Bu araştırma Kanada Doğa Bilimleri ve Mühendislik Konseyi Discovery Grant (NSERC) tarafından desteklenmiştir.

<ol><li>Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomic+islands+in+pathogenic+and+environmental+microorganisms%5BTitle%5D)+AND+%22Nat+Rev+Microbiol%22%5BJournal%5D)">Genomic islands in pathogenic and environmental microorganisms.</a> Nat Rev Microbiol. 2 (5), 414-424 (2004).</li>
<li>Furuya, E. Y., Lowy, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Antimicrobial-resistant+bacteria+in+the+community+setting%5BTitle%5D)+AND+%22Nat+Rev+Microbiol%22%5BJournal%5D)">Antimicrobial-resistant bacteria in the community setting.</a> Nat Rev Microbiol. 4 (1), 36-45 (2006).</li>
<li>Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aGriffiths%2C+A+%22An+Introduction+to+Genetic+Analysis%2C+7th+Edition%22">An Introduction to Genetic Analysis, 7th Edition</a>. , W.H. Freeman. San Fransisco. (2000).</li>
<li>Cooper, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recombination+Speeds+Adaptation+by+Reducing+Competition+between+Beneficial+Mutations+in+Populations+of+Escherichia+coli%5BTitle%5D)+AND+%22PLoS+Biol%22%5BJournal%5D)">Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli.</a> PLoS Biol. Barton, N. H. 5 (9), 225(2007).</li>
<li>Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Disrupting+antibiotic+resistance+propagation+by+inhibiting+the+conjugative+DNA+relaxase%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci%22%5BJournal%5D)">Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase.</a> Proc Natl Acad Sci. 104 (30), 12282-12287 (2007).</li>
<li>Carattoli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Plasmids+and+the+spread+of+resistance%5BTitle%5D)+AND+%22Int+J+Med+Microbiol%22%5BJournal%5D)">Plasmids and the spread of resistance.</a> Int J Med Microbiol. 303 (6-7), 298-304 (2013).</li>
<li>Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aShala%2C+A+%22Handbook+of+Clinical+Nanomedicine%3A+Nanoparticles%2C+Imaging%2C+Therapy+and+Clinical+Applications%22">Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications</a>. Bawa, R., Audette, G. F., Rubenstein, I. , Pan Sanford Publishing. Singapore. 657-686 (2016).</li>
<li>Tseng, T. T., Tyler, B. M., Setubal, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Protein+secretion+systems+in+bacterial-host+associations%2C+and+their+description+in+the+Gene+Ontology%5BTitle%5D)+AND+%22BMC+Microbiol%22%5BJournal%5D)">Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology.</a> BMC Microbiol. 9 (1), Suppl 1 2(2009).</li>
<li>Alvarez-Martinez, C. E., Christie, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Biological+diversity+of+prokaryotic+type+IV+secretion+systems%5BTitle%5D)+AND+%22Microbiol+Mol+Biol+Rev%22%5BJournal%5D)">Biological diversity of prokaryotic type IV secretion systems.</a> Microbiol Mol Biol Rev. 73 (4), 775-808 (2009).</li>
<li>Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((F+factor+conjugation+is+a+true+type+IV+secretion+system%5BTitle%5D)+AND+%22FEMS+Microbiol+Lett%22%5BJournal%5D)">F factor conjugation is a true type IV secretion system.</a> FEMS Microbiol Lett. 224 (1), 1-15 (2003).</li>
<li>Lederberg, J., Tatum, E. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+Recombination+in+Escherichia+Coli%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Gene Recombination in Escherichia Coli.</a> Nature. 158 (4016), 558-558 (1946).</li>
<li>Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mobility+of+Plasmids%5BTitle%5D)+AND+%22Microbiol+Mol+Biol+Rev%22%5BJournal%5D)">Mobility of Plasmids.</a> Microbiol Mol Biol Rev. 74 (3), 434-452 (2010).</li>
<li>Willetts, N., Skurray, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Conjugation+System+of+F-Like+Plasmids%5BTitle%5D)+AND+%22Annu+Rev+Genet%22%5BJournal%5D)">The Conjugation System of F-Like Plasmids.</a> Annu Rev Genet. 14 (1), 41-76 (1980).</li>
<li>Frost, L. S., Ippen-Ihler, K., Skurray, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+the+sequence+and+gene+products+of+the+transfer+region+of+the+F+sex+factor%5BTitle%5D)+AND+%22Microbiol+Rev%22%5BJournal%5D)">Analysis of the sequence and gene products of the transfer region of the F sex factor.</a> Microbiol Rev. 58 (2), 162-210 (1994).</li>
<li>Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Entry+exclusion+in+F-like+plasmids+requires+intact+TraG+in+the+donor+that+recognizes+its+cognate+TraS+in+the+recipient%5BTitle%5D)+AND+%22Microbiology%22%5BJournal%5D)">Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient.</a> Microbiology. 153, Pt 2 442-451 (2007).</li>
<li>Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Biogenesis%2C+Architecture%2C+and+Function+of+Bacterial+Type+Iv+Secretion+Systems%5BTitle%5D)+AND+%22Annu+Rev+Microbiol%22%5BJournal%5D)">Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems.</a> Annu Rev Microbiol. 59 (1), 451-485 (2005).</li>
<li>Christie, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Type+IV+secretion%3A+the+Agrobacterium+VirB%2FD4+and+related+conjugation+systems%5BTitle%5D)+AND+%22Biochim+Biophys+Acta+-+Mol+Cell+Res%22%5BJournal%5D)">Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems.</a> Biochim Biophys Acta - Mol Cell Res. 1694 (1-3), 219-234 (2004).</li>
<li>Bhatty, M., Laverde Gomez, J. a, Christie, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+expanding+bacterial+type+IV+secretion+lexicon%5BTitle%5D)+AND+%22Res+Microbiol%22%5BJournal%5D)">The expanding bacterial type IV secretion lexicon.</a> Res Microbiol. 164 (6), 620-639 (2013).</li>
<li>Christie, P. J., Cascales, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structural+and+dynamic+properties+of+bacterial+Type+IV+secretion+systems+%28Review%29%5BTitle%5D)+AND+%22Mol+Membr+Biol%22%5BJournal%5D)">Structural and dynamic properties of bacterial Type IV secretion systems (Review).</a> Mol Membr Biol. 22 (1-2), 51-61 (2005).</li>
<li>Christie, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Type+IV+secretion%3A+Intercellular+transfer+of+macromolecules+by+systems+ancestrally+related+to+conjugation+machines%5BTitle%5D)+AND+%22Mol+Microbiol%22%5BJournal%5D)">Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines.</a> Mol Microbiol. 40 (2), 294-305 (2001).</li>
<li>Christie, P. J., Whitaker, N., González-Rivera, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mechanism+and+structure+of+the+bacterial+type+IV+secretion+systems%5BTitle%5D)+AND+%22Biochim+Biophys+Acta%22%5BJournal%5D)">Mechanism and structure of the bacterial type IV secretion systems.</a> Biochim Biophys Acta. 1843 (8), 1578-1591 (2014).</li>
<li>Cascales, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+type+VI+secretion+toolkit%5BTitle%5D)+AND+%22EMBO+Rep%22%5BJournal%5D)">The type VI secretion toolkit.</a> EMBO Rep. 9, 735(2008).</li>
<li>Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure+and+Regulation+of+the+Type+VI+Secretion+System%5BTitle%5D)+AND+%22Annu+Rev+Microbiol%22%5BJournal%5D)">Structure and Regulation of the Type VI Secretion System.</a> Annu Rev Microbiol. 66 (1), 453-472 (2012).</li>
<li>Chandran, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure+of+the+outer+membrane+complex+of+a+type+IV+secretion+system%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Structure of the outer membrane complex of a type IV secretion system.</a> Nature. 462 (7276), 1011-1015 (2009).</li>
<li>Rivera-Calzada, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure+of+a+bacterial+type+IV+secretion+core+complex+at+subnanometre+resolution%5BTitle%5D)+AND+%22EMBO+J%22%5BJournal%5D)">Structure of a bacterial type IV secretion core complex at subnanometre resolution.</a> EMBO J. 32 (8), 1195-1204 (2013).</li>
<li>Waksman, G., Fronzes, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Molecular+architecture+of+bacterial+type+IV+secretion+systems%5BTitle%5D)+AND+%22Trends+Biochem+Sci%22%5BJournal%5D)">Molecular architecture of bacterial type IV secretion systems.</a> Trends Biochem Sci. 35, 691(2010).</li>
<li>Fronzes, R., Christie, P. J., Waksman, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+structural+biology+of+type+IV+secretion+systems%5BTitle%5D)+AND+%22Nat+Rev+Microbiol%22%5BJournal%5D)">The structural biology of type IV secretion systems.</a> Nat Rev Microbiol. 7 (10), 703-714 (2009).</li>
<li>Kaplan, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Probing+a+cell-embedded+megadalton+protein+complex+by+DNP-supported+solid-state+NMR%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR.</a> Nat Methods. 12 (7), 5-9 (2015).</li>
<li>Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+of+a+sex-factor-affinity+site+in+E.+coli+as+gamma+delta%5BTitle%5D)+AND+%22Cold+Spring+Harb+Symp+Quant+Biol%22%5BJournal%5D)">Identification of a sex-factor-affinity site in E. coli as gamma delta.</a> Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).</li>
<li>Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+the+pilus+in+recipient+cell+recognition+during+bacterial+conjugation+mediated+by+F-like+plasmids%5BTitle%5D)+AND+%22Mol+Microbiol%22%5BJournal%5D)">The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids.</a> Mol Microbiol. 13 (6), 939-953 (1994).</li>
<li>Jobling, M. G., Holmes, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Construction+of+vectors+with+the+pl5a+replicon%2C+kanamycin+resistance%2C+inducible+lacZ%CE%B1+and+pUC18+or+pUC19+multiple+cloning+sites%5BTitle%5D)+AND+%22Nucleic+Acids+Res%22%5BJournal%5D)">Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites.</a> Nucleic Acids Res. 18 (17), 5315(1990).</li>
<li>Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tight+regulation%2C+modulation%2C+and+high-level+expression+by+vectors+containing+the+arabinose+P%28BAD%29+promoter%5BTitle%5D)+AND+%22J+Bacteriol%22%5BJournal%5D)">Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter.</a> J Bacteriol. 177 (14), 4121-4130 (1995).</li>
<li>Yu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+efficient+recombination+system+for+chromosome+engineering+in+Escherichia+coli%5BTitle%5D)+AND+%22Proc+Natl+Acad+Sci+U+S+A%22%5BJournal%5D)">An efficient recombination system for chromosome engineering in Escherichia coli.</a> Proc Natl Acad Sci U S A. 97 (11), 5978-5983 (2009).</li>
<li>Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Functional+and+Mutational+Analysis+of+Conjugative+Transfer+Region+1+%28Tra1%29+from+the+IncHI1+Plasmid+R27%5BTitle%5D)+AND+%22J+Bacteriol%22%5BJournal%5D)">Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27.</a> J Bacteriol. 184 (8), 2173-2180 (2002).</li>
<li>Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((F-Like+Type+IV+Secretion+Systems+Encode+Proteins+with+Thioredoxin+Folds+That+Are+Putative+DsbC+Homologues%5BTitle%5D)+AND+%22J+Bacteriol%22%5BJournal%5D)">F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues.</a> J Bacteriol. 187 (24), 8267-8277 (2005).</li>
<li>Hazes, B., Frost, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Towards+a+systems+biology+approach+to+study+type+II%2FIV+secretion+systems%5BTitle%5D)+AND+%22Biochim+Biophys+Acta%22%5BJournal%5D)">Towards a systems biology approach to study type II/IV secretion systems.</a> Biochim Biophys Acta. 1778, 1839-1850 (2008).</li>
<li>Lento, C., Ferraro, M., Wilson, D., Audette, G. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((HDX-MS+and+deletion+analysis+of+the+type+4+secretion+system+protein+TraF+from+the+Escherichia+coli+F+plasmid%5BTitle%5D)+AND+%22FEBS+Lett%22%5BJournal%5D)">HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid.</a> FEBS Lett. Tsolis, R. 590 (3), 376-386 (2016).</li>
<li>Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA-binding+protein+nanotubes%3A+Learning+from+nature%27s+nanotech+examples%5BTitle%5D)+AND+%22Nano+Lett%22%5BJournal%5D)">DNA-binding protein nanotubes: Learning from nature's nanotech examples.</a> Nano Lett. 4, 1897-1902 (2004).</li>
<li>Harris, R. L., Silverman, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tra+proteins+characteristic+of+F-like+type+IV+secretion+systems+constitute+an+interaction+group+by+yeast+two-hybrid+analysis%5BTitle%5D)+AND+%22J+Bacteriol%22%5BJournal%5D)">Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis.</a> J Bacteriol. 186 (16), 5480-5485 (2004).</li>
<li>Moore, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+the+F-Plasmid+Conjugative+Transfer+Gene+traU%5BTitle%5D)+AND+%22J+Bacteriol%22%5BJournal%5D)">Characterization of the F-Plasmid Conjugative Transfer Gene traU.</a> J Bacteriol. 172 (8), 4263-4270 (1990).</li>
<li>Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+the+pilus+in+recipient+cell+recognition+during+bacterial+conjugation+mediated+by+F-like+plasmids%5BTitle%5D)+AND+%22Mol+Microbiol%22%5BJournal%5D)">The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids.</a> Mol Microbiol. 13 (6), 939-953 (1994).</li>
<li>Klimke, W. A., Frost, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genetic+analysis+of+the+role+of+the+transfer+gene%2C+traN%2C+of+the+F+and+R100-1+plasmids+in+mating+pair+stabilization+during+conjugation%5BTitle%5D)+AND+%22J+Bacteriol%22%5BJournal%5D)">Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation.</a> J Bacteriol. 180 (16), 4036-4043 (1998).</li>
<li>Jiang, W., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas%3A+New+Tools+for+Genetic+Manipulations+from+Bacterial+Immunity+Systems%5BTitle%5D)+AND+%22Annu+Rev+Microbiol%22%5BJournal%5D)">CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems.</a> Annu Rev Microbiol. 69 (1), 209-228 (2015).</li>
<li>Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Interspecies+bacterial+conjugation+by+plasmids+from+marine+environments+visualized+by+gfp+expression%5BTitle%5D)+AND+%22Mol+Biol+Evol%22%5BJournal%5D)">Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression.</a> Mol Biol Evol. 15 (4), 385-390 (1998).</li>
</ol>

Yazarlar hiçbir rakip mali çıkarları olduğunu beyan ederim.

Bakteriyel konjugasyon işlemi bakterileri gibi antibiyotik direnç belirteçlerin yayılması gibi zorlu ortamlarda büyümesi için evrimsel bir avantaj sağlayan genleri yayılabilir hangi bir araç sağlar. Konjugatif plazmid çok çok büyük olduğundan, konjugatif plazmid kendisini hedef genlerin mutasyon yoluyla transferi cihazının montajı katılan proteinler üzerinde 12 fonksiyonel çalışmalar hantal vardır. Bu tarifnamede ayrıntılı protokolleri, bir daha kolaylıkla daha küçük, daha idare edilebilir sentezleme plazmid (Şekil 1) kullanılarak ilgi konusu hedef genin değerlendirmek için kullanılabilecek bir yöntem sağlarlar. Biz F plazmid aracılı konjugasyon incelemek için F plazmid türevi pOX38-Tc (Tablo 1) istihdam; Diğer konjugatif plazmidler burada ayrıntılı protokoller ve uygun türev plazmidler kullanılarak incelenebilir. Özetlenen çiftleşme deneyleri bazı modifikasyonların ile Frost ve arkadaşları, 42 adapte edilmiştirons. Daha önce yapılan çalışmalarda, pOX38-Tc Δgene :: Cm yapının 8,33,42 oluşturulması, uygun kısıtlama enzimleri ile ilgili geni parçalanması ve pOX38-Tc amplifiye CAT kasetinin sokulmasıyla elde edilmiştir. Geçerli yöntemde 42, biz hedef genin nakavt ve CAT kaset ile değiştirmek için Recombineering E. coli DY330R 33,34 homolog rekombinasyon kullanır. F-T4SS pK184 gen kazanım plasmidi kullanılarak transfer kurtarma ile eş transfer ettiği üzerinden bu pOX38-Tc Δgene :: Cm gen spesifik nakavt için bir kontrol olarak hareket yapıyı taşıyan elde edilen DY330R suşu sağlayan bir avantajı vardır . Bir sebzelik-Cas9 metodolojisi, 43 kullanarak dolguyu oluşturmak mümkün olsa da biz bu imkanı araştırdı şu anda yok. Süreç (F türev plazmid pOX38-Tc bir gen nakavt nesil Figür başlıyore 1). Bu DY330R hücrelerinde homolog rekombinasyonla (Tablo 1) ile elde edilir, örneğin DY329, DY331 ve DY378 gibi benzer özelliklere sahip diğer suşları da kullanılabilir. Primerler, ilk pBAD33 plazmit 32 CAT kaseti yükseltmek ve hedef genin (Tablo 2) için spesifik olan bazlar sarkan içeren PCR için tasarlanmıştır; PCR ürünü daha sonra pOX38-Tc barındıran DY330R hücrelerine elektroporasyona edilir. Homolog rekombinasyon CAT kaset Cm direnç sağlarken etkili bir T4SS montaj ve konjugasyon kesintiye, hedef genin içinde çerçeve eklenir knock-out plazmid pOX38-Tc Δgene :: Cm üretir. Aynı zamanda, hedef gen pOX38-TC ile ilgili PCR yükseltilir ve küçük bir ifade plazması içine yerleştirilir; Bu protokolde, eğer arzu edilirse ancak bir hedef genin endüklenebilir ifadesi ile bir plasmid tercih olabilir, konstitütif ekspresyon için pK184 kullanımı. pK184-geni plazmidi daha sonra transforme edilirDY330R pOX38-Tc Δgene :: Cm hücrelerine, ve bu hücreler pOX38-Tc Δgene :: Cm birleşme analizleri için XK1200 hücrelerine konjugasyon yoluyla inşa aktarmak için verici olarak kullanılmaktadır. birleşme deneylerinde, verici ve alıcı hücreler, sırasıyla XK1200 pOX38-Tc Δgene :: Cm ve MC4100 vardır. PK184 gen kazanım plazmid, hem de hedef gen (silme ya da nokta mutasyonları) seri mutantlan, MC4100 alıcı hücrelere (Şekil 2 ile çiftleşme yükleme ve etkinliğini belirlemek için yeteneklerini değerlendirmek için donör hücre temin edilmektedir ; Tablo 3). Prosedüre kritik uygun verici ve alıcı suşları (Tablo 1) ve kullanılan primerlerin tasarımı kullanılmasıdır. tasarlanmış her astar için, takip edilmesi gereken genel kurallar vardır. biz kesinlikle% 40-60 GC içeriği ile uymak çalışırken, bu her zaman mümkün olmayabilir. Bu gibi durumlarda, ağ bir primer test deneycinin takdirine,biraz aşağıda veya bu aralığın üstünde i GC içeriği. İleri ve geri primer erime sıcaklığı (Tm) benzer olmalıdır ve tavlama sıcaklığı (T) değeri her zaman PCR için 2-5 ° C Tm daha düşük olması gerekir. Homo ve hetero dimerizasyon Tm &#39;nin çok düşük olması gerekir iken T a çok daha düşük olmalı geliştirmek için bir saç tokası izin için kullanılabilir serbest enerji, (az -10 kJ ve 30 ° C). Primerler, arzu edildiği gibi, silmeler, girmeler ya da nokta mutasyonları incelemek için dizayn edilebilir. Elde edilen gen yapısı amplifiye ve düzgün eksprese edilir ve böylece çerçeve geri plasmid lige edilmesi elbette önemlidir. yetkin hücrelerin dönüştürülmesi, sırasıyla, elektro-kimyasal olarak, yetkili hücreler kullanılarak elektroporasyon veya ısı şoku ile yapılabilir. Bu elektroporasyon gibi pOX38-Tc ve homolog rekombinasyon oligonucle gibi daha büyük yapıları için daha etkili bulmakotide, örneğin pK184-TRAF gibi küçük sentezleme plasmidleri kolaylıkla ısı şoku yöntemlerle hücrelere transforme edilebilir ise. Son olarak, hem donör ve alıcı suşları konjugatif ve kurtarma plazmidler üzerinde çalışan olanlardan farklı farklı dirençleri gerektiren, protokol boyunca kullanımında birden fazla antibiyotik olacağını hatırlamak önemlidir. Kenara Burada anlatılan çiftleşme deneyleri teknikleri, kendi yaklaşım biraz farklı bakteri konjugasyon incelemek için kullanılan başka yöntemler vardır. Yatay gen transferi bakteri türler arası alıcıları dahil olmak üzere bir alıcı hücreye, bir plasmid transferi bir süreçtir. 44 türler arası yatay gen transferi boyutunu belirlemek için bakteri konjugasyon kullanılan Dahlberg ve örneğin arkadaşları 44 tarafından yapılan bir çalışma. Bunlar KT2442 hücrelere klonlanmış bir plazmide yeşil flüoresan protein (GFP) dahil edilmesini kullanılmaktadır; kromozomal lKT2442 hücrelerinde AC q geni GFP ifade bastırmak. Plazmid taşıyan GFP lac q geni olmayan bir türe aktarıldığında, floresan gözlemlenmiştir. Çeşitli türlerde protein belirli bir işlevi sunmak için sınırlama rağmen 44, türler arası konjugasyon deneyi muhtemelen farklı türler arasında protein-protein etkileşimleri için evrimsel tahminler yapmak için burada sunulan protokoller ile birleştiğinde olabilir.

Mikro-organizma düzeyinde genler ve proteinlerin transferi bakteriyel hayatta kalma ve evrim yanı sıra enfeksiyon süreçlerinde önemli bir rol oynar. bakteriler arasında ya da bir bakteri, bir hücre arasındaki DNA değişimi dönüşümü, konjugasyon veya vektör iletimi yoluyla elde edilebilir. 1,2 Konjugasyon Escherichia coli gibi gram negatif bakteriler arasında konjugasyon sırasında dönüşüm ve transdüksiyon kıyasla benzersizdir, DNA transferi kompleks makromoleküler sistemi, verici ve alıcı hücrelerin birbirine bağlayan ve böylece bir verici-kontrollü bir şekilde meydana gelir. Konjugasyon ayrıca bakteri hücrelerinin ana bilgisayar sistemleri için genler, proteinler veya kimyasal enjekte konak hücreleri ile etkileşim içinde en doğrudan yoludur. 3 Oldukça sık, bu tür maddelerin transferi evrimini ve adaptasyon barındırmak için patogenez ve karsinogenez arasında değişen ana bilgisayarda olağanüstü etkileri vardır. O konjugatif recombinatio gösterilmiştirn çevresel stres koşullarında yüksek mutasyon oranları ile bakterilerde adaptasyon 3 kat oranını artırır. 4 Dahası, konjugasyon bakteri türleri antibiyotik direnç genleri yayılır, üzerinden kadar en yaygın yol kullanılarak verilir. 5,6 Mikroorganizmalar hücre zarları arasında makromoleküllerin transferini desteklemek için özel salgı sistemlerinin geliştiğini; tarif edilmiştir de gram negatif bakterilere salgılama sistemleri (TSSler) 9 tip şu anda: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, hem de SEC (sekresyon) ve Tat (iki arginin translokasyon) yollar. Salgı sistemi 7,8 Her tür daha farklı bakteri suşları nedeniyle protein çeşitliliği ve ilgili yolların ayırt edicilik için, farklı alt tipe bir zorunluluk ayrılmıştır. Örneğin, tip IV sekresyon sistemi (T4SS) &#39;de, Ti ve Çağ sistemleri F-plazmid ise efektör taşımacılığının kolaylaştırılması, R27 and pKM101 T4SSs bir konjugatif plazmid transferini kolaylaştırmak. Organizmaların bir alıcı ya da çevresindeki çevre ile hücresel içeriği kendi bileşen proteinlerden kendi salgı sistemlerini monte ve paylaşmak hangi mekanizmaların 7,9,10 ayrıntılı bir anlayış patojen mikroorganizmaları ve süreçlerini mücadele etmek için hedeflenen stratejilerin geliştirilmesinde önemli bir faktördür hücresel enfeksiyon. Lederberg ve Tatum, 11 E. coli içinde, ilk kimlik bakteriyel konjugasyon aşağıdaki mobil ve birleştirici plazmit, çok sayıda belirlenmiş ve karakterize edilmiştir. 12 Bu tür mobil plazmidler ancak tüm mobil plazmidler transferi (oriT) böylece plazmid aktarımını sağlayan kökenini tanıyan bir relaxase içeren, kayda değer aralığı (1 200&#39;den fazla kilobaz (kb) için) boyutu olduğunu gösteriyor. Konjügatif fonksiyonel T4SS montajı için plazmidler daha kodlayan genler aynı zamanda bir türIV birleştirme proteini. 12 Örneğin, E. coli 100 kb F plazmid bir 33.3 kB transferi (tra) bölgedeki tüm konjugatif genleri kodlar. 13 çifti oluşumu (Mpf), DNA transferi ve dışlama fonksiyonlarını çiftleşme pilus oluşumunu kolaylaştırmak tüm proteinler, konjugatif plazmid transferi sırasında F plazmid kodlamak tra bölgesinde genler. 10,14,15 bilginin önemli bir vücut konjugatif T4SSs için kullanılabilir, ancak sadece son zamanlarda kullanılabilir hale gelmektedir konjugatif protein ve komplekslerinin yapısal çalışmalar detaylı. 16-28 konjugatif işlem kapsamlı bir görünümünü monte etmek için, eş transfer proteinlerinin analiz mutasyon için, ayrıntılı yapısal çalışmaların bir bağlantı gereklidir. Bu konjugatif çiftleşme deneyleri ile elde edilebilir. F plazmid için tra bölge içinde kodlanan her protein F aracılı co bir rol oynarnjugation; Bu nedenle, bir transfer geninin nakavt / silme hücre (Şekil 1) konjugatif kapasitesini ortadan kaldıracaktır. küçük mobil plazmidler, F gibi daha büyük konjugatif plasmidler için, standart silme işlemleri için elverişli iken hedef gen, bir farklı antibiyotik dirençli bir gen taşıyıcı ile değiştirilmiş olduğu, bir gen nakavt daha kolay homolog rekombinasyon yoluyla elde edilir. Geçerli protokol, 55 kb F plazmid türevi pOX38-Tc kloramfenikol asetiltransferaz (CAT) ile ilgi bir transfer geni yerine homolog rekombinasyon istihdam; 29,30 Elde edilen nakavt plasmid pOX38-Tc Δgene :: Cm büyüme ortamında kloramfenikol varlığında (cm) karşı direnç kolaylaştırır. pOX38-Tc Δgene :: Cm barındıran donör hücreleri bir çiftleşme testinin kullanımı yoluyla gözlemlenen konjugatif DNA transferi / çiftleşme etkileyecek edemiyoruz; Bir pOX38-Tc Δgene :: Cm donör hücre çiftleşme verimliliği ve normal bir tilki kuyruğusağ- lasa daha sık, kaldırılmasını, azaltmak veya edecektir. pOX38-Tc Δgene :: Cm plazmid konjugatif transferi hedeflenen transferi genini barındıran küçük bir iyileşme plazmid aracılığıyla restore edilebilir. Bu kurtarma plazmid gibi plazmid pK184 (pK184-gen), 31 ya da çok uzun plazmid düzgün hücre (sitoplazma veya periplasmasında) içinde doğru konuma geni hedef olarak uyarılabilir ifade sağlayan biri olarak, kurucu ifade sağlar biri olabilir. Sonuç olarak, bu yeni verici arasındaki birleşme deneylerinde (pOX38-Tc Δgene :: Cm + pK184-geni plazmidler) ve bir alıcı hücre, çiftleşme verimi neredeyse o normal bir alıcı ve verici arasındaki çiftleşme testinin geri yüklemek için bekleniyor. Bu sistem, pK184-gen yapılarına (silme ya da nokta mutasyon) bir dizi nesil boyunca elendikçe genin işlevini prob ve pOX38-Tc Δgene :: Cm barındıran birleşme kapasitesini yeniden kazandırmak için, her yapı yeteneğini test edilmesine imkan verici hücres.

<table><tbody><tr><td>GeneJet Plasmid Mini-Prep Kit</td><td>Fisher Scientific</td><td>K0503</td><td></td></tr><tr><td>GeneJet Gel Extraction Kit</td><td>Fisher Scientific</td><td>K0692</td><td></td></tr><tr><td>GeneJet PCR Purification Kit</td><td>Fisher Scientific</td><td>K0702</td><td></td></tr><tr><td>Q5 Site-Directed Mutagenesis Kit</td><td>New England Biolabs</td><td>E0554S</td><td></td></tr><tr><td>Broad Range DNA Ladder</td><td>New England Biolabs</td><td>N0303A</td><td></td></tr><tr><td>Petri Dishes</td><td>Fisher Scientific</td><td>FB0875713</td><td></td></tr><tr><td>Electroporator</td><td>Eppendorf</td><td>4309000027</td><td></td></tr><tr><td>Electroporation cuvettes</td><td>Fisher Scientific</td><td>FB101</td><td>Cuvettes have a 1 mm gap.</td></tr><tr><td>&lt;strong&gt;Enzymes&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>AvaI</td><td>New England Biolabs</td><td>R0152S</td><td></td></tr><tr><td>EcoRI</td><td>New England Biolabs</td><td>R0101S</td><td></td></tr><tr><td>HindIII</td><td>New England Biolabs</td><td>R0104L</td><td></td></tr><tr><td>NdeI</td><td>New England Biolabs</td><td>R0111S</td><td></td></tr><tr><td>Phusion DNA Polymerase</td><td>New England Biolabs</td><td>M0530L</td><td></td></tr><tr><td>T4 DNA Ligase</td><td>New England Biolabs</td><td>M0202S</td><td></td></tr><tr><td>DpnI</td><td>New England Biolabs</td><td>R0176S</td><td></td></tr><tr><td>&lt;strong&gt;Antibiotics&lt;/strong&gt;</td><td></td><td></td><td>&lt;strong&gt;Final Concentrations&lt;/strong&gt;</td></tr><tr><td>Chloramphenicol (Cm)</td><td>Fisher Scientific</td><td>BP904-100</td><td>20 &amp;micro;g/mL</td></tr><tr><td>Kanamycin (Km)</td><td>BioBasic Inc.</td><td>DB0286</td><td>50 &amp;micro;g/mL</td></tr><tr><td>Nalidixic acid (Nal)</td><td>Sigma-Aldrich</td><td>N8878-25G</td><td>10 &amp;micro;g/mL</td></tr><tr><td>Rifampicin (Rif)</td><td>Calbiochem</td><td>557303</td><td>20 &amp;micro;g/mL</td></tr><tr><td>Tetracycline (Tc)</td><td>Fisher Scientific</td><td>BP912-100</td><td>10 &amp;micro;g/mL</td></tr><tr><td>Streptomycin (Sm)</td><td>Fisher Scientific</td><td>BP910-50</td><td>50 &amp;micro;g/mL</td></tr></tbody></table>

conjugative mating assays for sequence-specific analysis of transfer proteins involved in bacterial conjugation

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia coli, these transfer proteins make up a DNA transfer machinery known as the mating pair formation, or DNA transfer complex, which facilitates conjugative plasmid transfer. The objective of this paper is to provide a method that can be used to determine the role of a specific transfer protein that is involved in conjugation using a series of deletions and/or point mutations in combination with mating assays. The target gene is knocked out on the conjugative plasmid and is then provided in trans through the use of a small recovery plasmid harboring the target gene. Mutations affecting the target gene on the recovery plasmid can reveal information about functional aspects of the target protein that result in the alteration of mating efficiency of donor cells harboring the mutated gene. Alterations in mating efficiency provide insight into the role and importance of the particular transfer protein, or a region therein, in facilitating conjugative DNA transfer. Coupling this mating assay with detailed three-dimensional structural studies will provide a comprehensive understanding of the function of the conjugative transfer protein as well as provide a means for identifying and characterizing regions of protein-protein interaction.

F plazmid odaklı bakteriyel konjugasyon bir işlem pilus sentezi ve karşılıklı DNA transferi kolaylaştırmak için bir T4SS araya F-plazmidinin tra bölgesi içinde transfer proteinleri içeren koordineli bir süreçtir. Protein TRAF (GenBank erişim # BAA97961, UniProt İD P14497) konjugatif F pilus oluşumu için gereklidir. 10,14,35 - katalitik CXXC motifi olmayan da 37 proteini, bir C-terminali tioredoksin-benzeri domain içerir. Bu N-terminal alanı ile Trah proteini ile etkileşime tahmin edilmiş olmasına rağmen 35,38, 39 bir bölge çok başka 37 proteinin yapısal özellikleri hakkında bilinen, C-terminal alanı daha dinamik olduğu gösterilmiştir. Yapısal çalışmalar ile birlikte TRAF proteinin fonksiyonel yönlerini değerlendirmek için, öncelikle homolog yoluyla pOX38-Tc üzerinde TRAF genini nakavtrekombinasyon, E coli DY330R hücrelerinde pOX38-Tc ΔtraF :: Cm plazmid (Tablo 1) üretilmesi. Ayrıca üretilen 33,34 konjugasyon kurtarma sağlamak ve protein dizisi sondalama etkinleştirmek için TRAF -özel primerleri (Tablo 2) den pK184-TRAF plazmid oldu. PK184-TRAF trans sağlandı XK1200 hücre DY330R hücrelerinden 40 içine pOX38-Tc ΔtraF :: Cm plazmid transferi gösterir (Transkonjuganlardaki, 10 ug / ml Tc ve 20 ug / ml Cm 10 ug / ml Nal üzerinde büyümüş) pOx38-Tc ΔtraF :: cm o (a) TRAF nakavt bir çerçeve CAT kaseti sağlar ve (b) pK184-TRAF konjugatif işlevini geri yükleyebilirsiniz. TRAF mutantlarının bir dizi XK1200 pOX38-Tc ΔtraF :: Cm + pK184-TRAF Ax ile eşli birleşme deneyi 37 kullanılarak analiz oluşturulanHücreler ve sırasıyla donör ve alıcı olarak 41 MC4100 hücreleri. Bir Örnek mutant TRAF 55-247 (Tablo 1), protein bölgesi Trah etkileşim tahmin kaldıran, bir N-terminal çıkarılması işlemi, mutantıdır. Tam uzunluktaki TRAF proteini donör hücrelerine verildiğinde boş plazmid pK184 sağlayan (Tablo 3) değil ise, eş transfer, (Şekil 2) geri döner. Plazmid pK184-TRAF 55-247 (Tablo 3) ile donatılmış Benzer şekilde, XK1200 donör hücreleri eşli fonksiyonu geri değildir. Bu proteinin kesik bölgesi muhtemelen Trah ile etkileşim yoluyla, konjugasyondan cihaz içinde TRAF fonksiyonu için önemli olduğunu gösterir ve ayrıca mutasyon analizi için hedef proteinin bir bölgesini içerir. <img alt="Şekil 1" src="/files/ftp_upload/54854/54854fig1.jpg" /> <strong&gt; Şekil 1: konjugatif çiftleşme testinin şematik gösterimi. 1. Adımda, hedef genler PCR, hedef gen için homolog çıkıntılar CAT kaseti oluşturulur kullanılarak DY330R hücreleri, etkili bir rekombinasyon suşunda homolog rekombinasyon ile elendikçe. Elde edilen DY330R klon nakavt gen kurtarma plazmid (pK184-gen) üzerinden trans sağlanmadıkça konjugasyon kolaylaştırmak için değiştiremiyor plazmid pOX38-Tc Δgene :: Cm, barındırır. Elde edilen pOX38-Tc Δgene :: Cm plazmid MC4100 alıcı (Kademe 3) ile birleşme deneyleri kullanılarak genin ileri değerlendirme için XK1200 suşu (Aşama 2) aktarılır. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54854/54854fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/54854/54854fig2.jpg" /> Şekil 2: Mattahlil ing konjugasyon hedef genin fonksiyonunu değerlendirmek için. Verici ve alıcı hücreler E. coli XK1200 pOX38-Tc ΔtraF :: Cm sırasıyla pK184-TRAF ve MC4100 ile dönüştürülmüştür. Ortaya çıkan transkonjuganların (MC4100 pOX38-Tc ΔtraF :: Cm) konjugatif fonksiyonun başarılı kurtarma belirten Sm ve Cm içeren plakalar üzerinde büyür. Deney, tek bir agar plakası üzerinde iki kez yapılır ve seri seyreltileri için onar gen mutantlan (Tablo 2) birleşme etkinliğinin hesaplanması kullanılmıştır. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54854/54854fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bakteriyel suş / Plazmid </td><td> ilgili Özellikler </td><td> Seçici Marker (ler) † </strong&gt; </td><td> Referans </td></tr><tr><td> Bakteriyel Suşlar </td><td></td><td></td><td></td></tr><tr><td> DY330R </td><td> W3110, ΔlacU169 gal490 λc1857 Δ (cro-bioA) Rif R </td><td> Rif </td><td> 33,34 </td></tr><tr><td> XK1200 </td><td> F - lacΔU124 Δ (bio gyrA attλ ADA AROG gal) </td><td> Nal </td><td> 40 </td></tr><tr><td> MC4100 </td><td> araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR </td><td> Sm </td><td> 41 </td></tr><tr><td> Vektörler ve Yapılar </td><td></td><td></td><td></td></tr><tr><td> pBAD33 </td><td> P ArabAd: altında İfade için plazmid, </td><td> Santimetre </td><td> 32 </td></tr><tr><td> pK184 </td><td> Vektör, p15a replikon klonlama 2.4 kb </td><td> km </td><td> 31 </td></tr><tr><td> pK184-TRAF ‡ &lt;/ Td&gt; <td> pK184 içinde pOX38 F TRAF </td><td> km </td><td> 35 </td></tr><tr><td> pK184-TRAF 56-247 </td><td> pK184-TRAF F TRAF aa 56-247 </td><td> km </td><td></td></tr><tr><td> konjugatif Plazmidler </td><td></td><td></td><td></td></tr><tr><td> pOX38-Tc </td><td> IncFI Tra + RepFIA + F, mini Tn F1 HindIII fragmanı </td><td> Tc </td><td> 29,30 </td></tr><tr><td> pOX38-Tc ΔtraF :: Cm </td><td> CAT ile pOX38-Tc traf takılı </td><td> tc Cm </td><td> 35 </td></tr><tr><td colspan="4"> † Cm, kloramfenikol; Km, kanamisin; Nal, nalidiksik asit; Rif, rifampisin; Sm, streptomisin; Tc, tetrasiklin </td></tr><tr><td colspan="4"> ‡ Tüm TRAF konstruktları periplazmik boşluğuna lokalizasyon sağlamak için 19-Tortu, lider dizisini ihtiva etmektedir. </td></tr></tbody></table> Tablo 1: <stRong&gt; E. E. coli suşu ve plazmidler bu çalışmada kullanılan. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> inşa etmek </td><td> astar * </td></tr><tr><td> TRAF-Cm-For </td><td> 5&#39;-GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC 3 &#39; </td></tr><tr><td> TRAF-CM-Rev </td><td> 5&#39;-TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG 3 &#39; </td></tr><tr><td> pK184-TRAF-For </td><td> 5&#39;-TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC 3 &#39; </td></tr><tr><td> pK184-TRAF-Rev </td><td> 5&#39;-TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA 3 &#39; </td></tr><tr><td> pK184-TRAF 55-247 -Için </td><td> 5&#39;-TACG CATATG ATGGCCGCACTGCAGACGG 3 &#39; </td></tr><tr><td> pK184-TRAF 55-247 </sub&gt; -Rev </td><td> 5&#39;-TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA 3 &#39; </td></tr><tr><td colspan="2"> † Lento ark uyarlanmıştır Tablo. Izni ile 2016 35 </td></tr><tr><td colspan="2"> * TRAF sarkan bölgeleri italik edilir. (: AAGCTT, EcoRI: GAATTC Ndel: CATATG Hindlll) restriksiyon enzim yerlerinin altları çizilmiştir </td></tr></tbody></table> Tablo 2: Bu çalışmada kullanılan primerler listesi. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Verici plazmit † </td><td> Kurtarma Plazmid </td><td> Transkonjuganlardaki ‡ § (hücre ml-1) </td><td> Çiftleşme Efficiency§ || </td></tr><tr><td> pOX38-Tc ΔtraF :: Cm </td><td> Yok </td><td> 0 </td><td> 0 </td></tr><tr><td> pOX38-Tc ΔtraF :: Cm </td><td> pK184 </td><td> 0 </td><td> 0 </td></tr><tr><td> pOX38-Tc ΔtraF :: Cm </td><td> pK184-TRAF </td><td> 5 x 10 3 </td><td> 0,0167 </td></tr><tr><td> pOX38-Tc ΔtraF :: Cm </td><td> pK184-TRAF 55-247 </td><td> 0 </td><td> 0 </td></tr><tr><td colspan="4"> * Lento ve ark adapte Tablo. Izni ile 2016 35 </td></tr><tr><td colspan="4"> † Donör hücreleri, E. coli XK1200 3 x 10 7 hücre mL bir ortalama konsantrasyonu ile, idi -1 </td></tr><tr><td colspan="4"> ‡ alıcı hücreler E. coli MC4100 edildi. Pozitif kontrol için transkonjugamn sayısı 10-5 seyreltme arasındadır. 0 10-2 seyreltme hiçbir Transkonjuganlardaki gösterir. </td></tr><tr><td colspan="4"> iki ila dört eş deneylerin §An ortalaması, her bir yapı için gerçekleştirilmiştir. </td></tr><tr><td colspan="4"> || Mating verimi defin olan100 donör hücre başına Transkonjuganlardaki Ed. 0 çiftleşme verimliliği 10-2 seyreltme hiçbir transkonjugamn gösterir </td></tr></tbody></table> Tablo 3: TRAF silme yapıları tarafından Mülga çiftleşme verimlilik.

Watch this Scientific Journal Video about Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation at JoVE.com

Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations.

Bakteriyel Konjugasyon ilgilendim Transferi Proteinlerin Dizi özgü Analiz konjugatif Çiftleşme Tahliller

The transfer of genetic material by bacterial conjugation is a process that takes place via complexes formed by specific transfer proteins. In Escherichia ...

conjugative-mating-assays-for-sequence-specific-analysis-transfer

Nanyang Technological University

Research

JoVE Journal

Genetics

13.8K Görüntüleme.  York University. Here, we present a protocol to knockout a gene of interest involved in plasmid conjugation and subsequently analyze the impact of its absence using mating assays. The function of the gene is further explored to a specific region of its sequence using deletion or point mutations. 

Video: Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation

Site-specific Bacterial Chromosome Engineering: &#934;C31 Integrase Mediated Cassette Exchange (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as plasmid replication, plasmid stability, plasmid incompatibility, and plasmid copy number variance. This method uses the site-specific integrase from the Streptomyces phage (&Phi;) C312,3. The &Phi;C31 integrase catalyzes a direct recombination between two specific DNA sites: attB and attP (34 and 39 bp, respectively)4. This recombination is stable and does not revert5. A "landing pad" (LP) sequence consisting of a spectinomycin- resistance gene, aadA (SpR), and the E. coli &szlig;-glucuronidase gene (uidA) flanked by attP sites has been integrated into the chromosomes of Sinorhizobium meliloti, Ochrobactrum anthropi, and Agrobacterium tumefaciens in an intergenic region, the ampC locus, and the tetA locus, respectively. S. meliloti is used in this protocol. Mobilizable donor vectors containing attB sites flanking a stuffer red fluorescent protein (rfp) gene and an antibiotic resistance gene have also been constructed. In this example the gentamicin resistant plasmid pJH110 is used. The rfp gene6 may be replaced with a desired construct using SphI and PstI. Alternatively a synthetic construct flanked by attB sites may be sub-cloned into a mobilizable vector such as pK19mob7. The expression of the &Phi;C31 integrase gene (cloned from pHS628) is driven by the lac promoter, on a mobilizable broad host range plasmid pRK78139.
A tetraparental mating protocol is used to transfer the donor cassette into the LP strain thereby replacing the markers in the LP sequence with the donor cassette. These cells are trans-integrants. Trans-integrants are formed with a typical efficiency of 0.5%. Trans-integrants are typically found within the first 500-1,000 colonies screened by antibiotic sensitivity or blue-white screening using 5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid (X-gluc). This protocol contains the mating and selection procedures for creating and isolating trans-integrants.

A quick and efficient method to integrate foreign DNA of interest into pre-made acceptor strains, termed landing pad strains, is described. The method allows site-specific integration of a DNA cassette into the engineered landing pad locus of a given strain, through conjugation and expression of the &#934;C31 integrase.

Siteye özgü Bakteriyel Kromozom Mühendislik: ΦC31 integraz Aracılı Kaset Borsası (IMCE)

The bacterial chromosome may be used to stably maintain foreign DNA in the mega-base range1. Integration into the chromosome circumvents issues such as ...

Biyomühendislik

High-Resolution Comparison of Bacterial Conjugation Frequencies

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons of conjugation frequency under different conditions are required to understand how the conjugative element spreads in nature. However, conventional methods for comparing conjugation frequency are not appropriate for in-depth comparisons because of the high background caused by the occurrence of additional conjugation events on the selective plate. We successfully reduced the background by introducing a most probable number (MPN) method and a higher concentration of antibiotics to prevent further conjugation in selective liquid medium. In addition, we developed a protocol for estimating the probability of how often donor cells initiate conjugation by sorting single donor cells into recipient pools by fluorescence-activated cell sorting (FACS). Using two plasmids, pBP136 and pCAR1, the differences in conjugation frequency in Pseudomonas putida cells could be detected in liquid medium at different stirring rates. The frequencies of conjugation initiation were higher for pBP136 than for pCAR1. Using these results, we can better understand the conjugation features in these two plasmids.

With an aim to understand the behaviors of various bacterial conjugative DNA elements under different conditions, we describe a protocol for detecting differences in conjugation frequency, with high resolution, to estimate how efficiently the donor bacterium initiates conjugation.

Bakteriyel konjugasyon frekans yüksek çözünürlüklü karşılaştırma

Bacterial conjugation is an important step in the horizontal transfer of antibiotic resistance genes via a conjugative DNA element. In-depth comparisons ...

Genetik

An Assay for Quantifying Protein-RNA Binding in Bacteria

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding of an RNA binding protein (RBP) to the initiation region of the mRNA, which interferes with ribosome binding. In the presented method, we utilize this blocking phenomenon to quantify the binding affinity of RBPs to their cognate and non-cognate binding sites. To do this, we insert a test binding site in the initiation region of a reporter mRNA and induce the expression of the test RBP. In the case of RBP-RNA binding, we observed a sigmoidal repression of the reporter expression as a function of RBP concentration. In the case of no-affinity or very low affinity between binding site and RBP, no significant repression was observed. The method is carried out in live bacterial cells, and does not require expensive or sophisticated machinery. It is useful for quantifying and comparing between the binding affinities of different RBPs that are functional in bacteria to a set of designed binding sites. This method may be inappropriate for binding sites with high structural complexity. This is due to the possibility of repression of ribosomal initiation by complex mRNA structure in the absence of RBP, which would result in lower basal reporter gene expression, and thus less-observable reporter repression upon RBP binding.

In this method, we quantify the binding affinity of RNA binding proteins (RBPs) to cognate and non-cognate binding sites using a simple, live, reporter assay in bacterial cells. The assay is based on repression of a reporter gene.

Bakterilerde protein RNA bağlayıcı ölçümü için bir tahlil

In the initiation step of protein translation, the ribosome binds to the initiation region of the mRNA. Translation initiation can be blocked by binding ...

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Staphylococcal Cassette Chromosome mec (SCCmec) typing is a very important molecular tool for understanding the epidemiology and clonal strain relatedness of methicillin-resistant Staphylococcus aureus (MRSA), particularly with the emerging outbreaks of community-associated MRSA (CA-MRSA) occurring on a worldwide basis. Traditional PCR typing schemes classify SCCmec by targeting and identifying the individual mec and ccr gene complex types, but require the use of many primer sets and multiple individual PCR experiments. We designed and published a simple multiplex PCR assay for quick-screening of major SCCmec types and subtypes I to V, and later updated it as new sequence information became available. This simple assay targets individual SCCmec types in a single reaction, is easy to interpret and has been extensively used worldwide. However, due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. To facilitate the process of establishing a MRSA SCCmec assay, here we demonstrate how to set up our multiplex PCR assay, and discuss some of the vital steps and procedural nuances that make it successful.

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Metisiline diren

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

İmmünoloji ve Enfeksiyon

Detection of Horizontal Gene Transfer Mediated by Natural Conjugative Plasmids in E. coli

Conjugation represents one of the main mechanisms facilitating horizontal gene transfer in Gram-negative bacteria. This work describes methods for the study of the mobilization of naturally occurring conjugative plasmids, using two naturally-occurring plasmids as an example. These protocols rely on the differential presence of selectable markers in donor, recipient, and conjugative plasmid. Specifically, the methods described include 1) the identification of natural conjugative plasmids, 2) the quantification of conjugation rates in solid culture, and 3) the diagnostic detection of the antibiotic resistance genes and plasmid replicon types in transconjugant recipients by polymerase chain reaction (PCR). The protocols described here have been developed in the context of studying the evolutionary ecology of horizontal gene transfer, to screen for the presence of conjugative plasmids carrying antibiotic-resistance genes in bacteria found in the environment. The efficient transfer of conjugative plasmids observed in these experiments in culture highlights the biological relevance of conjugation as a mechanism promoting horizontal gene transfer in general and the spread of antibiotic resistance in particular.

Detection of Horizontal Gene Transfer Mediated by Natural Conjugative Plasmids in E. coli

Conjugation mediates horizontal gene transfer by mobilizing plasmid DNA across two different cells, facilitating the spread of beneficial genes. This work describes a widely-used method for the efficient detection of conjugative plasmid transfer, based on the use of differential markers in the conjugative plasmid, donor, and recipient to detect transconjugation.

E. coli'de Doğal Konjugatif Plazmidlerin Aracılık Ettiği Yatay Gen Transferinin Saptanması

Conjugation represents one of the main mechanisms facilitating horizontal gene transfer in Gram-negative bacteria. This work describes methods for the ...

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to antibiotics. Genomic studies reveal that S. aureus carries many virulence and resistance genes located in mobile genetic elements, suggesting that horizontal gene transfer (HGT) plays a critical role in S. aureus evolution. However, a full and detailed description of the methodology used to study HGT in S. aureus is still lacking, especially regarding natural transformation, which has been recently reported in this bacterium. This work describes three protocols that are useful for the in vitro investigation of HGT in S. aureus: conjugation, phage transduction, and natural transformation. To this aim, the cfr gene (chloramphenicol/florfenicol resistance), which confers the Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A (PhLOPSA)-resistance phenotype, was used. Understanding the mechanisms through which S. aureus transfers genetic materials to other strains is essential to comprehending the rapid acquisition of resistance and helps to clarify the modes of dissemination reported in surveillance programs or to further predict the spreading mode in the future.

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

We describe here three different protocols for the in vitro investigation of conjugation, transduction, and natural transformation in Staphylococcus aureus.

Yatay Gen Transferi Çalışmasında Metodolojisi<em&gt; Staphylococcus aureus</em

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Presented here is a simple method for creating a high-density transposon insertion library in Escherichia coli or Shigella flexneri using bacterial conjugation. This protocol allows the creation of a collection of hundreds of thousands of unique mutants in bacteria by the random genomic insertion of a transposon.

Bir yoğun Transposon ekleme kütüphane kullanarak bakteriyel konjugasyon Escherichia Coli Enterobacterial suşları gibi veya Shigella flexneri oluşturulması

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit

Cyanobacteria are a diverse group of prokaryotic photosynthetic organisms that can be genetically modified for the renewable production of useful industrial commodities. Recent advances in synthetic biology have led to development of several cloning toolkits such as CyanoGate, a standardized modular cloning system for building plasmid vectors for subsequent transformation or conjugal transfer into cyanobacteria. Here we outline a detailed method for assembling a self-replicating vector (e.g., carrying a fluorescent marker expression cassette) and conjugal transfer of the vector into the cyanobacterial strains Synechocystis sp. PCC 6803 or Synechococcus elongatus UTEX 2973. In addition, we outline how to characterize the performance of a genetic part (e.g., a promoter) using a plate reader or flow cytometry.

Here, we present a protocol describing how to i) assemble a self-replicating vector using the CyanoGate modular cloning toolkit, ii) introduce the vector into a cyanobacterial host by conjugation, and iii) characterize transgenic cyanobacteria strains using a plate reader or flow cytometry.

CyanoGate Modüler Klonlama Araç Kiti Kullanılarak Konjugasyon ile Siyanobakterilerin Genetik Modifikasyonu

Cyanobacteria are a diverse group of prokaryotic photosynthetic organisms that can be genetically modified for the renewable production of useful ...

Biyoloji

Generating Transposon Insertion Libraries in Gram-Negative Bacteria for High-Throughput Sequencing

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways that contribute to bacterial fitness under a wide range of environmental conditions. Tn-seq applications are extensive and have not only enabled examination of genotype-phenotype relationships at an organism level but also at the population, community and systems levels. Gram-negative bacteria are highly associated with antimicrobial resistance phenotypes, which has increased incidents of antibiotic treatment failure. Antimicrobial resistance is defined as bacterial growth in the presence of otherwise lethal antibiotics. The &#8220;last-line&#8221; antimicrobial colistin is used to treat Gram-negative bacterial infections. However, several Gram-negative pathogens, including Acinetobacter baumannii can develop colistin resistance through a range of molecular mechanisms, some of which were characterized using Tn-seq. Furthermore, signal transduction pathways that regulate colistin resistance vary within Gram-negative bacteria. Here we propose an efficient method of transposon mutagenesis in A. baumannii that streamlines generation of a saturating transposon insertion library and amplicon library construction by eliminating the need for restriction enzymes, adapter ligation, and gel purification. The methods described herein will enable in-depth analysis of molecular determinants that contribute to A. baumannii fitness when challenged with colistin. The protocol is also applicable to other Gram-negative ESKAPE pathogens, which are primarily associated with drug resistant hospital-acquired infections.

We describe a method to generate saturating transposon mutant libraries in Gram-negative bacteria and subsequent preparation of DNA amplicon libraries for high-throughput sequencing. As an example, we focus on the ESKAPE pathogen, Acinetobacter baumannii, but this protocol is amenable to a wide range of Gram-negative organisms.

Yüksek İşlem Likör Sıralaması Için Gram-Negatif Bakterilerde Transposon Ekleme Kitaplıkları Oluşturma

Transposon sequencing (Tn-seq) is a powerful method that combines transposon mutagenesis and massive parallel sequencing to identify genes and pathways ...

Conjugation: A Method to Transfer Ampicillin Resistance from Donor to Recipient E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1 
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases Laboratories, Boston, MA
First discovered by Lederberg and Tatum in 1946, conjugation is a form of horizontal gene transfer between bacteria that relies on direct physical contact between two bacterial cells (1). Unlike other forms of gene transfer, such as transformation or transduction, conjugation is a naturally occurring process in which DNA is secreted from a donor cell to a recipient cell in a unidirectional manner. This directionality and the ability for this process to increase the genetic diversity of bacteria has given conjugation the reputation as a form of bacterial &#34;mating,&#34; which is believed to have contributed greatly to the recent rise in antibiotic resistant bacteria (2, 3). By using selective pressures, for example the use of antibiotics, conjugation has been manipulated for use in the laboratory setting, making it a powerful tool for horizontal gene transfer between bacteria, and in some cases from bacteria to yeast, plant, and animal cells (4). Apart from applications in the laboratory, bacterium-eukaryote gene transfer by conjugation is an exciting avenue of DNA transfer with a multitude of possible biotechnical applications and naturally occurring implications (5).
Conjugation is thought to work by a &#34;two-step mechanism&#34; (6). First, before any DNA can be transferred, the donor cell must make direct cell-to-cell contact with the recipient. This process has been characterized best in gram-negative bacteria, the most studied of which is Escherichia coli. Cell-to-cell contact is established by the presence of a complex network of extracellular filaments on the donor known as the sex pilus, a conjugative element encoded for by the transferable gene known as the F (fertility) factor (7, 8). In addition to establishing contact between donor and recipient, several proteins are transported via the sex pilus to the recipient cytoplasm, forming a type IV secretion system (T4SS) conduit between the two cells, a necessary structure for the second step of conjugation, DNA transfer (6). By combining this function of the sex pilus with rolling circle replication of DNA, the donor cell is able to transfer DNA in the form of a transposable element, such as a plasmid or transposon, to the recipient by a &#34;shoot and pump&#34; model (6). In this case, the &#34;shooting&#34; is the transport of the pilot protein, with linked DNA, by the T4SS into the recipient cell, and the &#34;pumping&#34; is the active transport of DNA to the recipient, a process reliant on the T4SS and catalyzed by coupling proteins (6). The machinery used in this this process is composed of an origin of transfer sequence (oriT), which must be provided by the DNA in cis and trans genes, which encode a relaxase, mate pair formation complex, and type IV coupling protein, and can be present in cis or trans (9). This relaxase cleaves the nic site within the oriT sequence and covalently attaches to the 5&#39; end of the transferred strand to produce the relaxosome, a single-stranded DNA-relaxase complex with other auxiliary proteins (9). Once formed, the relaxosome connects to the mating pair formation complex, via the type IV coupling protein, which allows for the transfer of the ssDNA-relaxase complex into recipient cells by the T4SS (10). Once in the cytoplasm of the recipient, the DNA can integrate into the recipient genome or exist separately in the form of a plasmid, either of which allow for the expression of its genes.
In this experiment, the widely used conjugation donor strain E. coli WM3064 was used to transfer the gene encoding for ampicillin resistance to the recipient strain E. coli J53. While both strains of the gram-negative bacteria were resistant to tetracycline, only the donor strain WM3064 had the gene for ampicillin resistance, encoded for in the pWD2-oriT shuttle vector, and was auxotrophic to diaminopimelic acid (DAP) (11-13). This experiment consisted of two main steps, the preparation of donor and recipient strains, followed by the transfer of the ampicillin resistance gene from donor to recipient by conjugation (Figure 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/10516/10516fig1.jpg" /> 
Figure 1: Conjugation schematic. This schematic shows the successful transfer of a plasmid, only one example of a transposable DNA element, from a donor cell to a recipient cell using conjugation. Upon contact with the recipient cell by the donor cell via the sex pilus, the plasmid replicates by rolling circle replication, moves through the multiprotein complex joining the two cells, and forms a new full-length plasmid in the recipient cell.
By incubating a mixture of donor and recipient cells, then successively plating these cells in the presence of tetracycline and DAP, this allowed for the successful transfer of the ampicillin resistance gene. Successively plating cells grown from this mixture in the presence of tetracycline and ampicillin, removed all donor cells due to the lack of DAP and any recipient cells that may not have gained the ampicillin resistance gene, yielding strictly recipient J53 strain bacteria that acquired ampicillin resistance (Figure 2). Once carried out, the successful transfer of the ampicillin resistance gene was confirmed by PCR. Since conjugation was successful, the J53 strain of E. coli contained pWD2-oriT and was resistant to ampicillin, and the gene encoding for this resistance is detectable by PCR. However, if unsuccessful there would have been no detection of the ampicillin resistance gene and ampicillin would still function as an effective antibiotic against the J53 strain.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/10516/10516fig2.jpg" /> 
Figure 2: Protocol schematic. This schematic shows an overview of the presented protocol.
<img alt="Figure 3A" class="xfigimg" src="/files/ftp_upload/10516/10516fig3a.jpg" /> 
Figure 3A: The confirmation of successful conjugation by PCR. A) Freezer stocks of the conjugated and negative control samples were streaked out on agar plates and a colony was selected (red) for DNA isolation.

Conjugation: Transferring Ampicillin Resistance in E. coli

Source: Alexander S. Gold1, Tonya M. Colpitts1
1 Department of Microbiology, Boston University School of Medicine, National Emerging Infections Diseases ...