Bu araştırma, Ulusal Bilim Vakfı Hibe IOS-1025642 (GBM) tarafından desteklenmiştir. Biz ARqua1 gerginlik sağlamak için Maria Harrison teşekkür ederiz.

1. Kılavuzu RNA Tasarım ve Vektör İnşaat <ol><li> ilgi genleri hedef sekansları tanımlamak. Bu adımda 13,14 için uygun çevrimiçi CRISPR hedef bulma çeşitli programlar vardır. NOT: Burada GN 20 GG hedef motifi kullanmak, ancak diğer tasarımlar kullanılan uygulama veya vektör sistemine bağlı olarak uygun olabilir. </li><li> Tasarım 60-mer gRNA oligo DNA montaj için gerekli olan 5 ile çevrili hedef motifleri &#39;ve 3&#39; 20 nt dizileri GN 19 bölümünü kapsayacak şekilde. Son 60-mer motifi: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. NOT: Standart desalted primerler iyi çalışır. </li><li> Montaj için, dört DNA (Şekil 1) hazırlayın. DNA dizileri için ek dosyasına bakın. <ol><li> 2 saat boyunca 37 ° C&#39;de 1x Tampon 4 kısıtlama enzimi Spe I ile Cas9 10 plazmid: p201N 5 ug - 1 Digest. Bir özet Sütun arındırmaküreticinin talimatlarına şeklinizi ona göre. ~ 10 mM Tris-HCI 15 ul içinde süspanse ve UV spektrofotometre ile miktarı belirlenir. </li><li> İkinci 2 saat boyunca 25 ° C&#39;de 1x Tampon 3.1 kısıtlama enzimi Swa I ile sindirmek, bir gerçekleştirin. tam sindirim onaylamak için% 0.8 agaroz jel üzerinde ng 200 - 100 kontrol edin. NOT: Bir doğru sindirilmiş plazmid 14313 bp tek bir grup var olacaktır. Not: enzim ve defosforilasyon ısı inaktivasyonu gerekli değildir. Sindirilen plazmid, -20 ° C&#39;de saklanabilir. </li><li> PCR primerleri Swa I_MtU6F / MtU6R sırasıyla ScaffoldF / Spe I_ScaffoldR kullanılarak pUC gRNA Shuttle 10 plazmidden Medicago truncatula (M +), U6 promoteri ve iskele DNA&#39;lar yükseltmek. PCR, aşağıdaki koşullar ile yüksek aslına polimeraz kullanarak: 3 dakika için 95 ° C; 31 döngü (20 saniye 98 ° C, 15 sn için 60 ° C, 30 saniye için 72 ° C); ve 5 dakika için 72 ° C. <ol><li> PCR pr ~ 3 ul alikotları görselleştirmekbir% 1 agaroz jeli üzerinde oducts amplifikasyon teyit etmek için. MtU6 amplikon 377 bp ve iskele amplikon 106 bp. Üreticinin talimatlarına uygun olarak, kalan PCR ürünleri Kolon saflaştırmak -20 ° C&#39;de UV spektrofotometrisi ve mağaza tarafından tayin edin. </li></ol></li><li> laboratuvar dereceli su içinde 100 uM gRNA oligos tüm tüp tekrar süspansiyon. 1x Tampon 2.1 500 ul 100 uM oligo 1 ul ekle. İyice karıştırın. Birden fazla oligos havuzu varsa, 1x Tampon 2.1 tüpüne her 100 uM oligo 1 ul ekleyin. Seyreltilmiş oligo -20 ° C&#39;de saklanabilir. </li></ol></li><li> ısıtılmış kapak ile, 50 ° C de tutmak için bir termal döngü Program. bir hacme lineer vektör seyreltilmiş gRNA oligo (ler) ve su MtU6 promoteri skafoldun, 12 ng (0.2 pmol), 1 ul (0.2 umol) bir 50 ng (0.2 umol) 100 ng (0.011 umol) birleştirin 5 ul. 2x yüksek sadakat DNA montaj ustası karışımı 5 ul ekleyin iyice karıştırın ve aşağı doğru döndürün. 60 dakika boyunca reaksiyon inkübe50 ° C termal döngü. Daha sonra buz üzerinde reaksiyon yerleştirin. Not: Reaksiyon hacimleri düşük DNA verimi karşılamak için artırılabilir. </li><li> Yeterli E. halinde reaksiyon 2 ul Transform 50 mg L -1 kanamisin (Kan 50) ile takviye LB standart teknikler ve plaka kullanılarak coli hücreleri. gece boyunca 37 ° C&#39;de kaplanmıştır hücreleri büyütün. -20 ° C&#39;de, kalan DNA düzeneği reaksiyonu kaydedin. </li><li> primerler StUbi3P218R ve ISceIR kullanılarak PCR ile koloni ekranı. su ile 1 Kalan DNA düzeneği reaksiyonunun bir kısım seyreltilir: 5&#39;tir. no-insert kontrol olarak Cas9 plazmid: pozitif koloni ekranı için kontrol ve dairesel p201N 1 ng olarak 1 ul kullanın. <ol><li> PCR, aşağıdaki koşullar ile amplifiye; 3 dakika boyunca 95 ° C; 31 döngü (30 saniye için 95 ° C, 30 sn için 58 ° C, 30 saniye için 72 ° C); ve 5 dakika için 72 ° C &#39;de. bir% 1 agaroz jeli üzerinde PCR ürünleri görselleştirme. Doğru girmeler 725 bp ve vektörler zekâ bir grup olduğundan emin olun(örneğin, kesilmemiş vektör) hout ekler bir 310-bp şeridini sahip olacaktır. </li></ol></li><li> 37 ° C&#39;de 50 sıvı kültürler, gece boyunca LB Kan pozitif koloniler büyümek ve üreticinin talimatlarına uygun olarak plazmidler saflaştırılması. Sanger sekansı StUbi3P218R astar ile plazmidler ve hata klonlama esnasında katılan emin olmak için MtU6 promotörü, hedef, ve iskele dizilerine kromatogramlar hizalayın. </li><li> Bir teşhis Eco RV ve Sty I ile plazmid ~ 1 mikrogram sindirerek sindirmek gerçekleştirin % 0.8 agaroz jeli üzerinde görselleştirme. (Bp olarak) parçalarıdır: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, ve 174. </li><li> Birden fazla gRNAs ile vektörleri oluşturmak için DNA donanımını kullanın. <ol><li> İki gRNA kasetler ile bir vektör yapılandırmak için, PCR, ilgili her birinden 1 ng primer UNS1_MtU6F / Spe I_ScaffoldR olan primerler Swa I_MtU6F / UNS1_ScaffoldR ve ikinci pozisyonlar gRNA ile birinci pozisyon gRNA amplifiye1.8 - plazmidler adımlarla 1.1 inşa edilmiştir. Aşama 1.3.3 PCR koşulları kullanarak. amplifikasyon teyit etmek için bir% 1 agaroz jeli üzerinde PCR ürünlerinin ~ 3 ul alikotları görselleştirmek. Amplıkonlar ~ 500 bp. </li><li> Birleştirin ve 200 ul bir tüp içinde un saflaştırılmış PCR ürünleri, yaklaşık olarak eşit miktarda karışımı (tipik olarak 3 - her 4 ul). Montaj için, PCR ürünleri kombine 1 ul, Swa I 50 ng ekleyebilir ve Spe I p201N linearize: Cas9, laboratuvar dereceli su 2.5 ul ve 2x yüksek kalitede DNA montaj ustası karışımı 2.5 ul. 15 dakika boyunca 50 ° C termal döngüleyici içinde inkübe edin. Not: DNA montaj kılavuzları 2 için 15 dakika inkübasyon önerir - 3 fragmanları. </li><li> Yeterli E. içine 2 ul 1 - Dönüşümü LB Kan 50 koli hücreleri ve plaka. gece boyunca 37 ° C &#39;de, tabakalanmış hücrelere büyütün. -20 ° C&#39;de, kalan reaksiyon kaydedin. </li><li> Aşama 1.6 ile aynı koşullarda primerler StUbi3P218R ve ISceIR PCR ile koloni ekranı. doğru cLones 1200 bp amplikon sahip olacaktır. LB Kan olumlu koloniler 50 sıvı kültürleri bir gecede büyümek ve plazmidler arındırmak. </li><li> primerler StUbi3P218R ile Sanger dizisi plazmidler (ilk pozisyon gRNA kapsar) ve p201R (ikinci pozisyon gRNA kapsar). MtU6 promotörü, hedef, ve iskele dizilerine kromatogramlar hizalayın. Teşhis Eco RV ile sindirmek ve Sty I (bp olarak) aşağıdaki parçaları neden olur: 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. Koyu renk fragman ikinci gRNA içerir. </li></ol></li><li> Agrobacterium suşu ARqua1 15 rhizogenes içine tüm kalite kontrol beklentilerinin karşılanması sonrasında, plazmid dönüşümü. ayarları ile 1 mm küvet içinde elektro uyumlu hücre ile elektroporasyona 50 ul plazma preparatı 1 ul ekleyin: 2.4 kV, 25 | iF ve 200 w. SOC ~ 500 ul hücre yeniden elde etmek ve 2 saat boyunca 28 ° C&#39;de çalkalanır. LB Kan 50 ve g Plaka2 gün boyunca 28 ° C &#39;de sıra. 1.3.3 ile aynı primerler ve PCR koşulları kullanılarak koloni ekranını gerçekleştirin. Pozitif klonlardan gliserol stokları sağlayın. </li></ol> 2. Tüylü Kök Dönüşüm <ol><li> sabit karıştırma ile 15 dakika boyunca% 20 ev tipi ağartıcı içinde domates tohumu sterilize edin. bir laminar akış başlığı içinde, çamaşır suyu kaldırmak ve steril laboratuar dereceli suda 3 kez yıkayın. </li><li> ½ MS ortamı (2.22 g L-1, MS tuzları + Gamborg vitaminleri, 10 g L-1 sukroz, 3 g L-1 gellan zamkı, pH 5.8) ihtiva eden bir GA-7 kutu içinde levha 30 tohumları. Karanlıkta 2 ~ için gün çimlenme, daha sonra ışığa GA-7 kutularını taşıyın. ışığında ~ 4 gün daha fidan büyür. </li><li> Dönüşüm gün önce, çizgi dışarı A. Katı LB Kan 50 kültürleri rhizogenes ve gece boyunca 28 ° C&#39;de büyür. </li><li> dönüşümün Günü, laminer akış kaputu steril malzemeler monte: 12 ml kültür tüpleri, 50 ml konik tüp, ½ MS sıvı (yok gellan gum), 200 uM asetosiringon, filtre kağıdı, petri, forseps ve neşter, pipetler ve pipet uçları. ½ MS 50 ml asetosiringon 25 ul ilave edin ve her kültür tüpü içine ~ 6 mL dökün. </li><li> A. kazımak için bir bükülmüş 200 ul ucu kullanın ½ MS sıvının 6 ml plaka ve tekrar süspansiyon ile ilgili rhizogenes hücreleri. Vortex tüpü tamamen hücreleri tekrar süspansiyon. Her bir vektör hücrelerin tekrar asılı tutulmasından sonra, 600 nM&#39;lik bir sabit dalga uzunluğunda hücre 1 ml optik yoğunluk (OD) ölçün. OD 0.2 ve 0.4 arasında olmasını sağlayın; sulandırmak veya gerektiği gibi daha fazla hücre ekleyin. Her bir yapı için tekrarlayın. </li><li> steril bir filtre kağıdı ile bir Petri kabı ½ MS sıvı ~ 2 ml ekleyin. nemlendirilmiş filtre kağıdı üzerinde fide ve yerden tüketim kotiledon. Bir kez tüm kotiledon toplanmıştır, iki kesim uçları ile kotiledon parçaları sonuçlanan kotiledon kapalı distal ~ 1 cm kesti. A. eksplantlar ekle rhizogenes çözeltiler, karıştırın ve 20 dakika boyunca inkübeara sıra invertli. Not: yapı için yaklaşık 12 eksplant rutin kullanılan, çok sayıda 80 eksplantlar A. 6 ml aşılanmış olsa rhizogenes çözüm. </li><li> A. sırasında rhizogenes inkübasyon, Petri için filtre kağıdı eklemek, bir başına yapı dönüştürdü. Ayrıca kuru laminer akış kaputu, ½ MS katı ortam, hiçbir antibiyotik ayarlayın. </li><li> A. dışarı kotiledon Scoop Kuru filtre kağıdı üzerinde steril forseps ve yer ile rhizogenes çözüm. Bir sonraki dönüşüm ilerlerken kurumasına yok dokuları sağlamak için Petri kapakla kapatın. Filtre kağıdı ve transferi, alt yüzey tarafında yukarı, üzerinde Blot kotiledon MS ortamı ½. ameliyat bandı ile plakaları sarın 2 gün oda sıcaklığında karanlıkta CO-geliştirin. </li><li> Kadar ko-kültivasyonu, transfer kotiledonlar, alt yüzey tarafında sonra, MS ortamı (300 mg L-1 tikarsilin / klavulanik asit Tim 300 takviye ½ artık kısmından gelişmesini önlemek içinual A. rhizogenes) ve bitki seçimi için Kan 50 () ve cerrahi bant ile sarın. 16 saat fotoperiyodun oda sıcaklığında floresan ışıkları altında kültürleri korumak. </li><li> Uzunluğu 2 hafta kökleri en az 2 cm, steril forseps ve bir neşter kullanarak kotiledonlar kesilmiş ve MS Kan 50 Tim 300 ortamı ½ aktarılır - ~ 1.5 sonra. Tek bir plaka 10 ila 15 kökleri aktarın. Bir işaretleyici ile kök uçları konumunu işaretlemek cerrahi bant ile sarın ve kültür odasında korumak. </li><li> Bir hafta sonra, dönüştürülmüş kök seçici ortam üzerinde büyüme görülür. Tercih DNA ekstraksiyon yöntemi kullanılarak DNA ekstraksiyonu için dönüştürülmüş köklerinin altörneğini hasat. Not: kotiledon ile Tabaklar 2 saklanabilir - kökleri karışık karmaşa içine büyümeye işaret ve izole etmek zordur, bundan sonra 3 haftalık hasat. Sigara hasat kök dokuları süresiz muhafaza edilebilir. birçok analiz izole edilmiş bir DNA örneği üzerinde gerçekleştirilebilirs DNA mutasyon sıklığı ve türünü belirlemek için. Birkaç tür deneylerde elde edilen sonuçlar aşağıda tarif edilmiştir. </li></ol>

<ol><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li>
<li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li>
<li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+screening+of+a+CRISPR%2FCas9+library+for+functional+genomics+in+human+cells%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li>
<li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+new+frontier+of+genome+engineering+with+CRISPR-Cas9%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li>
<li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Editing+plant+genomes+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22Current+Opinion+in+Biotechnology%22%5BJournal%5D)">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li>
<li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+CRISPR%2FCas9+system+for+plant+genome+editing+and+beyond%5BTitle%5D)+AND+%22Biotechnology+Advances%22%5BJournal%5D)">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li>
<li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+genome+editing+of+sweet+orange+using+Cas9%2FsgRNA%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li>
<li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat%5BTitle%5D)+AND+%22G3-Genes+Genomes+Genetics%22%5BJournal%5D)">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li>
<li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model%5BTitle%5D)+AND+%22Plant+Physiology%22%5BJournal%5D)">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li>
<li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+genome+modifications+in+soybean+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22BMC+Biotechnology%22%5BJournal%5D)">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li>
<li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemical+synthesis+of+the+mouse+mitochondrial+genome%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li>
<li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate%3ACoA+ligase+specificity+and+redundancy%5BTitle%5D)+AND+%22New+Phytologist%22%5BJournal%5D)">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li>
<li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CCTop%3A+An+Intuitive%2C+Flexible+and+Reliable+CRISPR%2FCas9+Target+Prediction+Tool%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li>
<li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-P%3A+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants%5BTitle%5D)+AND+%22Molecular+Plant%22%5BJournal%5D)">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li>
<li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%22%5BJournal%5D)">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li>
<li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR%2FCas9+system%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li>
<li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Plant+genome+editing+made+easy%3A+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR%2FCas+system%5BTitle%5D)+AND+%22Plant+Methods%22%5BJournal%5D)">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39(2013).</li>
<li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+genome+engineering+using+CRISPR%2FCas+systems%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li>
<li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9%5BTitle%5D)+AND+%22Nat+Biotech%22%5BJournal%5D)">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li>
<li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li>
<li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li>
<li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+multiplicity+of+hairy+root+cultures%3A+Prolific+possibilities%5BTitle%5D)+AND+%22Plant+Science%22%5BJournal%5D)">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li>
<li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.%3A+sexual+transmission+of+the+transformed+genotype+and+phenotype%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li>
<li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Misexpression+of+miR482%2C+miR1512%2C+and+miR1515+Increases+Soybean+Nodulation%5BTitle%5D)+AND+%22Plant+Physiology%22%5BJournal%5D)">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li>
<li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%22%5BJournal%5D)">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li>
<li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ex+vitro.+composite+plants%3A+an+inexpensive%2C+rapid+method+for+root+biology%5BTitle%5D)+AND+%22Plant+Journal%22%5BJournal%5D)">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li>
</ol>

Yazarlar ifşa hiçbir şey yok.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single, one-hour reaction and gRNA oligos can be pooled to further streamline the cloning procedure. Furthermore, the DNA assembly mechanism is independent of restriction enzymes, which makes this method compatible with virtually any DNA sequence. Conveniently, a master mix of the invariable DNA components (linearized vector, MtU6 promoter, and scaffold) can be made and stored at -20 &#176;C for later assemblies. 
While we use the GN20GG gRNA target motif, there are several alternative gRNA target motifs that can be used17. Shorter gRNAs have been demonstrated to increase specificity in animal cells20. By using a 5' G with a U6 promoter in the gRNA sequence (or A in the case of a U3 promoter), regardless if it matches the intended target sequence, the more abundant target motif N21GG may be used. However, the GN20GG target motif does not present a major technical limitation as several suitable targets can be found in most plant genes. The cloning scheme presented here can be easily modified to accommodate any gRNA design; simply substitute bases in the gRNA oligo.
Another advantage of the DNA assembly cloning system is that the same reagents can be used to insert multiple gRNAs into a single vector. A protocol for two gRNAs is presented here, and with the same methodology, using unique nucleotide sequences21 as spacers between gRNAs, it should be possible to assemble six gRNAs or more in a single cloning reaction.
As presented in step 1.9, the sequential cloning of gRNA vectors into a final multi-gRNA vector will take several days to perform because of the multiple cloning and screening steps. A modification of this protocol permits the construction of multi-gRNA vectors in a single day by bypassing the single-gRNA vector cloning step. First assemble individual gRNAs with just the MtU6 amplicon, gRNA oligo, and scaffold amplicon. Individual reactions must be performed for each gRNA. Following step 1.4, omit the linearized vector and reduce the 50 &#176;C incubation to 15 minutes. A 1:5 dilution of the reactions can be used as template in step 1.9.1. 
A potential problem with step 1.9 is the carry-over of residual single-gRNA plasmids from the PCR amplification of the gRNAs since all plasmids are selected with kanamycin. While we have never observed single-gRNA vectors in any of our colony screens following the specified protocol, gel purification of the PCR products or DpnI treatment of the PCR reactions could be used should the problem occur.
The ability to generate CRISPR vectors in a high-throughput manner necessitates a high-throughput method of generating transgenic materials to use the CRISPR vectors. Hairy roots are well suited for this task as they are technically simple to generate, require relatively little laboratory space to maintain and can be produced in a wide range of plant species22,23. However one limitation is that hairy roots are generally not used to generate whole plants and root systems are not suitable models for investigating most above-ground phenotypes. The former limitation may be advantageous when targeting genes that are null-lethal in whole-plant systems.
An important consideration for any transformation experiment is that results may vary with the different genotypes of plants and bacterial strains used. We routinely induce hairy roots in the cultivar (cv.) Rio Grande but have had difficulty obtaining hairy roots with cv. Moneymaker. Here, we report the use of the A. rhizogenes strain ARqua1, but it should be noted that strain ATCC 15834 has also been reported to work in tomato9.
Another critical consideration for hairy root transformation is the potential for overgrowth of A. rhizogenes on the cotyledon explants. Bacterial overgrowth typically leads to cotyledon death and low transformation efficiencies. Cotyledons must be blotted dry after soaking with A. rhizogenes. Likewise, co-cultivation should be limited to two days to prevent excessive bacterial overgrowth. Some bacterial growth is typically observed on co-cultivation plates, but should be absent once cotyledons are transferred to media containing ticarcillin/clavulanic acid.
The ease of constructing CRISPR vectors and generating hairy roots enables large-scale reverse-genetic screens, similar to those that are used in animal cell culture systems2. Hairy roots have been used to study a variety of plant functions including root development9, symbiotic associations24,25, and nematode resistance26 and the use of hairy roots for screening immunity-related genes is an area of active research in our lab. In addition to overexpression, gene silencing, and other transgenic technologies, targeted gene deletion via CRISPR/Cas9 is a powerful tool for functional genomic studies.

CRISPR ile hedeflenen DNA değişiklikleri oluşturmak için yeteneği / Cas9 işlevsel genomik çalışmalar için büyük bir potansiyele sahiptir. CRISPR / Cas9 sisteminin iki bileşeni vardır; Staphylococcus pyogenes ve hedefli DNA ekibi (s, 1) Cas9 yönlendiren bir yaklaşık 100 nt kılavuz RNA (gRNA) molekülünden türetilen Cas9 nükleaz. Hedef tanıma, ilk olarak haiz ~ hedefleme vektörleri 2,3 yüksek kapasiteli bir üretim sağlayan gRNA, 20-nt. Tasarlanmış olabilir Çoğu organizmalar, zaten CRISPR / Cas9 teknolojisi 4,5 ile olmuştur. Bitkiler, CaMV 35S promotörü gibi yapısal promotörler, in, genel olarak Cas9 nükleaz 6 ekspresyonunu tahrik etmek için kullanılır. gRNAs gRNA ilk taban kısıtlayan RNA polimeraz III U6 ya da U3 promoterler kullanılarak ifade edilir ya G, verimli bir transkripsiyon için U3 U6 veya A için. Ancak RNA polimeraz II baloBu kısıtlamaların ücretsiz oters, aynı zamanda 7,8 kullanılmıştır. Farklı gRNAs farklı verimlilik ile DNA mutasyonlarının neden, ve bu yüzden ilk olarak tüm fabrika dönüşümleri yatırım veya kapsamlı fenotipik ekranlar kurmadan önce CRISPR vektörleri doğrulamak için önemli olabilir. CRISPR geçici ifadesi zordur mutasyonlar ve bu yaklaşımlar ile pratik fenotipik deneylerinin algılama hale stabil bitkilerde 6 ile karşılaştırıldığında, genel olarak, DNA modifikasyon daha düşük bir frekans ile sonuçlanır örneğin agroinfiltration kullanarak, bitkilerde oluşturur. Sözde saçak kökler stabil bitkiler için ay karşı bağımsız kararlı bir şekilde transforme edilmiş bir malzeme çok sayıda hafta içinde oluşturulabilir çünkü uygun, alternatif sistem vardır. CRISPR vektörleri saçak kök 9,10 DNA mutasyonlarının uyaran çok etkilidir. DNA montaj yöntemleri etkin bir şekilde overl içeren DNA parçalarını birbirine bağlamakapping 11 sona erer. Bazı DNA düzeneği yöntemlerinin önemli bir avantajı birleştirilmiş ürünler haline ssDNA (yani, oligolar) dahil yeteneğidir. gRNAs yalnızca ~ 20 nt uzunluğunda ve yeni hedefler sentezlenen oligo yapılabilir için, bu DNA montaj yöntemleri CRISPR klonlama için de uygundur. Burada anlatılan protokollerin başarılı soya 10, kavak 12 kullanılan ve şu anda domates edilmiş CRISPR vektörlerinin P201 serisi dayanmaktadır. Sunulan klonlama işlemi geçerli klonlama yöntemiyle 10 üzerinde çeşitli avantajlar sunuyor. Yani, tam fonksiyonel vektörler tek bir gün içinde tek bir klonlama reaksiyonda oluşturulabilir. Vektör yapımı daha da eller üzerinde zaman ve malzeme maliyetleri azaltarak, paralel olarak birden fazla CRISPR vektörleri oluşturmak için toplanmış olabilir. Ayrıca hedef gen delesyonlu transjenik malzemeler üretmek için etkili bir yöntem olarak, domates saçak kök oluşumu için bir protokol mevcut. Saçak kök geçerlidir için kullanılırCRISPR vektörleri yedik ve daha sonraki deneyler için malzeme sağlamak.

<table><tbody><tr><td>NEBuilder&amp;reg; (HiFi DNA assembly mix)</td><td>New England Biolabs</td><td>E5520</td><td></td></tr><tr><td>p201N:Cas9</td><td>Addgene</td><td>59175</td><td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td></tr><tr><td>pUC gRNA Shuttle</td><td>Addgene</td><td>47024</td><td></td></tr><tr><td>&lt;em&gt;Swa&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0604S</td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>Zymo clean and concentrator-5 column purification</td><td>Zymo Research</td><td>D4003</td><td></td></tr><tr><td>NEB Buffer 2.1</td><td>New England Biolabs</td><td>B7202S</td><td></td></tr><tr><td>NEB CutSmart (Buffer 4)</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>NEB Buffer 3.1</td><td>New England Biolabs</td><td>B7203S</td><td></td></tr><tr><td>EconoSpin Mini Spin Column (plasmid prep)</td><td>Epoch Life Sciences</td><td>1910-050/250</td><td></td></tr><tr><td>EcoRV-HF&amp;reg;</td><td>New England Biolabs</td><td>R3195S</td><td></td></tr><tr><td>StyI-HF&amp;reg;</td><td>New England Biolabs</td><td>R3500S</td><td></td></tr><tr><td>MS Salts + Gamborg Vitamins</td><td>Phytotechnology Laboratories</td><td>M404</td><td></td></tr><tr><td>Phytagel&amp;trade; (gellan gum)</td><td>Sigma Aldrich</td><td>P8169</td><td></td></tr><tr><td>GA-7 Boxes</td><td>Sigma Aldrich</td><td>V8505</td><td></td></tr><tr><td>Micropore&amp;trade; surgical tape</td><td>3M</td><td>1535-0</td><td></td></tr><tr><td>Timentin&amp;reg; (Ticarcillin/Clavulanic acid)</td><td>Various</td><td>0029-6571-26</td><td></td></tr><tr><td>Primers 5&#039; &amp;#8594; 3&#039;</td><td></td><td></td><td></td></tr><tr><td>SwaI_MtU6F&amp;nbsp;</td><td>&lt;strong&gt;GATATTAATCTCTTCGATGA&lt;br/&gt;AATTT&lt;/strong&gt;ATGCCTATCTTATAT&lt;br/&gt;GATCAATGAGG</td><td></td><td></td></tr><tr><td>MtU6R&amp;nbsp;&amp;nbsp;</td><td>AAGCCTACTGGTTCGCTTG&lt;br/&gt;AAG</td><td></td><td></td></tr><tr><td>ScaffoldF&amp;nbsp;</td><td>GTTTTAGAGCTAGAAATAGC&lt;br/&gt;AAGTT</td><td></td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I_Scaffold R</td><td>&lt;strong&gt;GTCATGAATTGTAATACGACTC&lt;br/&gt;A&lt;/strong&gt;AAAAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>StUbi3P218R&amp;nbsp;</td><td>ACATGCACCTAATTTCACTA&lt;br/&gt;GATGT</td><td></td><td></td></tr><tr><td>ISceIR</td><td>GTGATCGATTACCCTGTTAT&lt;br/&gt;CCCTAG</td><td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td><td></td></tr><tr><td>UNS1_Scaffold R&amp;nbsp;</td><td>GAGAATGGATGCGAGTAATGAA&lt;br/&gt;AAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>UNS1_MtU6 F&amp;nbsp;&amp;nbsp;</td><td>CATTACTCGCATCCATTCTCAT&lt;br/&gt;GCCTATCTTATATGATCAATGAGG</td><td></td><td></td></tr><tr><td>p201R&amp;nbsp;</td><td>CGCGCCGAATTCTAGTGATCG</td><td></td><td></td></tr><tr><td>Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td><td></td><td></td><td></td></tr></tbody></table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

DNA, montaj ile CRISPR vektör oluşturulması, tipik olarak, bağımsız klondan On ila yüzlerce oluşturur. PCR ile koloni taraması kolayca doğru klonlar tanımlar ve ve sorun giderme için kullanışlıdır ekler (Şekil 2A) olmadan plazmidler ayırt edebilirsiniz. Tipik olarak, klonların hepsi bir ek içeren ve bir kullanıcı tamamen koloni tarama adımlarını atlamak için tercih edebilir. Teşhis dijestleri (Şekil 2B) ve Sanger dizileme kalite kontrolü için kullanılır. Hataları ortaya ne zaman, genellikle, üst üste DNA bölgelerinde gözlenir, yani 5 &#39;MtU6 promotör sonu, gRNA veya 3&#39; iskele dizisinin sonu. Birden gRNA oligo tek bir reaksiyon olarak bir araya getirilmiş ise, gRNAs Sanger dizileme ile tespit edilir. Bireysel gRNAs eklenmesi eşit bir şekilde dağıtılır ve gRNAs en (Şekil 2C, bir tek dönüştürme izole edilebilir </strong&gt;). Yüksek sadakat DNA montaj karışımı yüksek sadakat versiyonu gibi standart DNA montaj karışımı tercih edilir daha az hata eğilimli (Şekil 2C) &#39;dir. Domates saçak kökler genelde dönüşüm (Şekil 3A) sonra, iki hafta içinde bir tane gözlenir. Uzunluğu kökleri ≥2 cm kesilir ve seçici ortam ve kanamisine dirençli kökleri bir hafta sonra (Şekil 3B) tespit edilebilir aktarılır. Çoğu kökleri seçici medya ve değişken olabilir dönüştürülmüş kökleri, kök büyümesi üzerine bir dereceye kadar artacak; Mümkünse, analiz için en güçlü büyüyen kökleri seçin. İki kanamisin dirençli köklerine biri tipik aşılanmış kotiledon başına geri kazanılır. Düzenli transferleri ile dönüştürülmüş kökleri seçici ortam üzerinde süresiz muhafaza edilebilir. DNA, kanamisine dirençli köklerinden ekstre edilir ve PCR Amplif için kullanılany hedef bölge (ler). PCR ürünleri, klonlanması ve sekanslanması (Şekil 3C), sınırlı parça uzunluk polimorfizm analizi, poliakrilamid jel elektroforezi 16 (Şekil 3D), T7E1 endonükleaz 16 ya da yüksek verimli bir amplikon sıralama gibi mutasyon verimi belirlemek için bir çok analizde kullanılabilir 10. Seçilen gRNA / hedef dizinin bağlı, diğer CRISPR bitki sistemlerinde 6 bildirildiği gibi, mutasyonlar ve mutasyon verimliliği bir dizi görülebilir. <img alt="Şekil 1" src="/files/ftp_upload/53843/53843fig1.jpg" /> . CRISPR Meclisi Şekil 1. İlke DNA montaj tepki olarak, dört DNA&#39;lar karıştırılır; p201N: Swa I ve Spe I (siyah daire), MtU6 organizatörü (yeşil ok), İskele (sarı çubuk) ve GN 19 hedef dizisini içeren 60-mer gRNA oligo (b Cas9 doğrusallaştırılmışlue bar). Her bir DNA molekülünün ucu bitişik parçası ile 20 bp örtüşmektedir. DNA montaj reaksiyonu tek bir dairesel molekülün içine bu DNA&#39;lar birleşir. bağlayıcı siteleri StUbi3p218R ve ISceIR astar siyah oklarla gösterilmiştir, 2x35S: Cas9 kaset, mor StUbi3: nptll kaset turuncu ve sol ve sağ sınırları gri çubuklarla gösterilir. Not: Vector. Harita ölçekli değildir <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig1large.jpg" target="_blank">bu rakamın daha büyük bir versiyonunu görmek için lütfen buraya tıklayınız.</a> <img alt="şekil 2" src="/files/ftp_upload/53843/53843fig2.jpg" /> Şekil 2. Koloni Tarama ve DNA montaj ve dönüşüm 20 klonların plazmid Kalite Kontrolü. A) Koloni taraması. M, 100-bp merdiven; + P201N: Cas9: GFPT2 pozitif kontrol; NI, p201N: Cas9 no-insert kontrolü; GA, seyreltilmiş DNA tertibatı, reaksiyon; NT, hiçbir şablon kontrolü. B) Dört p201N Temsilcisi özeti: Cas9: kısıtlama gRNA vektörleri Eko RV ve Sty I. enzimleri M, 2-log merdiven. C) standart ve yüksek kalitede DNA montaj karışımları ve 11 gRNA oligos tek bir reaksiyona araya toplanmış kurtarılan vektörlerin dağıtım sadakat karşılaştırılması. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> <img alt="Şekil 3," src="/files/ftp_upload/53843/53843fig3.jpg" /> Şekil 3. Tüylü Kök Kültürleri ve DNA Modifikasyon tespiti. A) Tüylü kökleri 11 gün sonra dönüşüm. B kotiledon çıkan görülebilir) Kökler yaklaşık bir hafta boyunca ½ MS Kan 50 medya üzerinde seçilir. Gri çubuklar klonlama Örneği) kaplama. C anda kök uçları konumunu göstermek vesıralama dört farklı kıllı kök olayları iki farklı gen hedefleri olan DNA mutasyonlarının belirlenmesi. Gri kutusu Δ mutasyon tipini ve DNA mutasyonlarının belirlemek için gösterilen mutasyon d.) Poliakrilamid jeli elektroforezi örneği ile klon numarasını gösterir, GN 20 GG hedef sekans anlamına gelmektedir. Geniş silme ve hetero grupları hedef dizilerinin DNA mutasyonlarının mevcudiyetini göstermektedir. 12 bağımsız olaylar Altı mutantlar (ö) olarak skorlanmıştır. WT, vahşi tipli kontrol; NT, no-şablon kontrolü. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig3large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Domates Tüylü Roots Üretimi ile yüksek verim CRISPR Vektör İnşaat ve DNA Değişiklikler Karakterizasyonu

DNA, düzeneğini kullanarak çok CRISPR vektörleri CRISPR çok sayıda yapı yapım tek klonlama reaksiyonda paralel yapılabilir basit bir işlem vektörleri. Domates kıllı kökleri CRISPR vektörleri doğrulamak ve mutant malzemeleri üretmek için mükemmel bir model sistem.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Nanyang Technological University

Research

JoVE Journal

Biology

17.9K Görüntüleme.  Boyce Thompson Institute for Plant Research.  DNA, düzeneğini kullanarak çok CRISPR vektörleri CRISPR çok sayıda yapı yapım tek klonlama reaksiyonda paralel yapılabilir basit bir işlem vektörleri. Domates kıllı kökleri CRISPR vektörleri doğrulamak ve mutant malzemeleri üretmek için mükemmel bir model sistem. 

Video: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to possess medicinally relevant biological activity. However, thus far this potential has not translated into a plethora of triterpene-derived drugs in the clinic. This is arguably (at least partially) a consequence of limited practical synthetic access to this class of compound, a problem that can stifle the exploration of structure-activity relationships and development of lead candidates by traditional medicinal chemistry workflows. Despite their immense diversity, triterpenes are all derived from a single linear precursor, 2,3-oxidosqualene. Transient heterologous expression of biosynthetic enzymes in N. benthamiana can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products that are not naturally produced by this host. Agro-infiltration is an efficient and simple means of achieving transient expression in N. benthamiana. The process involves infiltration of plant leaves with a suspension of Agrobacterium tumefaciens carrying the expression construct(s) of interest. Co-infiltration of an additional A. tumefaciens strain carrying an expression construct encoding an enzyme that boosts precursor supply significantly increases yields. After a period of five days, the infiltrated leaf material can be harvested and processed to extract and isolate the resulting triterpene product(s). This is a process that is linearly and reliably scalable, simply by increasing the number of plants used in the experiment. Herein is described a protocol for rapid preparative-scale production of triterpenes utilizing this plant-based platform. The protocol utilizes an easily replicable vacuum infiltration apparatus, which allows the simultaneous infiltration of up to four plants, enabling batch-wise infiltration of hundreds of plants in a short period of time.

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Transient heterologous expression of biosynthetic enzymes in Nicotiana benthamiana leaves can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products. Herein is described a detailed protocol for rapid (5 days) preparative-scale production of triterpenes and analogs utilizing this powerful plant-based platform.

Partiye Hazırlık bir ölçekte triterpen üretim için geçici Nicotiana Benthamiana ifadede bırakır

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to ...

Biyokimya

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

Bakteriyel Solgunluk Hastalığının Basit Genetik Analizi için Ralstonia Solanacearum ile Aşılama Takip Domates Kökü Dönüşümü

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Genetik

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant secondary metabolites such as flavonoids, especially rutin. Agrobacterium rhizogenes have been gradually used worldwide to induce hairy roots in medicinal plants to investigate gene functions and increase the yield of secondary metabolites. In this study, we have described a detailed method to generate A. rhizogenes-mediated hairy roots in TB. Cotyledons and hypocotyledonary axis at 7&#8211;10 days were selected as explants and infected with A. rhizogenes carrying a binary vector, which induced adventitious hairy roots that appeared after 1 week. The generated hairy root transformation was identified based on morphology, resistance selection (kanamycin), and reporter gene expression (green fluorescent protein). Subsequently, the transformed hairy roots were self-propagated as required. Meanwhile, a myeloblastosis (MYB) transcription factor, FtMYB116, was transformed into the TB genome using the A. rhizogenes-mediated hairy roots to verify the role of FtMYB116 in synthesizing flavonoids. The results showed that the expression of flavonoid-related genes and the yield of flavonoid compounds (rutin and quercetin) were significantly (p &#60; 0.01) promoted by FtMYB116, indicating that A. rhizogenes-mediated hairy roots can be used as an effective alternative tool to investigate gene functions and the production of secondary metabolites. The detailed step-by-step protocol described in this study for generating hairy roots can be adopted for any genetic transformation or other medicinal plants after adjustment.

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat Fagopyrum tataricum

We describe a method of inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in Tartary buckwheat (Fagopyrum tataricum). This can be used to investigate gene functions and production of secondary metabolites in Tartary buckwheat, be adopted for any genetic transformation, or used for other medicinal plants after improvement.

Agrobacterium rhizogenestarafından Kıllı Kökleri Indükleyen -Tartary Karabuğday Aracılı Dönüşüm (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

<meta charset="utf8"></head><body>Verimli kök transgenik sistemini aydınlatmak için CcCIPK14 gen fonksiyon analizi

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

CcCIPK14 Serisi Verimli kök transgenik sistemini aydınlatmak için gen fonksiyon analizi

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

CRISPRmass Kullanan Yüksek Verimli UAS-cDNA/ORF Plazmid Kitaplığı Yapısı

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

Yazar Spotlight: CRISPRmass Kullanarak Genom Çapında Plazmid Kütüphanesi Yapımını Basitleştirme

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

UAS-cDNA/ORF plazmit kütüphanesinin yüksek verimli yapısı için CRISPR tabanlı modüler montaj

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the CRISPR-Cas systems and their natural inhibitors-the anti-CRISPR proteins (Acrs)-provides a new tool to design and implement in vivo gene digital circuits. Here, we describe a protocol that follows the idea of the "Design-Build-Test-Learn" biological engineering cycle and makes use of dCas9/dCas12a together with their corresponding Acrs to establish small transcriptional networks, some of which behave like Boolean gates, in Saccharomyces cerevisiae. These results point out the properties of dCas9/dCas12a as transcription factors. In particular, to achieve maximal activation of gene expression, dSpCas9 needs to interact with an engineered scaffold RNA that collects multiple copies of the VP64 activation domain (AD). In contrast, dCas12a shall be fused, at the C terminus, with the strong VP64-p65-Rta (VPR) AD. Furthermore, the activity of both Cas proteins is not enhanced by increasing the amount of sgRNA/crRNA in the cell. This article also explains how to build Boolean gates based on the CRISPR-dCas-Acr interaction. The AcrIIA4 fused hormone-binding domain of the human estrogen receptor is the core of a NOT gate responsive to &#946;-estradiol, whereas AcrVAs synthesized by the inducible GAL1 promoter permits to mimic both YES and NOT gates with galactose as an input. In the latter circuits, AcrVA5, together with dLbCas12a, showed the best logic behavior.

CRISPR-Cas systems and anti-CRISPR proteins were integrated into the scheme of Boolean gates in Saccharomyces cerevisiae. The new small logic circuits showed good performance and deepened the understanding of both dCas9/dCas12a-based transcription factors and the properties of anti-CRISPR proteins.

CRISPR-Cas Sistemlerine ve Anti-CRISPR Proteinlerine Dayalı Gen Dijital Devreleri

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the ...

Biyomühendislik

Transgenik Soya Fasulyesi Tüylü Köklerinin Yüksek Verimli Üretimi

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

Yazar Spotlight: Gen Fonksiyonunun Analizi için Soya Fasulyesi Tüylü Kök Dönüşümü  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

Gen fonksiyonunun analizi için soya fasulyesi tüylü kök transformasyonu

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

Domates Tüylü Roots Üretimi ile yüksek verim CRISPR Vektör İnşaat ve DNA Değişiklikler Karakterizasyonu

Özet

Daha Fazla Video Keşfet

Partiye Hazırlık bir ölçekte triterpen üretim için geçici Nicotiana Benthamiana ifadede bırakır

Bakteriyel Solgunluk Hastalığının Basit Genetik Analizi için Ralstonia Solanacearum ile Aşılama Takip Domates Kökü Dönüşümü

Agrobacterium rhizogenestarafından Kıllı Kökleri Indükleyen -Tartary Karabuğday Aracılı Dönüşüm (Fagopyrum tataricum)

CcCIPK14 Serisi Verimli kök transgenik sistemini aydınlatmak için gen fonksiyon analizi

CcCIPK14 Serisi Verimli kök transgenik sistemini aydınlatmak için gen fonksiyon analizi

UAS-cDNA/ORF plazmit kütüphanesinin yüksek verimli yapısı için CRISPR tabanlı modüler montaj

UAS-cDNA/ORF plazmit kütüphanesinin yüksek verimli yapısı için CRISPR tabanlı modüler montaj

UAS-cDNA/ORF plazmit kütüphanesinin yüksek verimli yapısı için CRISPR tabanlı modüler montaj

CRISPR-Cas Sistemlerine ve Anti-CRISPR Proteinlerine Dayalı Gen Dijital Devreleri

Gen fonksiyonunun analizi için soya fasulyesi tüylü kök transformasyonu