 (5 &#181;g/ml) and 10 &#181;l of TNF-&#945; (10 &#181;g/ml) to the plate for gel contraction assay seeded in step 1.6. Add 2 &#181;l of TGF-&#946;1 (5 &#181;g/ml) and 2 &#181;l of TNF-&#945; (10 &#181;g/ml) to the plate for EMT confirmation seeded in step 1.6. Incubate at 37 &#176;C and 5% CO2 for 48 hr.</li>
</ol>
3. Confirmation of EMT Procedure by PCR and Western Blotting
<ol>
	<li>Confirm change in morphology (from cobble stone-like to spindle shape) of treated cells using phase contrast microscopy. 
	Note: Normal A549 cells have cobble stone-like and triangular shaped appearance that is a characteristic of epithelial cells, but after stimulation with TGF-&#946;1 and TNF-&#945;, the cells appear long and spindle shaped that is similar to mesenchymal cells14,15.</li>
	<li>Evaluate the expression of an epithelial marker, such as E-cadherin, and mesenchymal markers such as N-cadherin, vimentin, and &#945;-smooth muscle actin using PCR or Western blotting.
	<ol>
		<li>Extract total RNA from the cells using RNA extraction kit16 and synthesize cDNA using reverse transcriptase17 according to the manufacturer&#39;s protocol.</li>
		<li>Measure expression of mRNA levels using real time PCR system18 and monomeric cyanine dye PCR kit according to the manufacturers&#39; instructions. The specific primers for GAPDH (glyceraldehyde 3-phosphate dehydrogenase), ACTA2 (alpha-actin-2), CDH1 (cadherin-1; E-cadherin), and VIM (vimentin) are shown in Table 1.</li>
		<li>Lyse the cells using a lysis buffer (Table 2) solution containing 1% protease inhibitor cocktail. Measure all sample protein concentrations using a protein assay kit19,20, and apply the same amounts of protein to a polyacrylamide gel.
		<ol>
			<li>Perform SDS gel-electrophoresis and semi-dry transfer of the proteins to PVDF membrane21. Incubate the membrane with primary antibodies in blocking buffer for 1 - 2 hr. After incubation, wash twice the membrane with wash buffer and incubate the membrane 1 hr with second antibodies. 
			Note: See the Materials/Equipment Table for antibodies and dilutions used in these studies. See Table 2 for the components of blocking buffer.</li>
			<li>Wash the membrane with wash buffer twice. Take pictures of the membrane with the Western blotting detection kit22 using a cold CCD camera11,23.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
4. Gel Contraction Assay for Evaluating EMT
<ol>
	<li>Aspirate the conditioned media from the cell culture vessel, and wash well with 5 - 10 ml of PBS to remove dead cells. After washing, immediately aspirate the PBS.</li>
	<li>Add 2 ml of 0.05% Trypsin/EDTA and incubate at 37 &#176;C and 5% CO2 for 3 min.</li>
	<li>Collect the detached cells in centrifuge tubes containing DMEM supplemented with trypsin inhibitor (1 mg/ml), centrifuge the tubes at RT for 4 min at 150 &#215;g.</li>
	<li>Mix type 1 collagen gel with distilled water, and 4&#215; concentrated DMEM to adjust the volumes to achieve a collagen concentration of 1.75 mg/ml, and 1&#215; DMEM concentration. Be sure to keep the gel medium on ice during this step. 
	Note: To make 6 ml of gel medium, mix well 3.5 ml of type 1 collagen gel (3 mg/ml), 1.5 ml of 4&#215; concentrated DMEM, and 1ml of distilled water.</li>
	<li>Resuspend the cell pellet in 500 &#181;l of PBS and remove a sample for cell counting. Count the number of the cells using a hemocytometer with trypan blue stain to check cell viability.</li>
	<li>Add the gel medium to adjust the volumes to achieve a cell density of 3.0 &#215; 105 cells/well (6.0 &#215; 105 cells/ml) and gently but quickly mix it by pipetting without gelation.</li>
	<li>Dispense 0.5 ml of the mixture into each well of a 24-well non-treated plate quickly and carefully to make neat cylindrical form. Be careful not to allow any air bubbles to contaminate the gels (Figure 1A). 
	Note: The gel medium containing the cells is viscous and can easily gel and form crescent shape in the well.</li>
	<li>Incubate the plate for 15 min in a cell incubator at 37 &#176;C, 5% CO2 and 95% humidity to gel completely.</li>
	<li>Detach gels from the plate without breaking by moving a sterilized spatula in a manner to draw a circumference in one direction. Using a spatula, gently transfer the gels to 60 mm tissue culture dishes containing 5 ml of DMEM/1% FBS with or without TGF-&#946;1 (5 ng/ml) and TNF-&#945; (10 ng/ml).</li>
	<li>Gently shake the dishes to ensure gels are floating on the medium. Incubate in a cell incubator at 37 &#176;C, 5% CO2 and 95% humidity.</li>
</ol>
5. Measurement of Gel Size
<ol>
	<li>Measure the collagen gel size after 0, 24, 48, and 72 hr using an image analysis system.
	<ol>
		<li>Turn on the gel documentation system (Figure 2A), and put dishes into the light shielding cabinet. Then take off the lid of dishes in the cabinet.</li>
		<li>Open the related gel analyzing software. Click the &#34;image acquisition button&#34; in the menu-bar to show the image of the gels in the cabinet. Then, click &#34;acquire&#34; in the menu bar to take pictures of the gels (Figure 2B).</li>
		<li>Click the &#34;detection button&#34; in the menu bar (Figure 2C) and adjust the measurement region (yellow circle in Figure 2C) by dragging the mouse. Then, click the &#34;auto-detect button&#34; in the menu bar (see button in Figure 2D). The software automatically detects the gels showing a heatmap (Figure 2D).</li>
		<li>Click &#34;OK&#34; to extract the outline of the gels by image processing and to calculate areas surrounded by the outline (Figure 2E). After the area is calculated, the calculated area is displayed in separate pop-up window. 
		Note: If the gels overlap each other during imaging, move gels gently using a sterile pipette tip.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wynn, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+and+molecular+mechanisms+of+fibrosis.">Cellular and molecular mechanisms of fibrosis.</a> The Journal of pathology. 214, 199-214 (2008).</li><li>Hardie, W. D., Glasser, S. W., Hagood, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+concepts+in+the+pathogenesis+of+lung+fibrosis.">Emerging concepts in the pathogenesis of lung fibrosis.</a> The American journal of pathology. 175, 3-16 (2009).</li><li>Kovacic, J. C., Mercader, N., Torres, M., Boehm, M., Fuster, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-to-mesenchymal+and+endothelial-to-mesenchymal+transition:+from+cardiovascular+development+to+disease.">Epithelial-to-mesenchymal and endothelial-to-mesenchymal transition: from cardiovascular development to disease.</a> Circulation. 125, 1795-1808 (2012).</li><li>Thiery, J. P., Acloque, H., Huang, R. Y., Nieto, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transitions+in+development+and+disease.">Epithelial-mesenchymal transitions in development and disease.</a> Cell. 139, 871-890 (2009).</li><li>Kalluri, R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+basics+of+epithelial-mesenchymal+transition.">The basics of epithelial-mesenchymal transition.</a> The Journal of clinical investigation. 119, 1420-1428 (2009).</li><li>Forino, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGFbeta1+induces+epithelial-mesenchymal+transition,+but+not+myofibroblast+transdifferentiation+of+human+kidney+tubular+epithelial+cells+in+primary+culture.">TGFbeta1 induces epithelial-mesenchymal transition, but not myofibroblast transdifferentiation of human kidney tubular epithelial cells in primary culture.</a> International journal of experimental pathology. 87, 197-208 (2006).</li><li>Yang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Participation+of+miR-200+in+pulmonary+fibrosis.">Participation of miR-200 in pulmonary fibrosis.</a> The American journal of pathology. 180, 484-493 (2012).</li><li>Reynolds, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lung+inflammation+and+fibrosis:+an+alveolar+macrophage-centered+perspective+from+the+1970s+to+1980s.">Lung inflammation and fibrosis: an alveolar macrophage-centered perspective from the 1970s to 1980s.</a> American journal of respiratory and critical care medicine. 171, 98-102 (2005).</li><li>Camara, J., Jarai, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+primary+human+bronchial+epithelial+cells+is+Smad-dependent+and+enhanced+by+fibronectin+and+TNF-alpha.">Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-alpha.</a> Fibrogenesis &amp; tissue repair. 3, 2 (2010).</li><li>Kamitani, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+stimulation+with+TGF-beta1+and+TNF-alpha+induces+epithelial+mesenchymal+transition+in+bronchial+epithelial+cells.">Simultaneous stimulation with TGF-beta1 and TNF-alpha induces epithelial mesenchymal transition in bronchial epithelial cells.</a> International archives of allergy and immunology. 155, 119-128 (2011).</li><li>Mikami, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphotoxin+beta+receptor+signaling+induces+IL-8+production+in+human+bronchial+epithelial+cells.">Lymphotoxin beta receptor signaling induces IL-8 production in human bronchial epithelial cells.</a> PloS one. 9, e114791 (2014).</li><li>Yamauchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+necrosis+factor-alpha+enhances+both+epithelial-mesenchymal+transition+and+cell+contraction+induced+in+A549+human+alveolar+epithelial+cells+by+transforming+growth+factor-beta1.">Tumor necrosis factor-alpha enhances both epithelial-mesenchymal transition and cell contraction induced in A549 human alveolar epithelial cells by transforming growth factor-beta1.</a> Experimental lung research. 36, 12-24 (2010).</li><li>Grinnell, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fibroblasts,+myofibroblasts,+and+wound+contraction.">Fibroblasts, myofibroblasts, and wound contraction.</a> The Journal of cell biology. 124, 401-404 (1994).</li><li>Ramos, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FGF-1+reverts+epithelial-mesenchymal+transition+induced+by+TGF-{beta}1+through+MAPK/ERK+kinase+pathway+.">FGF-1 reverts epithelial-mesenchymal transition induced by TGF-{beta}1 through MAPK/ERK kinase pathway .</a> American journal of physiology. Lung cellular and molecular physiology. 299, L222-L231 (2010).</li><li>Ren, Z. X., Yu, H. B., Li, J. S., Shen, J. L., Du, W. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suitable+parameter+choice+on+quantitative+morphology+of+A549+cell+in+epithelial-mesenchymal+transition.">Suitable parameter choice on quantitative morphology of A549 cell in epithelial-mesenchymal transition.</a> Bioscience reports. 35, (2015).</li><li>Brinkmann, V., Kinzel, B., Kristofic, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TCR-independent+activation+of+human+CD4++45RO-+T+cells+by+anti-CD28+plus+IL-2:+Induction+of+clonal+expansion+and+priming+for+a+Th2+phenotype.">TCR-independent activation of human CD4+ 45RO- T cells by anti-CD28 plus IL-2: Induction of clonal expansion and priming for a Th2 phenotype.</a> Journal of immunology. 156, 4100-4106 (1996).</li><li>Krug, M. S., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First-strand+cDNA+synthesis+primed+with+oligo(dT).">First-strand cDNA synthesis primed with oligo(dT).</a> Methods in enzymology. 152, 316-325 (1987).</li><li>Morozumi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+detection+of+pathogens+in+clinical+samples+from+patients+with+community-acquired+pneumonia+by+real-time+PCR+with+pathogen-specific+molecular+beacon+probes.">Simultaneous detection of pathogens in clinical samples from patients with community-acquired pneumonia by real-time PCR with pathogen-specific molecular beacon probes.</a> Journal of clinical microbiology. 44, 1440-1446 (2006).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical biochemistry. 150, 76-85 (1985).</li><li>Wiechelman, K. J., Braun, R. D., Fitzpatrick, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigation+of+the+bicinchoninic+acid+protein+assay:+identification+of+the+groups+responsible+for+color+formation.">Investigation of the bicinchoninic acid protein assay: identification of the groups responsible for color formation.</a> Analytical biochemistry. 175, 231-237 (1988).</li><li>Ursitti, J. A., Mozdzanowski, J., Speicher, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroblotting+from+polyacrylamide+gels.">Electroblotting from polyacrylamide gels.</a> Current protocols in protein science. Chapter 10, Unit 10.7 (2001).</li><li>Kricka, L. J., Voyta, J. C., Bronstein, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemiluminescent+methods+for+detecting+and+quantitating+enzyme+activity.">Chemiluminescent methods for detecting and quantitating enzyme activity.</a> Methods in enzymology. 305, 370-390 (2000).</li><li>Noguchi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrative+analysis+of+the+tumorigenic+role+of+TAZ+in+human+non-small+cell+lung+cancer.">An integrative analysis of the tumorigenic role of TAZ in human non-small cell lung cancer.</a> Clinical cancer research : an official journal of the American Association for Cancer Research. 20, 4660-4672 (2014).</li><li>Kasai, H., Allen, J. T., Mason, R. M., Kamimura, T., Zhang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta1+induces+human+alveolar+epithelial+to+mesenchymal+cell+transition+(EMT).">TGF-beta1 induces human alveolar epithelial to mesenchymal cell transition (EMT).</a> Respiratory research. 6, 56 (2005).</li><li>Chen, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrin-mediated+type+II+TGF-beta+receptor+tyrosine+dephosphorylation+controls+SMAD-dependent+profibrotic+signaling.">Integrin-mediated type II TGF-beta receptor tyrosine dephosphorylation controls SMAD-dependent profibrotic signaling.</a> The Journal of clinical investigation. 124, 3295-3310 (2014).</li><li>Saito, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+expression+profiling+reveals+target+genes+of+TGF-beta+and+TNF-alpha+possibly+mediated+by+microRNAs+in+lung+cancer+cells.">An integrated expression profiling reveals target genes of TGF-beta and TNF-alpha possibly mediated by microRNAs in lung cancer cells.</a> PloS one. 8, e56587 (2013).</li><li>Dvashi, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+phosphatase+magnesium+dependent+1A+governs+the+wound+healing-inflammation-angiogenesis+cross+talk+on+injury.">Protein phosphatase magnesium dependent 1A governs the wound healing-inflammation-angiogenesis cross talk on injury.</a> The American journal of pathology. 184, 2936-2950 (2014).</li><li>Hallgren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+ROCK1+dependent+contractility+in+fibroblast+from+chronic+obstructive+pulmonary+disease+patients.">Enhanced ROCK1 dependent contractility in fibroblast from chronic obstructive pulmonary disease patients.</a> Journal of translational medicine. 10, 171 (2012).</li><li>Kobayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Matrix+metalloproteinase-9+activates+TGF-beta+and+stimulates+fibroblast+contraction+of+collagen+gels.">Matrix metalloproteinase-9 activates TGF-beta and stimulates fibroblast contraction of collagen gels.</a> American journal of physiology. Lung cellular and molecular physiology. 306, L1006-L1015 (2014).</li><li>Horie, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histamine+induces+human+lung+fibroblast-mediated+collagen+gel+contraction+via+histamine+H1+receptor.">Histamine induces human lung fibroblast-mediated collagen gel contraction via histamine H1 receptor.</a> Experimental lung research. 40, 222-236 (2014).</li><li>Kohyama, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PGD(2)+modulates+fibroblast-mediated+native+collagen+gel+contraction.">PGD(2) modulates fibroblast-mediated native collagen gel contraction.</a> American journal of respiratory cell and molecular biology. 27, 375-381 (2002).</li><li>Muir, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Esophageal+epithelial+cells+acquire+functional+characteristics+of+activated+myofibroblasts+after+undergoing+an+epithelial+to+mesenchymal+transition.">Esophageal epithelial cells acquire functional characteristics of activated myofibroblasts after undergoing an epithelial to mesenchymal transition.</a> Experimental cell research. 330, 102-110 (2015).</li><li>Zhong, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+endoplasmic+reticulum+stress+in+epithelial-mesenchymal+transition+of+alveolar+epithelial+cells:+effects+of+misfolded+surfactant+protein.">Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein.</a> American journal of respiratory cell and molecular biology. 45, 498-509 (2011).</li><li>Liu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+cytokines+augments+TGF-beta1-induced+epithelial-mesenchymal+transition+in+A549+cells+by+up-regulating+TbetaR-I.">Inflammatory cytokines augments TGF-beta1-induced epithelial-mesenchymal transition in A549 cells by up-regulating TbetaR-I.</a> Cell motility and the cytoskeleton. 65, 935-944 (2008).</li></ol>

The authors have no conflicts of interest to disclose.

The protocol developed in this study comprises two steps. The first step is performed to induce EMT, while the second step is the gel contraction assay. Since it is important to confirm that cells underwent EMT, step 2 provides an excellent complement to the morphological and gene expression changes. Previous studies showed that EMT of A549 cells was induced by TGF-&#946;1 only24; however, as we have reported previously10, TNF-&#945; treatment enhances EMT and the acquisition of mesenchymal cell markers. It is thought that the mechanisms of TGF-&#946;-mediated EMT is smad-dependent25. TNF&#945; enhances TGF-&#946;1-induced EMT that leads to enhancement of gel contraction. It has been reported that the mechanisms of TNF&#945; for enhancement of TGF-&#946;1-induced EMT are not only phosphorylation of smad2 linker region, but also MAPK signaling regulation26. Therefore, the protocol developed in this study included stimulation by both TGF-&#946;1 and TNF-&#945;.
The embedding of cells that underwent EMT into the type I collagen gel, and floating on the medium, are central aspects of this assay (step 4). Because the gels are soft and easily damaged, and have different dimensions on each side, extreme caution is required when applying the gels to the medium and measuring their sizes. If it is difficult to carry out this step, there is an alternative method to measure the gel sizes in the well without moving the gels into 60 mm dish27,28. There are several common problems, the first problem is that the collagen gels easily gelate at RT, so the gels often deform as mentioned in step 4.7. Therefore, the plate must be gently shaken after casting the gels into wells to make sure they take on a neat cylindrical form. The second problem is that if any air bubbles enter the gels during gelation, then the size of the gels will be uneven. Be careful not to allow any air bubbles to contaminate the gels. There are two main differences between original method and this method. The first differences is that the final concentration of collagen gels of original method is 0.75 mg/ml but that of this method is 1.75 mg/ml in order to allow the gels to contract more than they do with the original method. The second differences is that the original method uses serum free medium for gel floating medium but this method uses 1% FBS in the gel floating medium in order to keep cell viability and maintain cell contractility.
The gel contraction assay originally developed for fibroblasts is an ideal in vitro model for evaluating the contractility of cells that contribute to the process of wound healing and fibrosis 13. The attachment of fibroblasts to type 1 collagen is supposed to produce mechanical tensions that consequently leads to a reduction in the size of the collagen gels. Additionally, this assay has recently been used as an in vitro model for studying the contraction of airway cells in inflammatory diseases, including bronchial asthma and COPD29-31.
The gel contraction assay is comparable to other assays, such as cell migration assays, in that it does not require specific devices and exhibits high quantitative reproducibility. However, there are few reports applying the gel contraction assay for evaluating EMT32. In this study, gels containing cells that underwent EMT significantly decreased in size from 24 to 72 hr after gelation, indicating cell contraction. There are however limitations to this method. The first is that in this assay, the size change of the gels show the sum of contractility of all cells in the gels. However, it is difficult to evaluate single cell contractility in the gels using this assay. The second is that A549 cells is a cancer cell line, not normal human epithelial cells. Therefore, it is difficult to extrapolate our results directly to the pathogenesis of pulmonary fibrosis. However, A549 cells are widely used to study the functions of airway epithelial cells, and several studies yielded evidence of EMT by using A549 cells as a model of pulmonary fibrosis 33,34.
In summary, the type I collagen gels containing mesenchymal cells that underwent EMT were reduced in size, indicating contraction of those cells. Thus, the gel contraction assay should be considered as an extended in vitro assay to evaluate acquisition of contractile function in the cells through EMT process.

Fibrosis is involved in the pathogenesis of various chronic progressive diseases, such as interstitial pulmonary disease, cardiac fibrosis, liver cirrhosis, terminal renal failure, systemic sclerosis, and autoimmune disease1. Among interstitial lung diseases, idiopathic pulmonary fibrosis (IPF) is a chronic progressive disease and shows poor prognosis. Pathological hallmark of IPF is the development of fibroblastic foci consisting of activated fibroblasts and myofibroblasts that are associated with the prognosis. The origins of such pulmonary fibroblasts are proposed to be derived from several mesenchymal cells, including originally resident pulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, epithelial-mesenchymal transition (EMT) has been proposed to be associated with the formation of mesenchymal cells2, and to contribute to the pathogenesis of fibrotic disorders.
It is thought that EMT plays important roles in the process of fetal development, wound healing, and progression of cancer, including tumor invasion and metastasis3. Following the process of EMT, epithelial cells obtain the ability of mesenchymal cells by loss of epithelial markers, such as E-cadherin, and by expression of mesenchymal markers, such as vimentin, and &#945;-smooth muscle actin (SMA)4,5. Previous studies showed the evidence that EMT process has been associated with the development of tissue fibrosis in the kidney6 and lung7. Additionally, chronic inflammation promotes fibrotic disease8; furthermore, such inflammatory cytokines as Tumor necrosis factor superfamily member 14 (TNFSF14; LIGHT), tumor necrosis factor (TNF)-&#945;, and interleukin-1&#946;, have been shown to enhance EMT9-12.
Collagen gel contraction assay, a collagen-based cell contraction assay in which fibroblasts are embedded in type I collagen gel three-dimensionally, is an ideal in vitro model for the evaluation of contractility. Contractility is one of the characteristic functions of fibroblasts and contributes to normal wound repair and fibrosis13. In this assay, it is thought that the attachment of fibroblasts to type I collagen through integrin-dependent mechanisms is supposed to produce mechanical tension under some conditions, and consequently lead to tissue contraction.
Here, the development of the gel contraction assay is reported to be adapted to evaluate the acquisition of contractile function in the cells that underwent EMT. This report demonstrates that this modified assay is suitable for evaluating contractility in mesenchymal cells that underwent EMT.

<table><tbody><tr><td>DMEM</td><td>sigma aldrich</td><td>11965-092</td><td>For A549 medium</td></tr><tr><td>FBS</td><td>GIBCO</td><td>10437</td><td></td></tr><tr><td>Transforming Growth Factor-&amp;beta;1, Human, recombinant</td><td>Wako Laboratory chemicals</td><td>209-16544</td><td></td></tr><tr><td>Recombinant Human TNF-&amp;alpha;</td><td>R&amp;amp;D systems</td><td>210-TA/CF</td><td></td></tr><tr><td>E-Cadherin (24E10) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#3195</td><td>1:3,000 dilution</td></tr><tr><td>Vimentin (D21H3) Rabbit mAb</td><td>Cell Signaling Technology</td><td>#5741</td><td>1:3,000 dilution</td></tr><tr><td>Anti-&amp;alpha;-Tubulin antibody</td><td>sigma aldrich</td><td>T9026</td><td>1:10,000 dilution</td></tr><tr><td>Monoclonal Anti-Actin, &amp;alpha;-Smooth Muscle antibody&amp;nbsp;</td><td>sigma aldrich</td><td>A5228</td><td>1:10,000 dilution</td></tr><tr><td>Anti-N-cadherin antibody</td><td>BD Transduction Laboratories</td><td>#610920</td><td>1:1,000 dilution</td></tr><tr><td>Anti-Mouse IgG, HRP-Linked Whole Ab Sheep (secondary antibody)</td><td>GE Healthcare</td><td>NA931-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Anti-Rabbit IgG, HRP-Linked Whole Ab Donkey (secondary antibody)</td><td>GE Healthcare</td><td>NA934-100UL</td><td>1:20,000 dilution</td></tr><tr><td>Blocking reagent</td><td>GE Healthcare</td><td>RPN418</td><td>2% in TBS-T</td></tr><tr><td>6 Well Clear Flat Bottom TC-Treated Multiwell Cell Culture Plate, with Lid</td><td>corning</td><td>#353046</td><td></td></tr><tr><td>100 mm Cell culture dish</td><td>TPP</td><td>#93100</td><td></td></tr><tr><td>DMEM, powder</td><td>life technologies</td><td>12100-046</td><td>For 4&amp;times; DMEM</td></tr><tr><td>Type 1 collagen gel</td><td>Nitta gelatin</td><td>Cellmatrix type I-A</td><td></td></tr><tr><td>24 Well cell culture plate</td><td>AGC TECHNO GLASS</td><td>1820-024</td><td></td></tr><tr><td>Gel Documentation System&amp;nbsp;</td><td>ATTO</td><td>AE-6911FXN</td><td>Gel imager</td></tr><tr><td>Gel analyzing software</td><td>ATTO</td><td>Densitograph, ver. 3.00</td><td>analysing software bundled with AE-6911FXN</td></tr><tr><td>Trypsin-EDTA (0.05%), phenol red</td><td>life technologies</td><td>25300054</td><td></td></tr><tr><td>24 Well Plates, Non-Treated</td><td>IWAKI</td><td>1820-024</td><td></td></tr><tr><td>Trypan Blue Solution, 0.4%</td><td>life technologies</td><td>15250-061</td><td></td></tr><tr><td>RNA extraction kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>Reverse transcriptase</td><td>life technologies</td><td>18080044</td><td></td></tr><tr><td>Real time PCR system</td><td>Stratagene</td><td>Mx-3000P</td><td></td></tr><tr><td>SYBR green PCR kit</td><td>Qiagen</td><td>204145</td><td></td></tr><tr><td>Protease Inhibitor Cocktail (100x)</td><td>life technologies</td><td>78429</td><td></td></tr><tr><td>PVDF membrane</td><td>ATTO</td><td>2392390</td><td></td></tr><tr><td>Protein assay kit</td><td>bio-rad</td><td>5000006JA&amp;nbsp;</td><td></td></tr><tr><td>Polyacrylamide gel</td><td>ATTO</td><td>2331810</td><td></td></tr><tr><td>Western blotting detection reagent</td><td>GE Healthcare</td><td>RPN2232</td><td></td></tr><tr><td>Cold CCD camera</td><td>ATTO</td><td>Ez-Capture MG/ST</td><td></td></tr><tr><td>Trypsin inhibitor</td><td>sigma aldrich</td><td>T9003-100MG</td><td></td></tr><tr><td>Polyoxyethylene (20)Sorbitan Monolaurate</td><td>Wako Laboratory chemicals</td><td>163-11512</td><td></td></tr><tr><td>Polyoxyethylene (9) octyiphenyl ether</td><td>Wako Laboratory chemicals</td><td>141-08321</td><td></td></tr></tbody></table>

development of an in vitro assay to evaluate contractile function of mesenchymal cells that underwent epithelial-mesenchymal transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is the formation of fibroblastic foci, which is associated with the disease severity. Mesenchymal cells consisting of the fibroblastic foci are proposed to be derived from several cell sources, including originally resident intrapulmonary fibroblasts and circulating fibrocytes from bone marrow. Recently, mesenchymal cells that underwent epithelial-mesenchymal transition (EMT) have been also supposed to contribute to the pathogenesis of fibrosis. In addition, EMT can be induced by transforming growth factor &#946;, and EMT can be enhanced by pro-inflammatory cytokines like tumor necrosis factor &#945;. The gel contraction assay is an ideal in vitro model for the evaluation of contractility, which is one of the characteristic functions of fibroblasts and contributes to wound repair and fibrosis. Here, the development of a gel contraction assay is demonstrated for evaluating contractile ability of mesenchymal cells that underwent EMT.

During EMT, epithelial cells lose epithelial markers, like E-cadherin, and gain the expression of mesenchymal markers, such as vimentin and &#945;-smooth muscle actin4,5. Incubation of A549 human lung epithelial cells with TGF-&#946;1 and TNF-&#945; induces EMT. The appearance of normal A549 cells are cobble stone like shape and triangle shape that is a characteristic of epithelial cells (Figure 3A), but after stimulated with TGF-&#946;1 and TNF-&#945;, the appearance changed to long spindle shape that is similar to mesenchymal cells (Figure 3B).
The expression of epithelial and mesenchymal markers was evaluated to confirm that cells underwent EMT. Relative mRNA expression was calculated with &#916;&#916;Ct method. Individual data was normalized against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) that is a housekeeping gene. A549 cells treated with TGF-&#946;1 and TNF-&#945; for 48 hr had significantly reduced expression of CDH1 and significantly increased expression of VIM and ACTA2 (Figure 4A). The primers sequences used for q-PCR are shown in Table1. As shown in Figure 4B, stimulation with TGF-&#946;1 and TNF-&#945; attenuated E-cadherin expression, whereas the expression of vimentin, N-cadherin, and &#945;-smooth muscle actin was induced.
The gel contraction assay was performed to evaluate the contractility of cells that underwent EMT. After inducing EMT with TGF-&#946;1 and TNF-&#945;, cells were cast into the collagen gel and incubated for 72 hr in media containing TGF-&#946;1 and TNF-&#945;, or PBS. As shown in Figure 5A, the gels containing cells treated with TGF-&#946;1 and TNF-&#945; were smaller than control gels containing cells treated with PBS. To quantify the changes in gel size, gels were analyzed using a gel analyzer 0, 24, 48, and 72 hr after treatment. After 72 hr, the sizes of gels containing cells treated with TGF-&#946;1 and TNF-&#945; were significantly reduced compared to the control gels (Figure 5B). We also confirmed that the gels containing cells treated with TGF-&#946;1 alone were smaller than control gels but were not smaller than the gels treated with TGF-&#946;1 and TNF-&#945; (data not shown).
<img alt="Figure 1" src="/files/ftp_upload/53974/53974fig1.jpg" /> 
Figure 1.&#160;Supplementary Figure for Making Gels. These images show the gels cast into wells. The gel medium containing the cells is viscous and can easily gel and form crescent shape in the well. (A) The left image shows that the gels are casted correctly, and the right image shows the schema of &#34;neat cylindrical form&#34;. (B)The left image shows that the gels deform, and the right image shows that air bubbles contaminate the gels. (C) The gels are soft, so easily damaged and usually deform like &#34;Pac-Man&#34;. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53974/53974fig2.jpg" /> 
Figure 2.&#160;The Steps for Measuring the Gel Size. (A) The gel documentation system consists of a PC and a gel imaging system. (B) The &#34;image acquisition button&#34;, and a picture of the gels. (C) The &#34;detection button&#34;, and the window for adjusting the measurement region (yellow circle). (D) The &#34;auto-detection button&#34;, and the software makes a heatmap of the gels from a picture to detect the outline of the gels. (E) The software extracts the outline of the gels by image processing, and calculates areas surrounded by the outline. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53974/53974fig3.jpg" /> 
Figure 3.&#160;Morphologies of EMT-induced Cells. A549 human lung epithelia were plated at a density of 1.0 &#215; 105 cells/well in a 6-well plate and incubated with or without 5 ng/ml TGF-&#946;1 and 10 ng/ml TNF-&#945; for 48 hr, followed by phase contrast microscopic imaging. (A) and (B) are images obtained under &#215;200. The scale bars in (A) and (B), 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53974/53974fig4.jpg" /> 
Figure 4.&#160;EMT Stimulation with TGF-&#946;1 and TNF-&#945;. (A) qRT-PCR analysis of EMT marker expression (CDH1, VIM, and ACTA2). (B) Western blot showing the expression of E-cadherin, N-cadherin, vimentin, and &#945; smooth muscle actin proteins in A549 cells stimulated with or without TGF-&#946;1 and TNF-&#945;. &#945;-tubulin was used as the internal control. A549 cells were cultured as in Figure 1. N = 3 independent experiments. ** p &#60;0.01; error bars represent SEM. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53974/53974fig5.jpg" /> 
Figure 5.&#160;Cells Undergoing EMT Acquired Contractility. A549 cells were plated at a density of 1.0 x 106 cells/dish in 10 cm dishes and incubated with or without 5 ng/ml TGF-&#946;1 and 10 ng/ml TNF-&#945; for 48 hr. Cells were then cast into 500 &#181;l&#160;of medium containing 1.75 mg/ml collagen gel at a density of 3.0 &#215; 105 cells/well in a 24-well plate. After gel formation, they were added to medium with or without 5 ng/ml TGF-&#946;1 and 10 ng/ml TNF-&#945; in 60 mm dishes and incubated for 72 hr followed by imaging (A). Gel sizes were measured after 0, 24, 48, and 72 hr using an image analysis system. N = 9 independent experiments (B). ** p &#60;0.01; error bars represent SEM. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53974/53974fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene Name</td>
			<td colspan="2">Forward 5&#39;&#8594;3&#39;</td>
			<td colspan="2">Reverse 5&#39;&#8594;3&#39;</td>
		</tr>
		<tr>
			<td>ACTA2</td>
			<td colspan="2">GCACCCAGCACCATGAAGA</td>
			<td colspan="2">ACCGATCCAGACAGAGTATTT</td>
		</tr>
		<tr>
			<td>GAPDH</td>
			<td colspan="2">GGTGAAGGTCGGAGTCAACGGA</td>
			<td colspan="2">GAGGGATCTCGCTCCTGGAAGA</td>
		</tr>
		<tr>
			<td>VIM</td>
			<td colspan="2">GACAATGCGTCTCTGGCACGTCTT</td>
			<td colspan="2">TTCTTCTGCCTCCTGCAGGTTCTT</td>
		</tr>
		<tr>
			<td>CDH1</td>
			<td colspan="2">CCCATCAGCTGCCCAGAAAATGAA</td>
			<td colspan="2">CTGTCACCTTCAGCCATCCTGTTT</td>
		</tr>
	</tbody>
</table>
Table 1. Primer Sequences. Primer sequences used for qRT-PCR. GAPDH was used as internal control.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Lysis Buffer: RIPA Buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>20 mM Tris-HCl pH 7.5</td>
			<td></td>
		</tr>
		<tr>
			<td>150 mM NaCl</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mM EDTA</td>
			<td></td>
		</tr>
		<tr>
			<td>1% Polyoxyethylene (9) octyiphenyl ether</td>
			<td></td>
		</tr>
		<tr>
			<td>0.1% Na-deoxycholate</td>
			<td></td>
		</tr>
		<tr>
			<td>0.1% SDS</td>
			<td></td>
		</tr>
		<tr>
			<td>Blocking Buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>1% Blocking reagent in wash buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>Wash buffer: TBST buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>45 g</td>
		</tr>
		<tr>
			<td>1 M Tris pH 7.4</td>
			<td>50 ml</td>
		</tr>
		<tr>
			<td>Polyoxyethylene (20) Sorbitan monolaurate</td>
			<td>2.5 ml</td>
		</tr>
		<tr>
			<td>Distill Water</td>
			<td>add to 5 L</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>5 L</td>
		</tr>
	</tbody>
</table>
Table 2. The Components of &#160;Buffers Used. The components of lysis, blocking buffer and wash buffer.

Watch this Scientific Journal Video about Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition at JoVE.com

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Fibrosis is often involved in the pathogenesis of various chronic progressive diseases such as interstitial pulmonary disease. Pathological hallmark is ...

development-an-vitro-assay-to-evaluate-contractile-function

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

12.1K Views.  The University of Tokyo Hospital. Here, we describe the development and application of a gel contraction assay for evaluating contractile function in mesenchymal cells that underwent epithelial-mesenchymal transition.

Video: Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

Ovarian cancer is the fifth leading cause of cancer related deaths in the United States1. Despite a positive initial response to therapies, 70 to 90 percent of women with ovarian cancer develop new metastases, and the recurrence is often fatal2. It is, therefore, necessary to understand how secondary metastases arise in order to develop better treatments for intermediate and late stage ovarian cancer. Ovarian cancer metastasis occurs when malignant cells detach from the primary tumor site and disseminate throughout the peritoneal cavity. The disseminated cells can form multicellular clusters, or spheroids, that will either remain unattached, or implant onto organs within the peritoneal cavity3 (Figure 1, Movie 1). 
All of the organs within the peritoneal cavity are lined with a single, continuous, layer of mesothelial cells4-6 (Figure 2). However, mesothelial cells are absent from underneath peritoneal tumor masses, as revealed by electron micrograph studies of excised human tumor tissue sections3,5-7 (Figure 2). This suggests that mesothelial cells are excluded from underneath the tumor mass by an unknown process. 
Previous in vitro experiments demonstrated that primary ovarian cancer cells attach more efficiently to extracellular matrix than to mesothelial cells8, and more recent studies showed that primary peritoneal mesothelial cells actually provide a barrier to ovarian cancer cell adhesion and invasion (as compared to adhesion and invasion on substrates that were not covered with mesothelial cells)9,10. This would suggest that mesothelial cells act as a barrier against ovarian cancer metastasis. The cellular and molecular mechanisms by which ovarian cancer cells breach this barrier, and exclude the mesothelium have, until recently, remained unknown. 
Here we describe the methodology for an in vitro assay that models the interaction between ovarian cancer cell spheroids and mesothelial cells in vivo (Figure 3, Movie 2). Our protocol was adapted from previously described methods for analyzing ovarian tumor cell interactions with mesothelial monolayers8-16, and was first described in a report showing that ovarian tumor cells utilize an integrin &#x2013;dependent activation of myosin and traction force to promote the exclusion of the mesothelial cells from under a tumor spheroid17. This model takes advantage of time-lapse fluorescence microscopy to monitor the two cell populations in real time, providing spatial and temporal information on the interaction. The ovarian cancer cells express red fluorescent protein (RFP) while the mesothelial cells express green fluorescent protein (GFP). RFP-expressing ovarian cancer cell spheroids attach to the GFP-expressing mesothelial monolayer. The spheroids spread, invade, and force the mesothelial cells aside creating a hole in the monolayer. This hole is visualized as the negative space (black) in the GFP image. The area of the hole can then be measured to quantitatively analyze differences in clearance activity between control and experimental populations of ovarian cancer and/ or mesothelial cells. This assay requires only a small number of ovarian cancer cells (100 cells per spheroid X 20-30 spheroids per condition), so it is feasible to perform this assay using precious primary tumor cell samples. Furthermore, this assay can be easily adapted for high throughput screening.

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

The mesothelial clearance assay described here takes advantage of fluorescently labeled cells and time-lapse video microscopy to visualize and quantitatively measure the interactions of ovarian cancer multicellular spheroids and mesothelial cell monolayers. This assay models the early steps of ovarian cancer metastasis.

Ovarian cancer is the fifth leading cause of cancer related deaths in the United States1. Despite a positive initial response to therapies, 70 to 90 ...

Medicine

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature maintenance and pathological malformations can result in severe ischemic diseases, while overly abundant vascular development is associated with cancer and inflammatory disorders. A promising form of pro-angiogenic therapy is the use of angiogenic cell sources, which can provide regulatory factors as well as physical support for newly developing vasculature.
Mesenchymal Stromal Cells (MSCs) are extensively investigated candidates for vascular regeneration due to their paracrine effects and their ability to detect and home to ischemic or inflamed tissues. In particular, first trimester human umbilical cord perivascular cells (FTM HUCPVCs) are a highly promising candidate due to their pericyte-like properties, high proliferative and multilineage potential, immune-privileged properties, and robust paracrine profile. To effectively evaluate potentially angiogenic regenerative cells, it is a requisite to test them in reliable and &#34;translatable&#34; pre-clinical assays. The aortic ring assay is an ex vivo angiogenesis model that allows for easy quantification of tubular endothelial structures, provides accessory supportive cells and extracellular matrix (ECM) from the host, excludes inflammatory components, and is fast and inexpensive to set up. This is advantageous when compared to in vivo models (e.g., corneal assay, Matrigel plug assay); the aortic ring assay can track the administered cells and observe intercellular interactions while avoiding xeno-immune rejection.
We present a protocol for a novel application of the aortic ring assay, which includes human MSCs in co-cultures with developing rat aortic endothelial networks. This assay allows for the analysis of the MSC contribution to tube formation and development through physical pericyte-like interactions and of their potency for actively migrating to sites of angiogenesis, and for evaluating their ability to perform and mediate ECM processing. This protocol provides further information on changes in MSC phenotype and gene expression following co-culture.

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Here, we present a novel application of the aortic ring assay where prelabelled mesenchymal cells are co-cultured with rat aorta-derived endothelial networks. This novel method allows visualization of Mesenchymal Stromal Cells (MSCs) homing and integration with endothelial networks, quantification of network properties, and evaluation of MSC immunophenotypes and gene expression.

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature ...

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which facilitate the functional assessment of the seeded cells. To that end, microscale cantilever technology offers a platform with which to measure the contractile functionality of a range of cell types, including skeletal, cardiac, and smooth muscle cells, through assessment of contraction induced substrate bending. Application of multiplexed cantilever arrays provides the means to develop moderate to high-throughput protocols for assessing drug efficacy and toxicity, disease phenotype and progression, as well as neuromuscular and other cell-cell interactions. This manuscript provides the details for fabricating reliable cantilever arrays for this purpose, and the methods required to successfully culture cells on these surfaces. Further description is provided on the steps necessary to perform functional analysis of contractile cell types maintained on such arrays using a novel laser and photo-detector system. The representative data provided highlights the precision and reproducible nature of the analysis of contractile function possible using this system, as well as the wide range of studies to which such technology can be applied. Successful widespread adoption of this system could provide investigators with the means to perform rapid, low cost functional studies in vitro, leading to more accurate predictions of tissue performance, disease development and response to novel therapeutic treatment.

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

This protocol describes the use of microscale silicon cantilevers as pliable culture surfaces for measuring the contractility of muscle cells in vitro. Cellular contraction causes cantilever bending, which can be measured, recorded, and converted into readouts of force, providing a non-invasive and scalable system for measuring contractile function in vitro.

The development of more predictive and biologically relevant in vitro assays is predicated on the advancement of versatile cell culture systems which ...

Bioengineering

High Throughput Traction Force Microscopy Using PDMS Reveals Dose-Dependent Effects of Transforming Growth Factor-&#946; on the Epithelial-to-Mesenchymal Transition

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and mechanical stability, and represents a core element of multi-cellular animal life. In adherent cells, acto-myosin contraction is seen in traction forces that cells exert on their substrate. Dysregulation of cellular contractility appears in a myriad of pathologies, making contractility a promising target in diverse diagnostic approaches using biophysics as a metric. Moreover, novel therapeutic strategies can be based on correcting the apparent malfunction of cell contractility. These applications,&#160;however, require direct quantification of these forces.
We have developed silicone elastomer-based traction force microscopy (TFM) in a parallelized multi-well format. Our use of a silicone rubber, specifically polydimethylsiloxane (PDMS), rather than the commonly employed hydrogel polyacrylamide (PAA) enables us to make robust and inert substrates with indefinite shelf-lives requiring no specialized storage conditions. Unlike pillar-PDMS based approaches that have a modulus in the GPa range, the PDMS used here is very compliant, ranging from approximately 0.4 kPa to 100 kPa. We create a high-throughput platform for TFM by partitioning these large monolithic substrates spatially into biochemically independent wells, creating a multi-well platform for traction force screening that is compatible with existing multi-well systems.
In this manuscript, we use this multi-well traction force system to examine the Epithelial to Mesenchymal Transition (EMT); we induce EMT in NMuMG cells by exposing them to TGF-&#946;, and to quantify the biophysical changes during EMT. We measure the contractility as a function of concentration and duration of TGF-&#946; exposure. Our findings here demonstrate the utility of parallelized TFM in the context of disease biophysics.

We present a high throughput traction force assay fabricated with silicone rubber (PDMS). This novel assay is suitable for studying physical changes in cell contractility during various biological and biomedical processes and diseases. We demonstrate this method's utility by measuring a TGF-&#946; dependent increase in contractility during the epithelial-to-mesenchymal transition.

Cellular contractility is essential in diverse aspects of biology, driving processes that range from motility and division, to tissue contraction and ...

An Explant Assay for Assessing Cellular Behavior of the Cranial Mesenchyme

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the neural tube in a process known as neurulation. During neurulation, morphogenesis of the mesenchyme that underlies the neural plate is believed to drive neural fold elevation. The cranial mesenchyme is comprised of the paraxial mesoderm and neural crest cells. The cells of the cranial mesenchyme form a pourous meshwork composed of stellate shaped cells and intermingling extracellular matrix (ECM) strands that support the neural folds. During neurulation, the cranial mesenchyme undergoes stereotypical rearrangements resulting in its expansion and these movements are believed to provide a driving force for neural fold elevation. However, the pathways and cellular behaviors that drive cranial mesenchyme morphogenesis remain poorly studied. Interactions between the ECM and the cells of the cranial mesenchyme underly these cell behaviors. Here we describe a simple ex vivo explant assay devised to characterize the behaviors of these cells. This assay is amendable to pharmacological manipulations to dissect the signaling pathways involved and live imaging analyses to further characterize the behavior of these cells. We present a representative experiment demonstrating the utility of this assay in characterizing the migratory properties of the cranial mesenchyme on a variety of ECM components.

The cranial mesenchyme undergoes dramatic morphogenic movements that likely provides a driving force for elevation of the neural folds1,2. Here we describe a simple ex vivo explant assay to characterize the cellular behaviors of the cranial mesenchyme during neurulation. This assay has numerous applications including being amenable to pharmacological manipulations and live imaging analyses.

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the ...

Biology

Simplified, High-throughput Analysis of Single-cell Contractility using Micropatterned Elastomers

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, function at both the cellular and tissue levels,and regulate the mechanical systems in the body. Numerous biological processes are force-dependent, including motility, adhesion, and division of single-cells, as well as contraction and relaxation of organs such as the heart, bladder, lungs, intestines, and uterus. Given its importance in maintaining proper physiological function, cellular contractility can also drive disease processes when exaggerated or disrupted. Asthma, hypertension, preterm labor, fibrotic scarring, and underactive bladder are all examples of mechanically driven disease processes that could potentially be alleviated with proper control of cellular contractile force. Here, we present a comprehensive protocol for utilizing a novel microplate-based contractility assay technology known as fluorescently labeled elastomeric contractible surfaces (FLECS), that provides simplified and intuitive analysis of single-cell contractility in a massively scaled manner. Herein, we provide a step-wise protocol for obtaining two six-point dose-response curves describing the effects of two contractile inhibitors on the contraction of primary human bladder smooth muscle cells in a simple procedure utilizing just a single FLECS assay microplate, to demonstrate proper technique to users of the method. Using FLECS Technology, all researchers with basic biological laboratories and fluorescent microscopy systems gain access to studying this fundamental but difficult-to-quantify functional cell phenotype, effectively lowering the entry barrier into the field of force biology and phenotypic screening of contractile cell force.

This work presents a flexible protocol for utilizing fluorescently labeled elastomeric contractible surfaces (FLECS) Technology in microwell format for simplified, hands-off quantification of single-cell contractile forces based on visualized displacements of fluorescent protein micropatterns.

Cellular contractile force generation is a fundamental trait shared by virtually all cells. These contractile forces are crucial to proper development, ...

Induction and Analysis of Epithelial to Mesenchymal Transition

Epithelial to mesenchymal transition (EMT) is essential for proper morphogenesis during development. Misregulation of this process has been implicated as a key event in fibrosis and the progression of carcinomas to a metastatic state. Understanding the processes that underlie EMT is imperative for the early diagnosis and clinical control of these disease states. Reliable induction of EMT in vitro is a useful tool for drug discovery as well as to identify common gene expression signatures for diagnostic purposes. Here we demonstrate a straightforward method for the induction of EMT in a variety of cell types. Methods for the analysis of cells pre- and post-EMT induction by immunocytochemistry are also included. Additionally, we demonstrate the effectiveness of this method through antibody-based array analysis and migration/invasion assays.

A straightforward method is described for the induction of epithelial to mesenchymal transition (EMT) in a variety of cell types. Methods for the analysis of cells in EMT states by immunocytochemistry are included.

Epithelial  to mesenchymal transition (EMT) is essential for proper morphogenesis during  development. Misregulation of this  process has been implicated ...

In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring apparatus and a motor to perform functional studies. These studies will allow measurement of cardiomyocyte stiffness (passive force) and its activation with different calcium (Ca2+)-containing solutions to determine, amongst others: maximum force development, myofilament Ca2+-sensitivity (pCa50), cooperativity (nHill) and the rate of force redevelopment (ktr). This method also enables determination of the effects of drugs acting directly on myofilaments and of the expression of exogenous recombinant proteins on both active and passive properties of cardiomyocytes. Clinically, skinned cardiomyocyte studies highlight the pathophysiology of many myocardial diseases and allow in vitro assessment of the impact of therapeutic interventions targeting the myofilaments. Altogether, this technique enables the clarification of cardiac pathophysiology by investigating correlations between in vitro and in vivo parameters in animal models and human tissue obtained during open heart or transplant surgery.

This protocol aims to describe step-by-step the technique of extraction and assessment of cardiac function using skinned cardiomyocytes. This methodology allows measurement and acutemodulation of myofilament function using small frozen biopsies that can be collected from different cardiac locations, from mice to men.

In this article, we describe the steps required to isolate a single permeabilized (&#34;skinned&#34;) cardiomyocyte and attach it to a force-measuring ...

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in the aorta and regulates vasoconstriction and vasodilation. Mutations in genes encoding for the SMC contractile apparatus proteins are associated with aortic diseases, such as thoracic aortic aneurysms. Measuring SMC contraction in vitro is challenging, especially in a high-throughput manner, which is essential for screening patient material. Currently available methods are not suitable for this purpose. This paper presents a novel method based on electric cell-substrate impedance sensing (ECIS). First, an explant protocol is described to isolate patient-specific human primary SMCs from aortic biopsies and patient-specific human primary dermal fibroblasts for the study of aortic aneurysms. Next, a detailed description of a new contraction method is given to measure the contractile response of these cells, including the subsequent analysis and suggestion for comparing different groups. This method can be used to study the contraction of adherent cells in the context of translational (cardiovascular) studies and patient and drug screening studies.

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro

This paper describes an explant culture-based method for the isolation and culturing of primary, patient-specific human aortic smooth muscle cells and dermal fibroblasts. Furthermore, a novel method is presented for measuring cell contraction and subsequent analysis, which can be used to study patient-specific differences in these cells.

Smooth muscle cells (SMCs) are the predominant cell type in the aortic media. Their contractile machinery is important for the transmission of force in ...

Development of an In Vitro Assay to Evaluate Contractile Function of Mesenchymal Cells that Underwent Epithelial-Mesenchymal Transition

Summary

Explore More Videos

Chapters in this video

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

In vitro Mesothelial Clearance Assay that Models the Early Steps of Ovarian Cancer Metastasis

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Utilization of Microscale Silicon Cantilevers to Assess Cellular Contractile Function In Vitro

High Throughput Traction Force Microscopy Using PDMS Reveals Dose-Dependent Effects of Transforming Growth Factor-β on the Epithelial-to-Mesenchymal Transition

An Explant Assay for Assessing Cellular Behavior of the Cranial Mesenchyme

Simplified, High-throughput Analysis of Single-cell Contractility using Micropatterned Elastomers

Induction and Analysis of Epithelial to Mesenchymal Transition

In Vitro Assessment of Cardiac Function Using Skinned Cardiomyocytes

Isolation of Primary Patient-specific Aortic Smooth Muscle Cells and Semiquantitative Real-time Contraction Measurements In Vitro