Bu çalışma kısmen CD NIDA / NIH hibe DA024558, DA30896, DA033892 ve DA021471 tarafından desteklenmektedir. Biz de RCMI hibe G12MD007586 kabul, Vanderbilt CTSA UL1RR024975 hibe, Meharry Translational Araştırma Merkezi NCRR / NIH, NIMHD / NIH U54 hibe MD007593 ve Tennessee CFAR hibe P30 AI110527 dan (MeTRC) CTSA hibe U54 RR026140.

1. Virüs Üretimi Not: bulaşıcı HIV-1&#39;in yüksek titrelerini üretmek bir aktive dendrimer bazlı transfeksiyon reaktifi kullanarak bir enfeksiyon, HIV-1, moleküler klon, insan embriyonik böbrek (HEK) hücre çizgisi 293T transfekte etmek. Kalsiyum fosfat transfeksiyon yöntemi karşılaştırılabilir sonuçlar verir gözlenmiştir. <ol><li> Bir Biyolojik Güvenlik Seviye 2 (BSL2) Laboratuarda, tohum, 8 10 cm tabak başına 3 x 10 6 293T hücreleri mL% 10 fetal sığır serumu (FBS), penisilin ve streptomisin ile takviye edilmiş Dulbecco Modified Eagle Medium (DMEM) içinde. Kültür, bir 37 ° C &#39;ye ayarlanmış inkübatör ve% 5 hücreleri CO2 O / N. </li><li> Sonraki gün, her biri 10 cm tabak hücreleri transfekte etmek için, serum ve antibiyotik yoksun DMEM 300 uL nihai hacim pNL4-3 plazmid DNA (bakınız Materyaller Tablo) 8 ug seyreltin. Transfeksiyon reaktifi 80 mcL pipetleme iyice karıştırın ve oda sıcaklığında inkübe5 - transfeksiyon kompleksi oluşumu için 10 dakika. </li><li> Aspirasyon ile yemeklerin orta çıkarın ve serum ve antibiyotik içeren taze DMEM çanak başına 7 mL ekleyin. </li><li> Transfeksiyon kompleksi DMEM içeren serum ve antibiyotik 1 ml ekleyin pipetleme karışım ve hücreler bu karışıma ekleyin. Yavaşça transfeksiyon komplekslerinden eşit dağılımını kolaylaştırmak için çanak girdap. </li><li> Hemen, 48 saat boyunca hücre CO2, 37 ° C ve% 5 ayarlanmış bir kuluçka makinesi içinde BSL3 laboratuar yerde hücreleri transferi, ve kültür. </li><li> bir pipet kullanılarak virüs içeren bir doku kültür süpernatant toplamak ve daha sonra bir santrifüj tüpüne transfer. 5 dakika boyunca 300 x g&#39;de santrifüj hücreleri ve yıkıntıları pelet haline, ve daha sonra bir 0.45 mikron gözenek boyutlu şırınga filtre ile süpernatant filtre. </li><li> Bu hücresiz virüsü hazırlanmasında herhangi bir devir plazmid DNA ortadan kaldırmak için 1 saat süreyle 37 ° C &#39;de DNase 1 (20 ug / ml) ile tedavi edilir. </li><li> ölçmek içinBu rutin kullanım 22 için hızlı ve müsait yöntem olarak, HİV-1 titre, p24-özel enzim bağlı immünosorbent deneyi (ELISA) kullanın. Not: p24 ELISA fiziksel titresi (virüs parçacıklarının sayısı) ölçen Belirtilmelidir. Seçenek olarak ise, virüs ilişkili RT aktivitesi (ekzojen RT deneyi) veya virüs enfeksiyonu (tzm-BL endikatör hücre hattı bazlı enfekte deneyleri) ölçüm enfeksiyonlu virüs parçacığı özel olarak okunmasını sağlayacaktır. </li></ol> Sup-T1 Hücreleri 2. Virüs Enfeksiyonu (BSL3 Lab) <ol><li> Bir BSL2 Laboratuarda, 1 6 ila 10 x 10 x 1,0 ile 6 ve 2.0 hücre / Roswell Park Memorial Institute (RPMI),% 10 ısı ile inaktive edilmiş FBS, penisilin ile desteklenen ortamda ve streptomisin mL (bölünme oranı Sup-T1 hücreleri korumak : 2 her 2-3 d). , Kültür şişeler Sup-T1 hücreleri havuz pipetle iyice karıştırın ve bir hemasitometre ve tripan mavisi dışlama st kullanarak canlı hücre sayısını belirlemekyöntemi Aining. <ol><li> 50 ml konik santrifüj tüpleri içinde (virüs enfeksiyonu başına) 80 x 10 6 hücre hacimde gerekli sayıda hazırlayın. </li><li> 500 xg bir sallanan kepçeli rotor hücreleri santrifüj ve 5 dakika boyunca 25 ° C. Hücre kültürü ortamı çıkarmadan daha fazla işlem için BSL-3 laboratuara tanelenmiş hücreler ihtiva eden tüpler aktarın. Dikkatle hücre pelletini bozmadan tüpten hücre kültür ortamı aspire. </li></ol></li><li> tüp içinde hücrelere DNase I ile tedavi edilen virüs aşı maddesi, uygun bir miktarda eklenir ve yavaşça pipetleme ile iyice karıştırın. 80 x 10 6 hücre için, DNase I ile tedavi edilen virüs (P24 eşdeğer virüsün 50 ug), 30 mL kullanımı. Not: Fonksiyonel PIC izolasyonu enfeksiyonun yüksek çokluklar ile (MOI) hedef hücreleri enfekte gerektirir. </li><li> Eşit, yani iki adet 6 oyuklu doku kültür plakaları (12 x 2.5 ml alikotları arasındaki karışım dağıtın, Infect başına 2 tabak kullanıniyon). </li><li> spinoculation için, sallanan bir kova 480 xg&#39;de rotor ve 2 saat 25 ° C ile plakası taşıyıcılar ve santrifüj kültür plakaları yerleştirin. </li><li> 5 saat boyunca CO2 37 ° C&#39;de spinoculated hücreleri inkübe ve% 5. </li></ol> Enfekte Hücre 3. Hasat ve Lizis (BSL3 lab) <ol><li> 50 ml konik santrifüj tüpüne kültür plakalarından her enfeksiyona karşı gelen hücreler (~ toplam 30 mL) havuz. </li><li> 300 x g&#39;de santrifüj ile hücreler hasat edilir ve 10 dakika için 25 ° C. Dikkatle tüpten aspire (alternatif, bir pipet kullanın). </li><li> Herhangi bir artık viral partikülleri çıkarmak için, tampon K 2 mL eklenerek her bir hücre pelletini yıkama - / - (150 mM KCI, 20 mM HEPES, pH 7.6, 5 mM MgCI2) ve 300 x g hızında numune ve 25 ° C sıcaklıkta santrifüj 10 dakika. Sonra, pelet bozmadan özenle aspirasyon veya bir pipet kullanarak süpernatant kaldırmak. </li><li> Repeat adım 3.3. </li><li> Dikkatlice mikropipet kullanarak herhangi bir kalıntı tampon kaldırmak. Buz soğukluğunda parçalama tamponu K 2 mL her bir hücre pelletini + / + (Tampon K - / -% 0.025 digitonin, 1 mM DTT, 20 ug / ml aprotinin ile takviye edilmiş), nazik bir pipetleme ile karıştırın ve transfer 2 ml mikrosantrifüj tüpü. </li></ol> Sitoplazmik PIC 4. Hazırlama (BSL3 lab) <ol><li> 10 dakika boyunca oda sıcaklığında bir döner çalkalayıcıda örnekleri sallayın. </li><li> 1.500 x g&#39;de 4 ° C&#39;ye soğutulmuş, rotor, numuneler santrifüj ve 4 dakika için 4 ° C. </li><li> pelet bozmadan, dikkatli bir şekilde 16,000 xg&#39;de taze mikrosantrifüj tüpü ve santrifüj süpernatantı transfer ve 1 dakika boyunca 4 ° C. </li><li> Dikkatle taze mikrosantrifüj tüp süpernatantı aktarın. 30 dakika (Resim sallanan), oda sıcaklığında ve içeriği 20 mg / ml (PIC 2 mL 2 uL) bir son konsantrasyona kadar, RNaz A (20 mg / ml) ilave edin ve inkübe edilir. &lt;/ Li&gt; <li> % 7 oranında bir nihai konsantrasyona kadar ve yumuşak pipetle iyice karıştırın - (- / tampon K 60 w% / hac) sakroz ekleyin. Sıvı nitrojen içinde flaş dondurma ve yer -80 uzun süreli depolama için ° C derin dondurucuda, mikrosantrifüj tüplerinde PIC hacimde (örneğin, 200 uL) hazırlayın. </li></ol> In Vitro Entegrasyon 5. (IVI) Tahliller, HIV-1 pics kullanma <ol><li> ölçüye primerler phiX174-F phiX174-R kullanılarak PCR ile phiX174 plazmid DNA&#39;sından 2.0 kb bölgenin amplifikasyonuyla IVI deneyinde kullanılan hedef DNA hazırlamak. <ol><li> Tablo 1 &#39;de tarif edildiği gibi PCR karışımı bir araya getirin. Tablo 2&#39;de önerilen termal döngü koşulları kullanılarak, bir termal döngü PCR gerçekleştirin. (Üretici tarafından tavsiye edilen protokole göre) bir jel saflaştırma kiti kullanılarak PCR ürünü jelle saflaştırılması, ve kullanılana kadar -80 ° C &#39;de parçalar olarak saflaştırılmış bir hedef DNA saklayın. </li></ol></li><li> 200 hedef DNA&#39;nın 600 ng ekleyin - &amp; #181; PIC L tümböleni, iyice karıştırın ve 45 dakika boyunca 37 ° C&#39;de inkübe edin. Not: Bir integraz inhibitörü (örn Raltegravir) hedef DNA atlama da dahil IVI reaksiyonları kontrol reaksiyonları tavsiye edilir. </li><li> % 0.5, 8 mM, sırasıyla 0.5 mg / mL, nihai konsantrasyonları SDS, EDTA, ve proteinaz K eklenerek IVI reaksiyonu durdurun. İyice reaksiyon içeriğini karıştırın ve gece boyunca 56 ° C kuluçkaya yatmaktadır. </li><li> Sonraki gün, fenol / kloroform ekstraksiyonu ve etanol çökeltmesiyle IVI reaksiyonu toplam DNA arındırmak. 16.000 xg ve oda sıcaklığında bütün santrifüj adımları uygulayın. </li><li> 2 dakika boyunca, deproteinize örnek fenol eşit hacmi ekleme vorteks ile kuvvetli bir şekilde karıştırın ve santrifüjlenir. Dikkatle üst sulu faz kaldırmak ve yeni bir tüp aktarın. </li><li> Adımı tekrarlayın 5.5. yeni bir tüp, üst sulu faz transfer. </li><li> , Kloroform karışımı vorteks ile kuvvetlice karıştırın ve santrifüj fo: 1 fenol: 1 eşit hacimde ekleR 2 dak. yeni bir tüp, üst sulu faz transfer. </li><li> Kloroform eşit hacmi ekleme vorteks ile kuvvetli bir şekilde karıştırın ve 2 dakika boyunca santrifüj. yeni bir tüp, üst sulu faz transfer. </li><li> DNA çökeltilmesi 0.3 M bir son konsantrasyona kadar 0.1 mg / ml, sodyum asetat 3 M nihai konsantrasyona glikojen ekleyin ve% 100 etanol (buz soğukluğunda) 2.5 hacim için. Vortex içeriğini toplamak için, santrifüj kısaca karıştırın ve -80 ° CO / N tüp yerleştirmek için. </li><li> Sonraki gün, 16,000 x g&#39;de 30 dakika boyunca örnek santrifüj ve 30 dakika boyunca 4 ° C. Dikkatle pelet bozmadan süpernatant kaldırmak. </li><li> 16.000 x g&#39;de topak ve santrifüj% 80 etanol (buz soğukluğunda) 500 uL ilave edin ve 10 dakika boyunca 4 ° C. Oda sıcaklığında, DNA topağı hava-kurutun ve iyice nükleaz içermeyen su, 50 uL yeniden süspanse edin. -20 ° C&#39;de DNA örnekleri saklayın. </li></ol> Ükler PIC Aktivitesi 6. PCR tahlilleri <ol><li> Entegre HIV-1 DNA kavşaklar çoğaltmak için (sırasıyla LTR ve phiX174 astar,), viral LTR ve phiX174 DNA hedefleyen primerler kullanılarak ilk turda geleneksel PCR gerçekleştirin. <ol><li> Tablo 3 de tarif edildiği gibi birinci fasıl PCR karışımı bir araya getirin. Şablon DNA hariç bütün bileşenlerin bir ana karışımı birleştirin, ayrı PCR tüpleri içine 45-uL&#39;lik dağıtmak ve şablon DNA veya nükleaz içermeyen su (kontrol) 5 mcL ekleyin. </li><li> Tablo 4 &#39;de tavsiye edilen termal döngü koşulları kullanılarak, bir termal döngü PCR gerçekleştirin. </li></ol></li><li> seçici olarak birinci ro entegre vDNA dizilerini amplifiye etmek için virüs LTR (LTR-R ve LTR-U primerler) kısa bir bölgeye yanaşan primerler kullanılarak ikinci tur qPCR gerçekleştirmekund PCR ürünleri. Entegre vDNA numara kopyalamak belirlemek için, bilinen kopya numaralarının 10x seri dilüsyonları kullanılarak standart bir eğri oluşturmak (örneğin, 10 0-10 8), HIV-1, moleküler klon. <ol><li> Tablo 5&#39;te tarif edildiği gibi ikincil qPCR karışımı bir araya getirin. 96 oyuklu bir PCR reaksiyonu plaka kuyuları uygun sayıda 25. uL&#39;lik tevzi dikkatle, şablon DNA hariç bütün bileşenlerin bir ana karışımı monte ve saflaştırılmamış birinci tur PCR ürünleri ya nükleaz içermeyen su 5 mcL (kontrol). üç kez tüm qPCR reaksiyonları gerçekleştirmek. </li><li> Real-time PCR aracı haline PCR plakasını yükleyin ve Tablo 6&#39;da tavsiye edilen bisiklet koşulları kullanılarak qPCR gerçekleştirin. </li><li> Uygun bir yazılım kullanarak verileri analiz edin. </li></ol></li></ol>

<ol>
	<li>Sattentau, Q. J., Weiss, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CD4+antigen:+physiological+ligand+and+HIV+receptor.">The CD4 antigen: physiological ligand and HIV receptor.</a> Cell. 52 (5), 631-633 (1988).</li><li>Wilen, C. B., Tilton, J. C., Doms, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+HIV+entry.">Molecular mechanisms of HIV entry.</a> Adv Exp Med Biol. 726, 223-242 (2012).</li><li>Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nucleoprotein+complex+mediates+the+integration+of+retroviral+DNA.">A nucleoprotein complex mediates the integration of retroviral DNA.</a> Genes Dev. 3 (4), 469-478 (1989).</li><li>Bukrinsky, M. I., Sharova, N., Dempsey, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+nuclear+import+of+human+immunodeficiency+virus+type+1+preintegration+complexes.">Active nuclear import of human immunodeficiency virus type 1 preintegration complexes.</a> Proc Natl Acad Sci. 9 (14), 6580-6584 (1992).</li><li>Hansen, M. S., Smith, G. J., Kafri, T., Molteni, V., Siegel, J. S., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+complexes+derived+from+HIV+vectors+for+rapid+assays+in+vitro.">Integration complexes derived from HIV vectors for rapid assays in vitro.</a> Nature biotechnol. 17 (6), 578-582 (1999).</li><li>Farnet, C. M., Haseltine, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+human+immunodeficiency+virus+type+1+DNA+in+vitro.">Integration of human immunodeficiency virus type 1 DNA in vitro.</a> Proc Natl Acad Sci. 87 (11), 4164-4168 (1990).</li><li>Fujiwara, T., Mizuuchi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration:+structure+of+an+integration+intermediate.">Retroviral DNA integration: structure of an integration intermediate.</a> Cell. 54 (4), 497-504 (1988).</li><li>Brown, P. O., Bowerman, B., Varmus, H. E., Bishop, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Correct+integration+of+retroviral+DNA+in+vitro.">Correct integration of retroviral DNA in vitro.</a> Cell. 49 (3), 347-356 (1987).</li><li>Lewinski, M. K., Bushman, F. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+DNA+integration--mechanism+and+consequences.">Retroviral DNA integration--mechanism and consequences.</a> Adv Genet. 55, 147-181 (2005).</li><li>Engelman, A., Mizuuchi, K., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+DNA+integration:+mechanism+of+viral+DNA+cleavage+and+DNA+strand+transfer.">HIV-1 DNA integration: mechanism of viral DNA cleavage and DNA strand transfer.</a> Cell. 67 (6), 1211-1221 (1991).</li><li>Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+of+retroviral+integration.">Genetics of retroviral integration.</a> Ann rev gen. 26, 527-544 (1992).</li><li>Panganiban, A. T., Temin, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+terminal+nucleotides+of+retrovirus+DNA+are+required+for+integration+but+not+virus+production.">The terminal nucleotides of retrovirus DNA are required for integration but not virus production.</a> Nature. 306 (5939), 155-160 (1983).</li><li>Bieniasz, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell+biology+of+HIV-1+virion+genesis.">The cell biology of HIV-1 virion genesis.</a> Cell host microbe. 5 (6), 550-558 (2009).</li><li>Sherman, P. A., Fyfe, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+immunodeficiency+virus+integration+protein+expressed+in+Escherichia+coli+possesses+selective+DNA+cleaving+activity.">Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.</a> Proc Natl Acad Sci. 87 (13), 5119-5123 (1990).</li><li>Katzman, M., Katz, R. A., Skalka, A. M., Leis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+avian+retroviral+integration+protein+cleaves+the+terminal+sequences+of+linear+viral+DNA+at+the+in+vivo+sites+of+integration.">The avian retroviral integration protein cleaves the terminal sequences of linear viral DNA at the in vivo sites of integration.</a> J Virol. 63 (12), 5319-5327 (1989).</li><li>Craigie, R., Mizuuchi, K., Bushman, F. D., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+in+vitro+assay+for+HIV+DNA+integration.">A rapid in vitro assay for HIV DNA integration.</a> Nucl acid res. 19 (10), 2729-2734 (1991).</li><li>Bushman, F. D., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activities+of+human+immunodeficiency+virus+(HIV)+integration+protein+in+vitro:+specific+cleavage+and+integration+of+HIV+DNA.">Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.</a> Proc Natl Acad Sci. 88 (4), 1339-1343 (1991).</li><li>Pauza, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+bases+are+deleted+from+the+termini+of+HIV-1+linear+DNA+during+integrative+recombination.">Two bases are deleted from the termini of HIV-1 linear DNA during integrative recombination.</a> Virology. 179 (2), 886-889 (1990).</li><li>Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+analysis+of+HIV-1+preintegration+complexes.">Isolation and analysis of HIV-1 preintegration complexes.</a> Meth Mol Biol. 485, 135-149 (2009).</li><li>Engelman, A., Oztop, I., Vandegraaff, N., Raghavendra, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+HIV-1+preintegration+complexes.">Quantitative analysis of HIV-1 preintegration complexes.</a> Methods. 47 (4), 283-290 (2009).</li><li>Addai, A. B., Pandhare, J., Paromov, V., Mantri, C. K., Pratap, S., Dash, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cocaine+modulates+HIV-1+integration+in+primary+CD4++T+cells:+implications+in+HIV-1+pathogenesis+in+drug-abusing+patients.">Cocaine modulates HIV-1 integration in primary CD4+ T cells: implications in HIV-1 pathogenesis in drug-abusing patients.</a> J Leuk Biol. 97 (4), 779-790 (2015).</li><li>Wehrly, K., Chesebro, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p24+antigen+capture+assay+for+quantification+of+human+immunodeficiency+virus+using+readily+available+inexpensive+reagents.">p24 antigen capture assay for quantification of human immunodeficiency virus using readily available inexpensive reagents.</a> Methods. 12 (4), 288-293 (1997).</li></ol>

Yazarlar hiçbir rakip mali ve mali olmayan çıkarları beyan ederim.

retroviral PIC biyokimyasal analizler retroviral DNA entegrasyonu mekanizması içine kritik bilgiler sağladı. Retroviral PIC entegrasyonu faaliyetinin ölçülmesi plak formasyonu deneyi, Güney benek analizi, ve iç içe geçmiş qPCR elde edilebilir. Plak deneyi deneysel strateji zahmetlidir ve entegrasyonu 6, 7, 18 ölçmek için dolaylı bir yöntem kullanmaktadır. Güney benek bazlı deneyler ölçer entegrasyonu doğrudan değil, PIC 6, 7, 18, nispeten yüksek miktarlarda gerektirir. Bu rapor, in vitro HIV-1 PIC ilişkili entegrasyon aktivitesini ölçmek için bir iç içe qPCR stratejisi detayları. Önemli bir avantajı, bu yöntemin önemi reaksiyon başına 4 PIC hazırlanması nispeten düşük miktarlarda gereklilik, 5, 19. Bu yöntemin en önemli adımları enfeksiyonu için yüksek titre virüsün üretimi PIC hazırlama işleme. PCR ilk turda entegrasyonu kavşaklar üstel amplifikasyon içerdiğini burada belirtmek gerekir. Sonuç olarak, ikinci turda qPCR belirlenen entegre vDNA kopya sayıları, dolayısıyla PIC-ilişkili vDNA kopya ölçüsünü vermiyorum sınırlama var yarı-kantitatif ve. DNA, LTR-özgü primerler ile PIC saflaştırılan Bununla birlikte, PIC ilişkili vDNA qPCR belirlenebilir. Entegre vDNA oranı bir in vitro uyum reaksiyonu entegrasyon verimliliği hakkında bilgi verebilir gelen PIC-ilişkili vDNA numaralar kopyalayın. Bu yöntem, her iki yönde de entegre tespit etmek için bir seçim ve primerler başka heterolog hedef DNA eklenerek modifiye edilebilir. Özetle, yöntemBurada tarif edilen nicel HIV-1 PIC entegrasyonu aktivitesini ölçer ve retroviral entegrasyonu biyokimyasal ayrıntıları bir anlayış geliştirilmesi araştırma için benimsenebilir.

Erken ve geç olayların: hedef hücre içinde, HIV-1 replikasyon genel olarak iki faza gruplanmış birden fazla aşamasını içerir. HİV-1, sırasıyla, hedef hücre yüzeyi reseptörü, CD4 ve iki ko-reseptörleri (CCR5 ya da CXCR4) 1 birine bağlandığı zaman, erken olayları başlar. Sonuç olarak, virüs-hücre membranları sigorta ve viral kapsid (CA), çekirdek sitoplazmaya 2 salınır. CA temel viral ve kaynaklı hücresel hem de viral genomik tek şeritli RNA (ssRNA) ve çeşitli proteinleri içerir. CA-ilişkili viral proteinler ters transkriptaz (RT) ve integraz (İN), viral replikasyon erken olaylan sırasında kritik adımları aracılık iki enzimler bulunmaktadır. RT ve nükleoprotein kompleksleri, yani ters transkripsiyon kompleksi (RTC) ve ön-uyum kompleksi (PIC), sırasıyla, 3, 4, 5 kapsamında işlevin &lt;sup&gt;, 6. &#39;(Sonunda 3&#39;ün at) (sonu ve U3 viral ssRNA genom liman terminal tekrarı (R) 5&#39; ucunda) &#39;eşsiz dizileri U5 bitişik elemanları biter. RTC çift-şeritli (ds) DNA kopyasını (vDNA) viral ssRNA genomu dönüştürür. Bu ters transkripsiyon işlemi, bu şekilde vDNA 7, 8 her iki ucunda uzun terminal tekrarları (LTR) üretilmesi, U5 ve U3 dizilerinin çoğaltılması ile sonuçlanır. Daha sonra, PIC-ilişkili IN konukçu kromozom 9, 10, 11 içine vDNA entegrasyonunu sağlayan iki sıralı biyokimyasal reaksiyonları katalize eder. İlk olarak, sitoplazmada, multimerler her iki LTR 12 meşgul ve 3&#39;-terminal uçlarının her birinden bir dinükleotid bölmektedir. Bu 3&#39;-uç işleme, her 3&#39;-ucunda vDNA (Ca OH) bir hidroksil grubu oluşturur.Zikzaklı bir şekilde kromozomal DNA&#39;nın her iki kolunu kesmek için bir nükleofil olarak OH vDNA CA; buradaki sonra, PIC çekirdeğe trafik işlemlerini gerçekleştirir. Aynı zamanda, İN koordineli kromozomal DNA karşı sarmalda elde fosfodiester bağlarına vDNA her iki ucunu birleşim yerlerinin. Bu şerit transferi adımından sonra, konak hücre makine entegrasyonu sitenin kavşakta 5 &#39;vDNA uçlarına ve onarım takip eden tek sarmallı boşluklar iki eşleşmemiş nükleotidleri kaldırır. Erken olaylar dolayısıyla HIV-1 genomunun entegre DNA kopyası (provirus) kurulmasıyla sonuçlanacak. Provirüs virüs kodlanmış proteinlerin ekspresyonu dahil olmak üzere, daha sonraki olayları başlattığı etkin viral gen ekspresyonu için uygun bir ortam sağlar; olgunlaşmamış virüs montaj; ve bulaşıcı virionlar 13 içine tomurcuklanma, serbest ve olgunlaşma. Saflaştırılmış rekombinant retroviral IN yetkili olduğunuin vitro, yürütmek, hem 3&#39;-uç işleme ve iplik aktarma faaliyetleri Eksojen LTR-benzeri DNA ana madde sağladı. Arıtılmış yeniden birleştirici kullanarak biyokimyasal çalışmalar, vDNA entegrasyonu 14, 15, 16, 17 kritik yönleri ortaya koymuştur. Bununla birlikte, doğal enfeksiyon farklı olarak, bu in vitro biyokimyasal reaksiyon, hedef DNA&#39;ya alt-tabaka DNA&#39;nın her iki ucundan ortak entegre desteklemez. Bunun aksine, akut olarak enfekte olan hücrelerden izole retroviral PIC concertedly heterolog hedef DNA&#39;ya endojen vDNA her iki ucunu birleştirmek. Bu izole yerli Pics kullanarak yaygınlaşmasının ve ben n Vitro Entegrasyonu (IVI) deneyleri sonraki iyileştirmelere yol açtı. İlk olarak retroviral IVI deneyi, bir rekombinant sıçan ile enfekte edilmiş hücrelerden alınan sitoplazmik özler raporBunu LTR E. coli supF genini barındıran Lösemi Virüsü (MLV) aktivite kaynağı ve litik büyüme hatalı dışsal, hedef DNA olarak verilen bir mutan lambda faj DNA olarak görev yaptı. rekombinant DNA MLV Başarılı entegrasyon faj DNA kopyalamak ve supF takip eden ifade rekombinant faj plak oluşturan yeteneğini restorasyonu yol açtı. Bununla birlikte, bu deneysel strateji dolaylı şekilde zahmetli ve önlemler entegrasyondur. Bu uyarılar gidermek için, eksojen doğrusallaştırılmış bakteriyofaj phiX174 DNA&#39;sına entegre endojen vDNA bir ölçüsü olarak, PIC ilişkili IVI aktivitesi nicelleştiren bir Güney benek tabanlı dolaylı uç işaretleme analizi, 18 7, 6 geliştirilmiştir. Bu yöntem entegrasyon olayların doğrudan ölçüsünü verir rağmen, PIC hazırlık nispeten yüksek miktarlarda teknik olarak oldukça zor kalır, gerekligayret. Bu aşmak için, PIC bölgesinin sadece az miktarda gereken iç içe PCR bazlı deneyler, 19 5, 4 geliştirilmiştir. Bu yazıda güncelleştirilmiş bir sürümünü tanımlayan bir iç içe doğal enfeksiyon sırasında meydana gelen HIV-1 PIC-aracılı entegrasyon faaliyeti özetlemek için tasarlanmış in vitro yöntem PCR tabanlı. Bu yöntem, bir gerçek zamanlı kantitatif Polimeraz Zincir Reaksiyonu (qPCR) ölçülen endojen PIC aktivite kaynağı olarak, HİV-1 ile enfekte edilmiş hedef hücrelerin sitoplazmik özler kullanılır. Onların entegrasyon faaliyetlerini PICS izole ve ölçmek için prosedürler Engelman laboratuvar 20 tarafından yayınlanan protokollerden, değişikliklerle, adapte edilir. Bu yöntemde PIC ilişkili entegrasyon aktivitesi eksojen bir doğrusal hedef DNA 21 ve elde edilen DNA ürünleri temin edilmesiyle başlatılırBu entegrasyon, reaksiyon saf hale getirilir ve daha sonra, PCR tabanlı bir miktar tayini için başlangıç ​​malzemesi olarak kullanılır. Birinci turda, geleneksel PCR, viral hedef DNA, kavşaklar, uygun primerler kullanılarak yükseltilir. ikinci turda qPCR, LTR-özel primerler, özellikle ilk tur PCR ürünlerinden vDNA popülasyonu ettirecek kullanılır. Bu yöntemin ayrıntılı bir açıklama için protokol bölümüne bakın. Retroviral PIC ile in vitro çalışmalar retroviral DNA entegrasyon mekanizması anlayışımızda ve IN inhibitörlerinin gelişiminde önemli ilerlemelere yol açmıştır. HIV-1 entegrasyon viral ve konak faktörlerin rolünü belirlemek ve ilaç direncini mücadele yolunda yeni antiviral ilaçlar geliştirmek, haritalama, HIV-1 bütünleşme sitelerinde son artan odak dayanarak, IVI deneylerinin bir artış ilgi ve yaygın kullanımı tasavvur Bu raporda açıklanan gibi. Bu da, yol açacaktıryönteminde gelecek iyileştirmeler, böylece onun uygulamalarının kapsamını çeşitlendirilmesi.

<table align="left" border="1" cellpadding="0" cellspacing="0" style="width:679px;" width="679">
	<tbody>
		<tr>
			<td style="width:312px;">
			Fetal bovine serum (FBS)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			10437-028
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:34px;">
			Heat-inactivated Fetal bovine serum (Hi-FBS)
			</td>
			<td style="width:198px;height:34px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:34px;">
			10438-026
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:42px;">
			Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM)
			
			</td>
			<td style="width:198px;height:42px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;height:42px;">
			11995-065
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Roswell Park Memorial Institute (RPMI) 1640 medium
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			11875-093
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phosphate buffered saline (PBS) (1X)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			20012-027
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Trypsin-EDTA (0.25%)
			
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			25200-056
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Penicillin-Streptomycin solution (100x)
			</td>
			<td style="width:198px;">
			Cellgro/Mediatech
			</td>
			<td style="width:138px;">
			30-002-CI
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEK293T cells (293T)
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-3216
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV-1 proviral molecular clone pNL4-3
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			114
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PolyFect transfection reagent
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			301107
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			DNase
			
			</td>
			<td style="width:198px;">
			Calbiochem/Merckmillipore
			</td>
			<td style="width:138px;">
			260913
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Immulon 2HB 96-well plates
			
			</td>
			<td style="width:198px;">
			Thermo Scientific
			
			</td>
			<td style="width:138px;">
			3455
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Triton X-100
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9284
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA coating antibody: anti-CA-183-H12-5C monoclonal antibody
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			1513
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			ELISA wash solution (0.2% Tween-20 in PBS)
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Donor bovine serum
			</td>
			<td style="width:198px;">
			&#160;Gibco/Invitrogen
			</td>
			<td style="width:138px;">
			16030074
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:78px;">
			Blocking Buffer (5% donor bovine serum in PBS) - Prepare fresh before use.
			
			</td>
			<td style="width:198px;height:78px;">
			---
			</td>
			<td style="width:138px;height:78px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sample diluent (SD) buffer (10% donor bovine serum and 0.5% Triton X-100 in PBS) - Sterilize using 0.22 micron pore-size syringe filter and store aliquots at 4&#176;C.
			
			</td>
			<td style="width:198px;">
			---
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Recombinant p24 protein
			(Full-length CA protein was expressed from pET21a-CA plasmid in E. coli BL21-DE3 and purified as described in Ref # ----)
			</td>
			<td style="width:198px;">
			Dr. Wesley Sundquist
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HIV IgG
			</td>
			<td style="width:198px;">
			NIH AIDS Research and Reference Reagent Program
			
			</td>
			<td style="width:138px;">
			3957
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Goat anti-human IgG (H+L) cross-adsorbed secondary antibody, HRP conjugate
			</td>
			<td style="width:198px;">
			Pierce/ThermoFisher
			
			</td>
			<td style="width:138px;">
			31412
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			TMB Microwell Peroxidase substrate system
			</td>
			<td style="width:198px;">
			KPL, Inc.
			</td>
			<td style="width:138px;">
			50-76-00
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			SupT1 cells
			</td>
			<td style="width:198px;">
			American Type Culture Collection (ATCC)
			</td>
			<td style="width:138px;">
			CRL-1942
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			HEPES pH 7.2-7.5
			(ready-to-use solution)
			</td>
			<td style="width:198px;">
			GIBCO/Invitrogen
			</td>
			<td style="width:138px;">
			15630-080
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Potassium chloride (KCl) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			60142
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Magnesium chloride (MgCl2) solution
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			M1028
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Dithiothreitol (DTT)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			43815
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Aprotinin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			A6106
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Digitonin
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			D141
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			RNase A
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			12091-021
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:29px;">
			Sucrose
			</td>
			<td style="width:198px;height:29px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:29px;">
			S0389
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			phiX174 Replicative Form 1 DNA
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			D1531
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			PhiX174-F primer:
			5&#8217;-CGCTTCCATGACGCAGAAGTT-3&#8217;
			
			PhiX174-R primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			
			
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			dNTP mix
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			U1515
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Go Taq DNA Polymerase
			</td>
			<td style="width:198px;">
			Promega
			</td>
			<td style="width:138px;">
			M3005
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Qiaquick gel extraction kit
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			28706
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ultrapure distilled water
			</td>
			<td style="width:198px;">
			Invitrogen
			</td>
			<td style="width:138px;">
			10977-015
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Tris-EDTA (TE) buffer (100X)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			T9285
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium dodecyl sulphate (SDS)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			L3771
			</td>
		</tr>
		<tr>
			<td style="width:312px;height:50px;">
			Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0
			</td>
			<td style="width:198px;height:50px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;height:50px;">
			E7889
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Proteinase K (20 mg/ml ready-to-use solution)
			</td>
			<td style="width:198px;">
			Qiagen
			</td>
			<td style="width:138px;">
			19131
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Phenol (equilibrated with 10&#160;mM Tris HCl, pH&#160;8.0 and 1&#160;mM EDTA)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			P4557
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Chloroform
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			288306
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Glycogen (5 mg/ml solution)
			</td>
			<td style="width:198px;">
			Ambion/Invitrogen
			</td>
			<td style="width:138px;">
			AM9510
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Sodium acetate (3M, pH 5.2)
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			57899
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Ethanol
			</td>
			<td style="width:198px;">
			Sigma-Aldrich
			</td>
			<td style="width:138px;">
			E7023
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			First round LTR primer:
			5&#8217;-GTGCGCGCTTCAGCAAG-3&#8217;)
			First round phiX174 primer:
			5&#8217;-CACTGACCCTCAGCAATCTTA-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			Second round LTR-R primer:
			5&#8217;-TCTGGCTAACTAGGGAACCCA-3&#8217;
			Second round LTR-U primer:
			5&#8217;-CTGACTAAAAGGGTCTGAGG-3&#8217;;
			
			Second round Taqman probe:
			&#160;5&#8217;-56- FAM/TTAAGCCTCAATAAAGCTTGC
			CTTGAGTGC/36-TAMRA/-3&#8217;
			</td>
			<td style="width:198px;">
			Invitrogen and/or IDT-DNA
			</td>
			<td style="width:138px;">
			---
			</td>
		</tr>
		<tr>
			<td style="width:312px;">
			iQ Supermix
			</td>
			<td style="width:198px;">
			Bio-Rad
			</td>
			<td style="width:138px;">
			170-8862
			</td>
		</tr>
	</tbody>
</table>

measurement of in vitro integration activity of hiv-1 preintegration complexes

HIV-1 kaplama proteinleri sitoplazmaya Viral kapsid (CA) çekirdeğin serbest ardından viral hücre zarı birleşmesine yol açar, hedef hücre yüzeyi üzerinde aynı kökenli reseptörleri girerler. Daha sonra, viral ters transkriptazı (RT), bir adaşı nükleoprotein kompleksinin bir parçası olarak karmaşık Ters Transkripsiyon (RTC), çift iplikçikli bir DNA kopyasını (vDNA) viral tek iplikli RNA genomunu dönüştürür olarak adlandırılır. Bu, başka bir nukleoprotein kompleksinin biyogeneze açar, vDNA ve ilişkili virüs proteinleri ve konak faktörlerinin oluşan ön entegrasyon kompleksi (PIC) olarak adlandırılan. PIC-ilişkili viral integraz (İN), bir geçici ve mekansal olarak düzenlenmiştir, iki aşamalı bir işlemde konak kromozomal DNA içine vDNA entegrasyonunu yönetir. İlk olarak, PIC çekirdeğine trafik işlemlerini sonra, kromozomal DNA içine işlenmiş vDNA entegrasyonunu aracılık ikinci sitoplazmada vDNA 3 &#39;uçları işler ve. PIC izolebunlar, bir eksogen olarak ilave heterolog hedef DNA&#39;ya ilişkili vDNA entegre yetkinliğe sahip olan akut HIV-1 ile enfekte edilmiş hedef hücrelerden in vitro fonksiyonel. Böyle bir PIC tabanlı in vitro entegrasyon tayinlerde anlamlı retroviral entegrasyon mekanik ayrıntılarını ortaya koymayı amaçlayan ve inhibitörleri IN keşfetmek katkıda bulunmuştur. Bu yazıda, izole yerli PIC in vitro entegrasyon aktivitesini ölçmek için iç içe geçmiş bir gerçek zamanlı kantitatif Polimeraz Zincir Reaksiyonu (qPCR) tabanlı bir strateji benimseyerek güncelleştirilmiş bir HIV-1 PIC tahlil üzerine ayrıntılı.

HIV-1 PIC bölgesinin izolasyonu Akut enfekte Sup-T1 hücreleri, HIV-1 PIC bölgesinin izolasyonu için kullanılan protokolün bir şeması, Şekil 1 &#39;de tasvir edilmiştir. Bu protokol, Engelman ve ark anlatılan yöntemlerle elde edilir. 19, 20. HIV-1 PIC enfekte olmuş hücreler toplandı ve ters-transkribe vDNA oluşmaktadır nükleoprotein kompleksleri, viral proteinler, ve hücresel faktörler 19, 20 vardır. Bu raporda tarif edilen yöntem PIC ilişkili entegrasyon aktivite kaynağı olarak, HIV-1 ile enfekte olan hücrelerin sitoplazmik özler kullanılır. HIV-1 PIC in vitro entegrasyon etkinlikte Şekil 2 &#39;de gösterilmiştir. Bu yöntem, PIC ilişkili IVI aktivitesini ölçmek için bir iç içe qPCR dayalı strateji kullanır ve prosedürler Engelman laboratuarda 19, 20, 21 tarafından yayınlanan protokollerden, modifikasyonlarla, adapte edilir. Bu yöntemde PIC ilişkili entegrasyon aktivitesi bir heterolog doğrusal hedef DNA 21 ile sağlanmaktadır ve bu uyum reaksiyonundan elde edilen DNA ürünleri saflaştırılmış ve daha sonra, PCR tabanlı bir miktar tayini için başlangıç malzemesi olarak kullanılmaktadır. Birinci turda, geleneksel PCR, viral hedef DNA, kavşaklar, uygun primerler kullanılarak yükseltilir. ikinci turda qPCR, LTR-özel primerler, özellikle ilk tur PCR ürünlerinden vDNA popülasyonu ettirecek kullanılır. protokol s bakınızBu yöntemin ayrıntılı bir açıklama için ection. Bir IVI testte Örnek sonuçlar, HIV-1 PIC Şekil 3&#39;te gösterilmiştir kullanılarak gerçekleştirildi. Sup-T1 hücreleri (80 x 10 6 hücre / enfeksiyonu) DNase 1 ile tedavi edilmiş HIV-1, 30 mL spinoculated edildi (~ p24 eşdeğer, 50 ug) 480 ya da yokluğunda önleyicisi Raltegravir 1 uM, HIV-1 mevcudiyetinde xg ve 2 saat boyunca 25 ° C. Hücreler, 37 ° C de 5 saat ve% 5 CO2 için, daha sonra kültüre edildi. Protokol bölümünde tarif edildiği gibi PIC izole edilmiştir. IVI reaksiyonlar 45 dakika süreyle 37 ° C de, her biri kullanarak resimler 200 uL hedef DNA, 600 ng (PCR ile phiX174 DNA&#39;dan amplifiye eden bir 2 kb DNA fragmanı), gerçekleştirilmiştir. Reaksiyonlar 56 ° CO / H SDS ve EDTA varlığında proteinaz K tedavisi proteinden edildi. kloroform (1: 1), reaksiyon ürünleri bir kez fenol, iki kez fenol ile ekstre edildi Karışım, bir kezkloroform ile. Daha sonra, DNA, etanol ile çökeltilmiş tuzu ve eş-çökeltme glikojen mevcudiyetinde, ve DNA topağı% 80 etanol ile bir kez yıkanmıştır. Saflaştırılmış DNA nükleaz içermeyen su, 50 uL içinde yeniden süspanse edilmiştir. Yuvalanmış qPCR stratejisi phiX174 DNA&#39;sına entegre vDNA sayısını belirlemek için kullanılmıştır. Birinci turda, geleneksel PCR olarak, phiX174 hedef DNA ve viral LTR bölgeye dizilere tamamlayıcı primerleri, entegrasyon Reaksiyonu, DNA ürünleri 5 uL entegre viral hedef DNA kavşakları amplifiye etmek için kullanılmıştır. Ikinci turda qPCR, LTR kapsayan primerler özel birinci tur amplikon ürünleri 5 uL gelen ve HIV-spesifik DNA sekanslarını büyütmek için kullanılmıştır bilinen kopya sayılarının seri seyreltileri, 10 misli (10 8 -10 0) HIV-1 molekül klonu (Standartlar). Tüm qPCR reaksiyonları üç kopya halinde gerçekleştirilmiştir ve veri wer edildiE ticari yazılımı kullanılarak analiz edildi. aykırı elde edilen değerler, entegre vDNA numaraları interpolasyon edilmiş kopya olan bir standart eğri oluşturmak için çizilmiştir. Hata çubukları standart sapmaları temsil etmektedir. Şekil 3&#39;te gösterildiği gibi, HIV-1 PIC sağlam hedef DNA (Şerit 5) içine ilgili vDNA entegre olur. Önemli olarak, PIC bölgesinin IVI verimliliği büyük ölçüde inhibitör Raltegravir (Şerit 6) ile takviye edilmiş reaksiyonlarda indirgendi. Bu güçlü HIV-1 için bu deneyde ölçüldüğü entegrasyon aktivitesi ilişkilendirir. Bundan başka, enfekte edilmemiş hücrelerden sitoplazmik lizatları içeren kontrol reaksiyonları (Şerit 1) tek başına PIC (Şerit 2), tek başına DNA (Şerit 3), hedef ve entegrasyon aktivitesi göstermedi başına (şerit 4) tampon maddesi. Buna ek olarak, ilk tur PCR, Taq polimeraz dahil kontrolü (Şerit 7) entegrasyonu ürünleri büyütmemiştir. Özellikle, PIC-alone kontrol (Lane 2) elde edilen veriler göstermektedir ki iç içe geçmiş qPCR strateji specifiCally&#39;nin entegre vDNA ancak PIC ilişkili vDNA ölçer. Topluca, bu veriler PIC ilişkili entegrasyon aktivitesinin ölçümü göstermektedir. <img alt="Şekil 1" src="/files/ftp_upload/54581/54581fig1.jpg" /> Şekil 1: HIV-1 PIC Hazırlanması için Protokol şematik temsili. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> PICS içeren sitoplazmik özler, HIV-1 ile enfekte Sup-T1 hücrelerinden izole edilmiştir. Bu PIC bölgesindeki in vitro uyum tahlilinde uyum aktivite kaynağı olarak kullanılır. <img alt="şekil 2" src="/files/ftp_upload/54581/54581fig2.jpg" /> Şekil 2: in vitro şematik olarak </e<html> m&gt;, HIV-1 PIC entegrasyonu Deneyi. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> Entegrasyon deneyleri, HIV-1 resim ve heterolog hedef phiX174 DNA kullanılarak in vitro gerçekleştirilmiştir. Entegre HIV-1 DNA, ilk tur, geleneksel PCR vDNA özgü sekanslar, tercihen, bir ikinci tur qPCR amplifiye edildiği entegrasyon kavşakları güçlendirir olup, burada, bir iç içe PCR stratejisi ile ölçülmüştür. <img alt="Şekil 3," src="/files/ftp_upload/54581/54581fig3.jpg" /> Şekil 3: HIV-1 vDNA Entegrasyon Aktivite PIC-ilişkili. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54581/54581fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> &quot;Fo: keep-together.within-PAGE =&quot; 1 &quot;&gt; entegre vDNA 10x seri dilüsyonları kullanılarak oluşturulan standart bir eğriden türetilen değerlerin konulması sureti ile tespit edilmiştir numara kopyalamak HIV-1 PIC ilişkili entegrasyon aktivitesi deneyinin Örnek sonuçlanır. bir HIV-1 moleküler klonun bilinen kopya sayısı. Tüm reaksiyonlar üç kopya halinde gerçekleştirilmiştir ve veriler ticari yazılım kullanılarak analiz edildi. Hata çubukları, standart sapmayı temsil ederler. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bileşen </td><td> Stok </td><td> 50 uL reaksiyon için final hacmi </td></tr><tr><td> phiX174 plazmit DNA </td><td> 10 ng / ml </td><td> 5,0 uL </td></tr><tr><td> GoTaq reaksiyon tamponu </td><td> 5x </td><td> 10.0 uL </td></tr><tr><td> dNTP nükleotid karışımı </td><td> 10 mm </td&gt; <td> 1.0 mL </td></tr><tr><td> phiX174-F astar </td><td> 10 uM </td><td> 2.5 uL </td></tr><tr><td> phiX174-R astar </td><td> 10 uM </td><td> 2.5 uL </td></tr><tr><td> GoTaq DNA Polimeraz </td><td> (5 U / ml) </td><td> 0.25 uL </td></tr><tr><td> Nukleazsız damıtılmış su </td><td> - </td><td> 28.75 uL </td></tr></tbody></table> Tablo 1. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> = 2 dak 95 ° C </td></tr><tr><td> Döngü 34 tekrarlar arasında: 95 ° C&#39;de 30 s = 53 ° C 30 s = = 2 dakika, 72 ° C </td></tr><tr><td> 72 ° C&#39;de 10 dakika = </td></tr><tr><td> 4 ° C = Tut </td></tr></tbody></table> Tablo 2. <table fo: keep-together.within sayfa = &quot;1&quot; fo: keep-ile-next.within-page = &quot;always&quot;&gt; <tbody><tr><td> Bileşen </td><td> Stok </td><td> 50 uL reaksiyon için final hacmi </td></tr><tr><td> IVI reaksiyon DNA ürünü </td><td> - </td><td> 5,0 uL </td></tr><tr><td> GoTaq reaksiyon tamponu </td><td> 5x </td><td> 10.0 uL </td></tr><tr><td> dNTP nükleotid karışımı </td><td> 10 mm </td><td> 1.0 mL </td></tr><tr><td> LTR astar </td><td> 10 uM </td><td> 2.5 uL </td></tr><tr><td> phiX174 astar </td><td> 10 uM </td><td> 2.5 uL </td></tr><tr><td> GoTaq DNA Polimeraz </td><td> (5 U / ml) </td><td> 0.25 uL </td></tr><tr><td> Nukleazsız damıtılmış su </td><td> - </td><td> 28.75 uL </td></tr></tbody></table> Tablo 3. <table fo:keep-together.within-page = &quot;1&quot; fo: keep-ile-next.within sayfa = &quot;always&quot;&gt; <tbody><tr><td> = 5 dak 95 ° C </td></tr><tr><td> Döngü 23 tekrarlar arasında: 94 ° C&#39;de 30 s = 55 ° C&#39;de 30 s = = 4 dakika, 72 ° C </td></tr><tr><td> 72 ° C&#39;de 10 dakika = </td></tr><tr><td> 4 ° C = Tut </td></tr></tbody></table> Tablo 4. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Bileşen </td><td> Stok </td><td> 30 uL reaksiyon için final hacmi </td></tr><tr><td> 1. yuvarlak PCR ürünleri </td><td> - </td><td> 5,0 uL </td></tr><tr><td> LTR-R astar </td><td> 10 uM </td><td> 0.9 mL </td></tr><tr><td> LTR-U astar </td><td> 10 uM </td><td> 0.9 mL </td></tr><tr> &lt;td&gt; Taqman Probe </td><td> 10 uM </td><td> 0.3 mL </td></tr><tr><td> iQ Supermix </td><td> 2 kere </td><td> 15.0 uL </td></tr><tr><td> Nukleazsız damıtılmış su </td><td> - </td><td> 7.9 mL </td></tr></tbody></table> Tablo 5. <table fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> = 3 dk 95 ° C </td></tr><tr><td> Döngü 39 tekrarlar arasında: 94 ° C 15 sn = 58 ° C&#39;de 30 s = 72 ° C&#39;de 30 s = plaka Okuma </td></tr></tbody></table> Tablo 6.

Watch this Scientific Journal Video about Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes at JoVE.com

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Ölçümü<em&gt; İn Vitro</em&gt; HIV-1 Preintegration Kompleksleri Entegrasyon Etkinliği

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

measurement-vitro-integration-activity-hiv-1-preintegration

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

7.4K Görüntüleme.  Meharry Medical College. This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy. 

Video: Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

HIV-1 tropizm genotipik Çıkarım kullanarak Nüfus tabanlı Sıralama V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

İmmünoloji ve Enfeksiyon

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

HIV-1 Çekirdek in vitro Uncoating

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Imaging of HIV-1 Envelope-induced Virological Synapse and Signaling on Synthetic Lipid Bilayers

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between CD4+ T cells involves the formation of a virological synapse (VS), which is an F-actin-dependent cell-cell junction formed upon the engagement of HIV-1 envelope gp120 on the infected cell with CD4 and the chemokine receptor (CKR) CCR5 or CXCR4 on the target cell 8. In addition to gp120 and its receptors, other membrane proteins, particularly the adhesion molecule LFA-1 and its ligands, the ICAM family, play a major role in VS formation and virus transmission as they are present on the surface of virus-infected donor cells and target cells, as well as on the envelope of HIV-1 virions1,4,5,6,7,13. VS formation is also accompanied by intracellular signaling events that are transduced as a result of gp120-engagement of its receptors. Indeed, we have recently showed that CD4+ T cell interaction with gp120 induces recruitment and phosphorylation of signaling molecules associated with the TCR signalosome including Lck, CD3&zeta;, ZAP70, LAT, SLP-76, Itk, and PLC&gamma;15.
In this article, we present a method to visualize supramolecular arrangement and membrane-proximal signaling events taking place during VS formation. We take advantage of the glass-supported planar bi-layer system as a reductionist model to represent the surface of HIV-infected cells bearing the viral envelope gp120 and the cellular adhesion molecule ICAM-1. The protocol describes general procedures for monitoring HIV-1 gp120-induced VS assembly and signal activation events that include i) bi-layer preparation and assembly in a flow cell, ii) injection of cells and immunofluorescence staining to detect intracellular signaling molecules on cells interacting with HIV-1 gp120 and ICAM-1 on bi-layers, iii) image acquisition by TIRF microscopy, and iv) data analysis. This system generates high-resolution images of VS interface beyond that achieved with the conventional cell-cell system as it allows detection of distinct clusters of individual molecular components of VS along with specific signaling molecules recruited to these sub-domains.

This article describes a method to visualize formation of an HIV-1 envelope-induced virological synapse on glass supported planar bilayers by total internal reflection fluorescence (TIRF) microscopy. The method can also be combined with immunofluorescence staining to detect activation and redistribution of signaling molecules that occur during HIV-1 envelope-induced virological synapse formation.

Görüntülemede HIV-1 Zarf bağlı Virolojik Synapse ve Sentetik Lipid Bilayers üzerine Sinyal

Human immunodeficiency virus type 1 (HIV-1) infection occurs most efficiently via cell to cell transmission2,10,11. This cell to cell transfer between ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Bir<em&gt; In vitro</emOkumak&gt; Co-enfeksiyon Modeli<em&gt; Plasmodium falciparum</emİnsan İlköğretim Monosit kökenli Bağışıklık Hücrelerde&gt;-HIV-1 Etkileşimleri

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

Bir Kısıtlama Enzim Temelli Klonlama Yöntemi değerlendirin<em&gt; In vitro</em&gt; HIV-1 Tipi C Gag-MJ4 Kimerik Virüslerin Çoğaltma Kapasitesi

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Bir Hücre temelli bir ELISA testi kullanarak, HIV-1 zarf trimerik Glikoproteinler konformasyonel Değerlendirilmesi

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

HIV-1 pozitif Bireylerin Plazma eksozomlann izolasyonu

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle (GUV) Membranes

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an essential step for virus particle formation, since a defect in Gag membrane binding results in severe impairment of viral particle production. To gain mechanistic details of Gag-lipid membrane interactions, in vitro methods based on NMR, protein footprinting, surface plasmon resonance, liposome flotation centrifugation, or fluorescence lipid bead binding have been developed thus far. However, each of these in vitro methods has its limitations. To overcome some of these limitations and provide a complementary approach to the previously established methods, we developed an in vitro assay in which interactions between HIV-1 Gag and lipid membranes take place in a &#34;cell-like&#34; environment. In this assay, Gag binding to lipid membranes is visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique. Here we describe the background and the protocols to obtain myristoylated full-length Gag proteins and GUV membranes necessary for the assay and to detect Gag-GUV binding by microscopy.

Visualization of HIV-1 Gag Binding to Giant Unilamellar Vesicle GUV Membranes

We illustrate here an in vitro membrane binding assay in which interactions between HIV-1 Gag and lipid membranes are visually analyzed using YFP-tagged Gag synthesized in a wheat germ-based in vitro translation system and GUVs prepared by an electroformation technique.

Dev ünilamellar vesikül (GUV) membranlanna bağlanan, HIV-1 Gag Görselleştirme

The structural protein of HIV-1, Pr55Gag (or Gag), binds to the plasma membrane in cells during the virus assembly process. Membrane binding of Gag is an ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Bir gen ya da ilaç terapisinde kullanım için, HIV-1 üretim yapan RNA&#39;lar etkinlik ve toksisite Değerlendirilmesi

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.