Questa ricerca è stata sostenuta dalla National Science Foundation concessione IOS-1.025.642 (GBM). Ringraziamo Maria Harrison per fornire il ceppo ARqua1.

1. Guida RNA Progettazione e Costruzione di vettore <ol><li> Identificare sequenze bersaglio per i geni di interesse. Ci sono una varietà di programmi di destinazione conoscitiva CRISPR in linea adatte per questo passo 13,14. NOTA: Qui usiamo il GG motivo bersaglio GN 20, ma altri disegni possono essere adatti a seconda del sistema di applicazione o il vettore utilizzato. </li><li> Progettazione 60-mer oligonucleotidi gRNA per includere la porzione GN 19 dei motivi di destinazione affiancato da 5 &#39;e 3&#39; sequenze di 20-nt che sono necessari per il montaggio del DNA. Il motivo finale 60-mer è: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. NOTA: Standard, primer dissalati funzionano bene. </li><li> Preparare i quattro DNA per il montaggio (Figura 1). Vedere file supplementare per sequenze di DNA. <ol><li> Digest: 1 - 5 mg di p201N: Cas9 10 plasmide con l&#39;enzima di restrizione Spe I in 1x tampone 4 a 37 ° C per 2 ore. Colonna-purificare il digest unecondo le istruzioni del produttore. Risospendere in ~ 15 ml di 10 mM Tris-HCl, e quantificare mediante spettrofotometria UV. </li><li> Eseguire una seconda digerire con l&#39;enzima di restrizione SWA I in 1x tampone 3.1 a 25 ° C per 2 ore. Controllo di 100 - 200 ng su un gel di agarosio 0,8% per confermare completa digestione. NOTA: Un plasmide correttamente digerito avrà una singola banda a 14.313 bp. Nota: inattivazione termica dell&#39;enzima e defosforilazione non sono richiesti. plasmide digerito può essere conservato a -20 ° C. </li><li> PCR amplifica il truncatula Medicago (Mt) U6 promotore e impalcature DNA dal PUC gRNA navetta 10 plasmide utilizzando i primer Swa I_MtU6F / MtU6R e ScaffoldF / Spe I_ScaffoldR, rispettivamente. Utilizzare una polimerasi ad alta fedeltà con le condizioni di PCR: 95 ° C per 3 min; 31 cicli (98 ° C per 20 sec, 60 ° C per 15 sec, 72 ° C per 30 sec); e 72 ° C per 5 min. <ol><li> Visualizza ~ 3 aliquote microlitri di PCR products su un gel di agarosio 1% per confermare l&#39;amplificazione. L&#39;amplicone MtU6 è 377 bp e l&#39;amplicone patibolo è di 106 bp. Colonna-purificare i restanti prodotti di PCR in base alle istruzioni del produttore, quantificare mediante spettrofotometria UV e conservare a -20 ° C. </li></ol></li><li> Risospendere l&#39;intero tubetto di oligonucleotidi gRNA a 100 micron di acqua di laboratorio di grado. Aggiungere 1 ml di 100 mM oligo a 500 ml di 1x tampone 2.1. Mescolare bene. Se il pool più oligonucleotidi, aggiungere 1 ml di ogni oligo 100 micron al 2,1 tubo 1x tampone. oligo diluiti possono essere conservati a -20 ° C. </li></ol></li><li> Programmare un termociclatore di tenere a 50 ° C, utilizzando un coperchio riscaldato. Combinare 100 ng (0,011 pmol) del vettore linearizzato, 50 ng (0,2 pmol) di MtU6 promoter, 12 ng (0,2 pmol) dell&#39;impalcatura, 1 ml (0,2 pmol) di diluito oligo gRNA (s), e acqua ad un volume di 5 ml. Aggiungere 5 ml di 2x ad alta fedeltà assemblaggio DNA master mix, mescolare bene e spin down. Incubare la reazione per 60 min in50 ° C termociclatore. Poi posizionare la reazione in ghiaccio. Nota: i volumi di reazione può essere aumentata per ospitare basse rese di DNA. </li><li> Trasforma 2 ml di reazione in E. competente coli cellule utilizzando tecniche standard e piastra su LB integrato con 50 mg L-1 kanamicina (Kan 50). Crescere cellule placcato a 37 ° C durante la notte. Salvare la reazione di assemblaggio DNA rimanente a -20 ° C. </li><li> schermo Colony mediante PCR utilizzando il StUbi3P218R primer e ISceIR. Diluire un&#39;aliquota della reazione complesso DNA residuo con acqua 1: 5. Usare 1 ml come controllo positivo per lo schermo colonia e 1 ng di p201N circolare: Cas9 plasmide come un controllo non-insert. <ol><li> PCR amplifica le condizioni; 95 ° C per 3 min; 31 cicli (95 ° C per 30 sec, 58 ° C per 30 sec, 72 ° C per 30 sec); ed a 72 ° C per 5 min. Visualizzare prodotti di PCR su un gel di agarosio 1%. Assicurarsi che gli inserimenti corretti hanno una banda a 725 bp e vettori ingegnoInserti Hout (ad esempio, non tagliato vettore) avranno una banda di 310 bp. </li></ol></li><li> Crescere colonie positive in LB Kan 50 colture liquide durante la notte a 37 ° C e purificare plasmidi secondo le istruzioni del produttore. Sequenza Sanger plasmidi con il primer StUbi3P218R e allineare cromatogrammi alle MtU6 promotore, target, e le sequenze ponteggio per garantire l&#39;assenza di errori sono stati introdotti durante la clonazione. </li><li> Eseguire una diagnosi digest da digerire ~ 1 mg di plasmide con Eco e RV porcile I. Visualizzare su un gel di agarosio 0,8%. Frammenti (in punti base) sono: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, e 174. </li><li> Utilizzare il montaggio del DNA per costruire vettori con più gRNAs. <ol><li> Per costruire un vettore con due cassette gRNA, PCR amplifica la prima posizione gRNA con i primer Swa I_MtU6F / UNS1_ScaffoldR e la seconda posizione di gRNA con i primer UNS1_MtU6F / Spe I_ScaffoldR da 1 ng di ciascuno dei rispettiviplasmidi costruiti in passi 1.1 - 1.8. Utilizzare le condizioni di PCR nella fase 1.3.3. Visualizzare ~ 3 aliquote microlitri di prodotti di PCR su un gel di agarosio 1% per confermare l&#39;amplificazione. Gli ampliconi sono ~ 500 bp. </li><li> Unire e miscelare circa la stessa quantità di prodotti di PCR non-purificata in tubo da 200 ml (di solito 3 - 4 ml di ciascuno). Per il montaggio, aggiungere 1 ml combinati prodotti di PCR, 50 ng di Swa I e Spe I linearizzato p201N: Cas9, acqua di laboratorio di grado a 2,5 ml e 2,5 ml di 2x ad alta fedeltà assemblaggio DNA master mix. Incubare in un termociclatore a 50 ° C per 15 min. Nota: I manuali di montaggio DNA raccomanda 15 minuti di incubazione per 2 - 3 frammenti. </li><li> Trasforma 1 - 2 ml in E. competente coli e piatto su LB Kan 50. Crescere le cellule placcato a 37 ° C durante la notte. Salvare la reazione rimanente a -20 ° C. </li><li> schermo Colony mediante PCR con primer StUbi3P218R e ISceIR con le stesse condizioni passo 1.6. corretto cLones avranno un amplicone 1.200 bp. Crescere colonie positive in LB Kan 50 colture liquide durante la notte e purificare plasmidi. </li><li> Sanger plasmidi sequenza con il primer StUbi3P218R (buste primo posizione gRNA) e p201R (copre la seconda posizione gRNA). Allineare cromatogrammi alle MtU6 sequenze promotore, di destinazione, e ponteggi. Diagnostic digerire con Eco e RV porcile mi darà luogo ai seguenti frammenti (in bp): 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. frammento Bolded contiene la seconda gRNA. </li></ol></li><li> Dopo aver incontrato tutte le aspettative di controllo della qualità, di trasformare i plasmidi in Agrobacterium rhizogenes ceppo ARqua1 15. Aggiungere 1 ml di preparazione plasmide di 50 ml di cellule electrocompetent e l&#39;elettroporazione in una provetta 1 mm con le impostazioni: 2.4 kV, 25 uF, e 200 Ω. Recuperare le cellule a ~ 500 ml di SOC e agitare a 28 ° C per 2 ore. Piastra su LB Kan 50 e gfila a 28 ° C per 2 giorni. Eseguire schermo colonia utilizzando gli stessi primer e condizioni di PCR come 1.3.3. Fare scorte glicerolo da cloni positivi. </li></ol> Trasformazione 2. Peloso Root <ol><li> Sterilizzare semi di pomodoro a 20% candeggina per uso domestico per 15 min, con una costante miscelazione. In una cappa a flusso laminare, rimuovere la candeggina e lavare in acqua da laboratorio-grado sterile 3 volte. </li><li> Piastra 30 semi in una scatola GA-7 contenenti supporti ½ MS (2,22 g L -1 MS sali + Gamborg vitamine, 10 g L -1 di saccarosio, 3 g L -1 gellano, pH 5,8). Germini per ~ 2 giorni al buio, quindi spostare GA-7 scatole di luce. Crescere piantine per ~ 4 più giorni alla luce. </li><li> Il giorno prima trasformazione, striscia fuori A. rhizogenes culture in solido LB Kan 50 e crescere a 28 ° C durante la notte. </li><li> Giorno di trasformazione, nella cappa a flusso laminare assemblare materiali sterili: 12 ml provette di coltura, tubo da 50 ml, ½ MS liquido (non gellano gum), 200 micron acetosyringone, carta da filtro, piastre di Petri, pinze e bisturi, pipette e puntali per pipette. Aggiungere 25 ml di acetosyringone a 50 ml di ½ MS e versare ~ 6 ml in ciascuna provetta cultura. </li><li> Utilizzare una punta piegata 200 pl per raschiare A. cellule rhizogenes dalla piastra e risospendere in 6 ml di ½ MS liquido. Vortex la provetta per risospendere completamente le cellule. Dopo risospendere le cellule da ciascun vettore, misurare la densità ottica (OD) di 1 ml di cellule ad una lunghezza d&#39;onda fissa di 600 nM. Assicurarsi OD è compresa tra 0,2 e 0,4; diluire o aggiungere più celle, se necessario. Ripetere per ogni costrutto. </li><li> Aggiungere ~ 2 ml di ½ MS liquido ad una capsula di Petri con una carta da filtro sterile. cotiledoni accise dalle piantine e posto sulla carta da filtro inumidita. Una volta che tutti i cotiledoni sono stati raccolti, tagliare i distali ~ 1 cm fuori dei cotiledoni, con conseguente pezzi cotiledone con due estremità tagliate. Aggiungere espianti ad A. soluzioni rhizogenes, si mescolano, e incubare per 20 mincon inversione occasionale. Nota: circa 12 espianti al costrutto sono abitualmente utilizzati, anche se, come ben 80 espianti sono stati inoculati in 6 ml di A. soluzione rhizogenes. </li><li> Durante la A. rhizogenes incubazione, aggiungere carta da filtro a piastre di Petri, uno per ogni costrutto trasformato. Impostare anche ½ terreni solidi MS, antibiotici, nella cappa a flusso laminare ad asciugare. </li><li> Scoop cotiledoni di A. soluzione rhizogenes con pinza sterile e posto su carta da filtro asciutta. Coprire con il coperchio Petri per garantire i tessuti non seccano mentre si procede alla successiva trasformazione. cotiledoni macchia sulla carta da filtro e il trasferimento, lato abaxial up, a ½ supporto MS. Avvolgere piastre con nastro chirurgico e co-coltivazione al buio a temperatura ambiente per 2 giorni. </li><li> Dopo aver co-coltivazione, cotiledoni di trasferimento, lato abaxial up, a ½ supporti MS integrati con 300 mg L-1 ticarcillina / acido clavulanico (Tim 300, per impedire la crescita di residUAL A. rhizogenes) e Kan 50 (per la selezione delle piante) e avvolgere con nastro adesivo chirurgico. Mantenere culture sotto luci fluorescenti a temperatura ambiente con un fotoperiodo di 16 ore. </li><li> Dopo ~ 1,5 - 2 settimane radici di almeno 2 cm di lunghezza sono asportati dai cotiledoni con pinza sterile e un bisturi e trasferiti a ½ MS Kan 50 Tim 300 mezzi. Trasferire 10 a 15 radici di una singola lastra. Segnare la posizione degli apici radicali con un pennarello, avvolgere con nastro adesivo chirurgico, e mantenere in camera cultura. </li><li> Dopo una settimana, radici trasformate sono visti crescono sul terreno selettivo. Raccolto un sottocampione di radici trasformate per l&#39;estrazione del DNA utilizzando il metodo del DNA di estrazione preferito. Nota: Piastre con cotiledoni possono essere conservati per 2 - 3 raccolti settimanalmente, dopo che indicano le radici crescono in un pasticcio aggrovigliato e sono difficili da isolare. tessuti radicali non raccolte possono essere mantenuti a tempo indeterminato. Una varietà di saggi può essere eseguita sul campione di DNA isolatas per determinare il DNA mutazione frequenza e tipo. I risultati di un paio di tali dosaggi sono descritti di seguito. </li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

Gli autori non hanno nulla da rivelare.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single, one-hour reaction and gRNA oligos can be pooled to further streamline the cloning procedure. Furthermore, the DNA assembly mechanism is independent of restriction enzymes, which makes this method compatible with virtually any DNA sequence. Conveniently, a master mix of the invariable DNA components (linearized vector, MtU6 promoter, and scaffold) can be made and stored at -20 &#176;C for later assemblies. 
While we use the GN20GG gRNA target motif, there are several alternative gRNA target motifs that can be used17. Shorter gRNAs have been demonstrated to increase specificity in animal cells20. By using a 5' G with a U6 promoter in the gRNA sequence (or A in the case of a U3 promoter), regardless if it matches the intended target sequence, the more abundant target motif N21GG may be used. However, the GN20GG target motif does not present a major technical limitation as several suitable targets can be found in most plant genes. The cloning scheme presented here can be easily modified to accommodate any gRNA design; simply substitute bases in the gRNA oligo.
Another advantage of the DNA assembly cloning system is that the same reagents can be used to insert multiple gRNAs into a single vector. A protocol for two gRNAs is presented here, and with the same methodology, using unique nucleotide sequences21 as spacers between gRNAs, it should be possible to assemble six gRNAs or more in a single cloning reaction.
As presented in step 1.9, the sequential cloning of gRNA vectors into a final multi-gRNA vector will take several days to perform because of the multiple cloning and screening steps. A modification of this protocol permits the construction of multi-gRNA vectors in a single day by bypassing the single-gRNA vector cloning step. First assemble individual gRNAs with just the MtU6 amplicon, gRNA oligo, and scaffold amplicon. Individual reactions must be performed for each gRNA. Following step 1.4, omit the linearized vector and reduce the 50 &#176;C incubation to 15 minutes. A 1:5 dilution of the reactions can be used as template in step 1.9.1. 
A potential problem with step 1.9 is the carry-over of residual single-gRNA plasmids from the PCR amplification of the gRNAs since all plasmids are selected with kanamycin. While we have never observed single-gRNA vectors in any of our colony screens following the specified protocol, gel purification of the PCR products or DpnI treatment of the PCR reactions could be used should the problem occur.
The ability to generate CRISPR vectors in a high-throughput manner necessitates a high-throughput method of generating transgenic materials to use the CRISPR vectors. Hairy roots are well suited for this task as they are technically simple to generate, require relatively little laboratory space to maintain and can be produced in a wide range of plant species22,23. However one limitation is that hairy roots are generally not used to generate whole plants and root systems are not suitable models for investigating most above-ground phenotypes. The former limitation may be advantageous when targeting genes that are null-lethal in whole-plant systems.
An important consideration for any transformation experiment is that results may vary with the different genotypes of plants and bacterial strains used. We routinely induce hairy roots in the cultivar (cv.) Rio Grande but have had difficulty obtaining hairy roots with cv. Moneymaker. Here, we report the use of the A. rhizogenes strain ARqua1, but it should be noted that strain ATCC 15834 has also been reported to work in tomato9.
Another critical consideration for hairy root transformation is the potential for overgrowth of A. rhizogenes on the cotyledon explants. Bacterial overgrowth typically leads to cotyledon death and low transformation efficiencies. Cotyledons must be blotted dry after soaking with A. rhizogenes. Likewise, co-cultivation should be limited to two days to prevent excessive bacterial overgrowth. Some bacterial growth is typically observed on co-cultivation plates, but should be absent once cotyledons are transferred to media containing ticarcillin/clavulanic acid.
The ease of constructing CRISPR vectors and generating hairy roots enables large-scale reverse-genetic screens, similar to those that are used in animal cell culture systems2. Hairy roots have been used to study a variety of plant functions including root development9, symbiotic associations24,25, and nematode resistance26 and the use of hairy roots for screening immunity-related genes is an area of active research in our lab. In addition to overexpression, gene silencing, and other transgenic technologies, targeted gene deletion via CRISPR/Cas9 is a powerful tool for functional genomic studies.

La capacità di generare le modifiche del DNA mirati con CRISPR / Cas9 ha un grande potenziale per gli studi di genomica funzionale. Ci sono due componenti del sistema CRISPR / Cas9; la nucleasi Cas9, derivata da pyogenes Staphylococcus e una molecola di circa 100 nt guida RNA (gRNA) che dirige Cas9 al sito DNA bersaglio (s) 1. Obiettivo riconoscimento è conferito dal primo ~ 20-nt del gRNA, che consente la produzione di high-throughput di targeting vettori 2,3. La maggior parte degli organismi che possono essere progettati, già sono stati con CRISPR tecnologia / Cas9 4,5. Nelle piante, promotori costitutivi, come il promotore CaMV 35S, sono comunemente utilizzati per guidare l&#39;espressione della nucleasi Cas9 6. I gRNAs sono espressi utilizzando le RNA polimerasi III U6 o U3 promotori che limita la prima base del gRNA, o un G, per la U6, o A per U3, per la trascrizione efficiente. Tuttavia prom RNA polimerasi IIoters, che sono liberi di queste restrizioni, sono stati utilizzati 7,8. Diversi gRNAs inducono mutazioni del DNA con diverse efficienze, e quindi può essere importante per convalidare prima vettori CRISPR prima di investire nelle trasformazioni intero impianto o la creazione di ampi schermi fenotipici. Espressione transiente di CRISPR costruisce nelle piante, utilizzando agroinfiltration per esempio, comporta generalmente una minore frequenza di modifica DNA rispetto agli impianti stabili 6, rendendo il rilevamento di mutazioni difficili e saggi fenotipici impraticabili con tali approcci. Le cosiddette radici pelose sono una comoda, sistema alternativo poiché un gran numero di materiali stabilmente trasformate indipendenti può essere generato all&#39;interno settimane, anziché mesi per impianti stabili. Vettori CRISPR sono molto efficaci a indurre mutazioni del DNA nelle radici pelose 9,10. metodi di assemblaggio DNA legare in modo efficiente frammenti di DNA contenenti overlANALITICI finisce 11. Un vantaggio importante di alcuni metodi di assemblaggio DNA è la capacità di incorporare ssDNA (cioè oligonucleotidi) nei prodotti assemblati. Dal momento che gRNAs sono solo ~ 20-nt lunga e nuovi obiettivi possono essere realizzati con oligonucleotidi sintetizzati, questi metodi di assemblaggio del DNA sono adatti per CRISPR clonazione. I protocolli descritti qui sono basate sulla serie P201 di vettori CRISPR che è stato usato con successo nella soia 10, pioppo 12 e ora pomodoro. La procedura di clonazione presentato offre diversi vantaggi rispetto al metodo di clonazione corrente 10. Vale a dire, vettori completamente funzionali possono essere generati in una singola reazione clonazione in un solo giorno. costruzione del vettore può anche essere raggruppati per generare più vettori CRISPR in parallelo, riducendo ulteriormente hands-on costi di tempo e materiali. Presentiamo anche un protocollo per la generazione di pomodoro radici pelose come un metodo efficiente per la produzione di materiali transgenici con delezioni geniche mirate. radici pelose sono utilizzati per validemangiato i vettori CRISPR e fornire materiale per esperimenti successivi.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR vettore costruzione con assemblaggio DNA genera tipicamente decine a centinaia di cloni indipendenti. Lo screening mediante PCR Colony identifica facilmente cloni corretti e in grado di distinguere tra i plasmidi con e senza inserti (Figura 2a) che è utile per la risoluzione dei problemi. Tipicamente, tutti i cloni contengono un inserto e un utente può scegliere di ignorare i passaggi di screening colonia del tutto. Digest diagnostici (Figura 2b) e il sequenziamento Sanger sono utilizzati per il controllo qualità. Quando si verificano errori, di solito sono osservati nelle regioni di DNA sovrapposte, cioè, &#39;estremità del promotore MtU6, il gRNA, o 3&#39; del 5 fine della sequenza scaffold. Se più oligo gRNA vengono raggruppati in una singola reazione, i gRNAs sono determinati da Sanger sequenziamento. L&#39;incorporazione dei singoli gRNAs è uniformemente distribuito e la maggior parte delle gRNAs può essere isolato da una singola trasformazione (Figura 2C </sTrong&gt;). Il mix di assemblaggio del DNA ad alta fedeltà è preferito il mix di assemblaggio del DNA standard, come la versione ad alta fedeltà è meno soggetto a errori (Figura 2C). Pomodoro radici pelose si osservano di solito una o due settimane dopo la trasformazione (Figura 3A). Radici ≥2 cm di lunghezza sono escisse e trasferito al terreno selettivo e le radici kanamicina resistenti possono essere identificati una settimana dopo (Figura 3B). La maggior parte delle radici cresceranno in una certa misura su terreni selettivi e la crescita delle radici nelle radici trasformate può essere variabile; se possibile, selezionare i più vigorosamente crescita radici per l&#39;analisi. Da uno a due radici kanamicina-resistenti sono in genere recuperati per cotyledon inoculato. Con trasferimenti regolari, radici trasformate possono essere mantenute a tempo indeterminato su terreni selettivi. DNA viene estratto da radici kanamicina resistente e PCR è usato per amplify la regione di destinazione (s). I prodotti di PCR possono essere utilizzati in una varietà di saggi per determinare l&#39;efficienza di mutazione, come la clonazione e il sequenziamento (Figura 3C), analisi di restrizione frammento lunghezza polimorfismo, SDS-PAGE 16 (Figura 3D), T7E1 endonucleasi 16, o ad alta produttività amplicon sequencing 10. Come riportato in altri sistemi CRISPR-pianta 6, a seconda della sequenza gRNA / target selezionato, si può osservare una serie di mutazioni e efficienze mutazione. <img alt="Figura 1" src="/files/ftp_upload/53843/53843fig1.jpg" /> . Figura 1. Principio dell&#39;Assemblea CRISPR Nella reazione di assemblaggio del DNA, DNA quattro sono mescolati insieme; p201N: Cas9 linearizzato con Swa I e Spe I (cerchio nero), promotore MtU6 (freccia verde), impalcatura (barra gialla) e il 60-mer oligo gRNA contenente la sequenza bersaglio GN 19 (bbar Lue). Le estremità di ogni molecola di DNA sovrapposizioni 20 bp con il pezzo adiacente. La reazione di assemblaggio del DNA ricombina questi DNA in un unico, molecola circolare. I siti di legame di primer StUbi3p218R e ISceIR sono indicati con frecce nere, il 2x35S: Cas9 cassetta è viola, il StUbi3: cassetta nptII è arancione e sinistra e destra sono indicati i confini con barre grigie. Nota:. Vector mappa non è in scala <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig1large.jpg" target="_blank">prega di cliccare qui per vedere una versione più grande di questa figura.</a> <img alt="figura 2" src="/files/ftp_upload/53843/53843fig2.jpg" /> Figura 2. Screening Colony e plasmidi controllo di qualità. A) lo screening Colonia di 20 cloni di assemblaggio del DNA e la trasformazione. M, scala di 100 bp; +, P201N: Cas9: GFPT2 controllo positivo; NI, p201N: Cas9 di controllo non-insert; GA, DNA diluito reazione di montaggio; NT, no-modello di controllo. B) Rappresentante digest di quattro p201N: Cas9: vettori gRNA con gli enzimi di restrizione Eco RV e Sty I. M, 2-log scala. C) Confronto della fedeltà dello standard e ad alta fedeltà mix di assemblaggio del DNA e la distribuzione dei vettori recuperati quando 11 gRNA oligonucleotidi sono stati raggruppati in una singola reazione. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig2large.jpg" target="_blank">Cliccate qui per vedere una versione più grande di questa figura.</a> <img alt="Figura 3" src="/files/ftp_upload/53843/53843fig3.jpg" /> Figura 3. Culture Peloso radice e la rilevazione del DNA modifica. A) radici pelose può essere visto che emerge da cotiledoni 11 giorni dopo la trasformazione. B) Le radici sono selezionati sulla ½ MS Kan 50 supporti per circa una settimana. Barre grigie indicano la posizione di apici radicali al momento della placcatura. C) Esempio di clonazione esequenziamento per determinare mutazioni del DNA con due diversi obiettivi gene in quattro diversi eventi peloso-root. Casella grigia denota GN 20 GG sequenza bersaglio, Δ tipo di mutazione, e il numero di cloni con la mutazione indicato. D) Esempio di SDS-PAGE per determinare mutazioni del DNA indica. Grandi cancellazioni e bande eteroduplex indicano la presenza di mutazioni del DNA alle sequenze bersaglio. Sei dei 12 eventi indipendenti sono stati segnati come mutanti (Δ). WT, wild-type di controllo; NT, non-modello di controllo. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig3large.jpg" target="_blank">Si prega di cliccare qui per vedere una versione più grande di questa figura.</a>

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

High-throughput CRISPR vettore Costruzione e caratterizzazione di modifiche del DNA da Generazione di Roots pomodoro Peloso

Utilizzando assemblaggio DNA, vettori multipli CRISPR possono essere costruiti in parallelo in una singola reazione clonazione, rendendo la costruzione di un gran numero di CRISPR vettori un compito semplice. Pomodoro radici pelose sono un sistema eccellente modello per convalidare vettori CRISPR e generare materiali mutanti.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Universidad San Sebastian

Research

JoVE Journal

Biology

17.8K Views.  Boyce Thompson Institute for Plant Research.  Utilizzando assemblaggio DNA, vettori multipli CRISPR possono essere costruiti in parallelo in una singola reazione clonazione, rendendo la costruzione di un gran numero di CRISPR vettori un compito semplice. Pomodoro radici pelose sono un sistema eccellente modello per convalidare vettori CRISPR e generare materiali mutanti. 

Video: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

Generazione di DNA / RNA ibrido nel DNA genomico da trasformazione utilizzando RNA contenenti oligonucleotidi

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

Ricerca

Biologia

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping project is to collect a tissue sample from each individual plant. The traditional approach to this task is to sample plants one-at-a-time. If one wishes to genotype hundreds or thousands of individuals, however, using this strategy results in a significant bottleneck in the genotyping pipeline. The Ice-Cap method that we describe here provides a high-throughput solution to this challenge by allowing one scientist to collect tissue from several thousand seedlings in a single day 1,2. This level of throughput is made possible by the fact that tissue is harvested from plants 96-at-a-time, rather than one-at-a-time.
The Ice-Cap method provides an integrated platform for performing seedling growth, tissue harvest, and DNA extraction. The basis for Ice-Cap is the growth of seedlings in a stacked pair of 96-well plates. The wells of the upper plate contain plugs of agar growth media on which individual seedlings germinate. The roots grow down through the agar media, exit the upper plate through a hole, and pass into a lower plate containing water. To harvest tissue for DNA extraction, the water in the lower plate containing root tissue is rapidly frozen while the seedlings in the upper plate remain at room temperature. The upper plate is then peeled away from the lower plate, yielding one plate with 96 root tissue samples frozen in ice and one plate with 96 viable seedlings. The technique is named "Ice-Cap" because it uses ice to capture the root tissue. The 96-well plate containing the seedlings can then wrapped in foil and transferred to low temperature. This process suspends further growth of the seedlings, but does not affect their viability. Once genotype analysis has been completed, seedlings with the desired genotype can be transferred from the 96-well plate to soil for further propagation. We have demonstrated the utility of the Ice-Cap method using Arabidopsis thaliana, tomato, and rice seedlings. We expect that the method should also be applicable to other species of plants with seeds small enough to fit into the wells of 96-well plates.

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

The Ice-Cap method allows one to grow plants in 96-well plates and non-destructively harvest root tissue from each seedling. DNA extracted from this root tissue can be used for genotyping reactions. We have found that Ice-Cap works well for Arabidopsis thaliana, tomato, and rice seedlings.

Ice-Cap: Un metodo per la Crescita Arabidopsis E piante di pomodoro in piastre con 96 pozzetti di High-Throughput Genotipizzazione

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

Generazione Substrato per endonucleasi di CRISPR / Cas Sistemi

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

Generazione di immunoprecipitazione della cromatina Template DNA di alta qualità per high-throughput sequencing (ChIP-Seq)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

Targeted DNA metilazione Analisi per sequenziamento di prossima generazione

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Screening ad alto rendimento per i modulatori chimici di Genes post-trascrizionale regolamentati

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: Genome-wide Mappatura delle interazioni proteina-DNA da High Throughput Sequencing di Adenina-metilato frammenti di DNA

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplificazione, sequenziamento di prossima generazione, e DNA genomico mappatura dei siti di integrazione retrovirali

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). Therefore, assessing mitochondrial function in primary TECs may provide valuable insight into the bioenergetic status of the cells, providing insight into the pathophysiology of CKD. While there are a number of complex protocols available for the isolation and purification of proximal tubules in different species, the field lacks a cost-effective method optimized for&#160;tubular cell isolation without the need for purification. Here, we provide an isolation protocol that allows for studies focusing on both primary mouse proximal and distal renal TECs. In addition to cost-effective reagents and minimal animal procedures required in this protocol, the isolated cells maintain high energy levels after isolation and can be sub-cultured up to four&#160;passages, allowing for continuous studies. Furthermore, using a high throughput extracellular flux analyzer, we assess the mitochondrial respiration directly in the isolated TECs in a 96-well plate for which we provide recommendations for the optimization of cell density and compound concentration. These observations suggest that this protocol can be used for renal tubular ex vivo studies with a consistent, well-standardized production of renal TECs. This protocol may have broader future applications to study mitochondrial dysfunction associated with renal disorders for drug discovery or drug characterization purposes.

This protocol provides a cost-effective approach to isolate and characterize mouse primary renal tubular cells that can subsequently be sub-cultured to assess renal biological functions ex vivo, including mitochondrial bioenergetics.

Isolamento, caratterizzazione e Throughput elevato flusso extracellulare analisi di cellule epiteliali tubolari renali primari del Mouse

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

Tick Microbiome caratterizzazione ordinando Amplicon del rRNA 16S di prossima generazione

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...