이 연구는 국립 과학 재단 (National Science Foundation) 부여 IOS-1025642 (GBM)에 의해 지원되었다. 우리는 ARqua1 균주를 제공하는 마리아 해리슨 감사합니다.

1. 가이드 RNA 설계 및 벡터 건설 <ol><li> 관심있는 유전자에 대한 표적 서열을 확인합니다. 이 단계 (13, 14)에 적합한 온라인 CRISPR 대상-찾는 다양한 프로그램이 있습니다. 참고 : 여기에 우리는 GN 20 GG 대상 모티브를 사용하지만, 다른 디자인을 사용하는 응용 프로그램이나 벡터 시스템에 따라 적합 할 수있다. </li><li> 디자인 60 메르 gRNA 올리고는 DNA 조립에 필요한 5 측면 대상 주제 &#39;및 3&#39;20 NT 시퀀스의 GN (19) 부분을 포함한다. 마지막 60 메르 주제는 다음과 같습니다 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. 참고 : 표준, 탈염 프라이머가 잘 작동합니다. </li><li> 조립을위한 네 개의 DNA를 (그림 1)을 준비합니다. DNA 서열에 대한 추가 파일을 참조하십시오. <ol><li> 2 시간 동안 37 ℃에서 1X 버퍼 (4)의 제한 효소와 I SPE Cas9 10 플라스미드 p201N 5 μg의 1 - 다이제스트. 는 다이제스트 열은-정화제조업체의 지침에 ccording. ~ 10 mM 트리스 - 염산 15 μl를에 재현 탁하고, UV 분광 광도법에 의해 정량화. </li><li> 제 2 시간 동안 25 ℃에서 1X 버퍼 3.1 제한 효소 I SWA와 다이제스트 수행한다. 완전한 분해를 확인하기 위해 0.8 % 아가 로스 겔상에서 ng를 200-100를 확인한다. 참고 : 제대로 소화 플라스미드 14,313 BP에 하나의 밴드를해야합니다. 참고 : 효소와 탈 인산화의 열 불 활성화가 필요하지 않습니다. 분해 된 플라스미드를 -20 ℃에서 저장 될 수있다. </li><li> PCR은 프라이머 SWA I_MtU6F / MtU6R 각각 ScaffoldF / SPE I_ScaffoldR를 사용하여는 pUC gRNA 셔틀 (10) 플라스미드에서 Medicago의 truncatula (마) U6 프로모터 및 발판 DNA를 증폭. 상기 증폭 된 PCR 조건을 가진 고성능 폴리머 사용하여 3 분 동안 95 ° C 단계; 31주기 (20 초 98 ° C, 15 초 동안 60 ° C, 30 초 72 ° C); 5 분 동안 72 ° C. <ol><li> PCR 홍보의 ~ 3 μL 씩 시각화1 % 아가 로스 겔상에서 oducts의 증폭을 확인한다. MtU6 앰플 리콘은 377 BP하고 비계 앰플 리콘은 106 bp의입니다. , 제조업체의 지시에 따라 PCR 나머지 제품을 칼럼 - 정제 -20 ℃에서 UV 분광 광도법에 의해 정량화하고 저장. </li></ol></li><li> 실험실 수준의 물에 100 μM에 gRNA 올리고의 전체 튜브를 재현 탁. 1X 버퍼 2.1 500 ㎕를 100 μM 올리고 1 μl를 추가합니다. 잘 섞다. 여러 올리고 풀링 경우, 1 배 버퍼 2.1 튜브에 각각 100 μM 올리고 1 μl를 추가합니다. 희석 올리고는 -20 ° C에서 저장 될 수있다. </li></ol></li><li> 가열 된 리드를 사용하여, 50 ° C에서 유지하도록 열 순환기 프로그램. 의 부피로 선형화 된 벡터 묽은 gRNA 올리고 (들) 및 물 MtU6 프로모터 지지체의 12 NG (0.2 pmol의), 1 μL (0.2 pmol의)의 50 NG (0.2 pmol의)의 100 NG (0.011 pmol의)을 겸용 5 μL. 2 배 높은 충실도 DNA 어셈블리 마스터 믹스 5 μl를 추가 잘 혼합 스핀 다운. 에서 60 분 동안 반응을 품어50 ° C 열 순환기. 그런 다음 얼음에 반응을 놓습니다. 주의 : 반응 볼륨이 낮은 DNA 수율을 수용하기 위해 증가 될 수있다. </li><li> 관할 E.으로 반응 2 μl를 변환 50 mg을 L -1 카나마이신 (칸 50)로 보충 LB에 표준 기술과 플레이트를 이용하여 대장균 세포. 하룻밤 37 ℃에서 도금 세포를 성장. -20 ° C에서 남아있는 DNA 어셈블리 반응을 저장합니다. </li><li> 프라이머의 StUbi3P218R 및 ISceIR를 사용하여 PCR에 의한 식민지 화면. 물 (1)과 나머지 DNA 조립체 반응의 분취 액을 희석 : 5이다. 노 삽입 제어와 같은 Cas9 플라스미드 : 긍정적 인 식민지의 화면 제어 및 원형 p201N 1 NG로 1 μl를 사용합니다. <ol><li> PCR은 조건을 증폭; 3 분 95 ° C; 31주기 (30 초 95 ° C, 30 초 동안 58 ° C, 30 초 72 ° C); 5 분 동안 72 ° C에서. 1 % 아가 로즈 겔상에서 PCR 생성물을 가시화. 정확한 삽입이 725 BP와 벡터 기지에서 밴드가 있는지 확인(예를 들어, 포경 벡터) 심 삽입은 310 bp의 밴드를해야합니다. </li></ol></li><li> 37 ° C에서 50 액체 배양 밤새 LB 칸에 긍정적 인 식민지를 성장하고 제조업체의 지침에 따라 플라스미드를 정제. 생거 순서는 StUbi3P218R 프라이머로 플라스미드 및 오류가 복제 동안 소개되지 않았다 보장하기 위해 MtU6 프로모터, 대상 및 발판 시퀀스에 크로마토 그램을 맞 춥니 다. </li><li> 진단은 에코 RV 및 촌 I.와 플라스미드 ~ 1 μg의 소화에 의해 소화 수행 0.8 % 아가 로스 젤에 시각화합니다. (BP)에 조각은 다음과 같습니다 : 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. </li><li> 여러 gRNAs와 벡터를 구성하는 DNA 어셈블리를 사용합니다. <ol><li> 두 gRNA 카세트를 갖는 벡터를 구성하기 위해 PCR은 각각 각각의 1 NG의 프라이머 UNS1_MtU6F / SPE I_ScaffoldR와 프라이머 SWA I_MtU6F / UNS1_ScaffoldR 및 제 gRNA 위치와 제 1 위치 gRNA 증폭1.8 - 플라스미드 단계 1.1으로 구성. 단계 1.3.3에서 PCR 조건을 사용합니다. 증폭을 확인하기 위해, 1 % 아가 로즈 겔상에서 PCR 제품 ~ 3 μL 씩 시각화. 증폭는 ~ 500 BP 있습니다. </li><li> 합하여 200 μL 튜브 않은 정제 PCR 제품의 대략 동일한 양을 혼합 (일반적으로 3 - 각 4 μL). 어셈블리를 들어, PCR 제품 조합 1 μL, SWA I의 50 NG를 추가하고 SPE 나는 p201N을 선형화 : Cas9, 실험실 수준의 물을 2.5 μL와 배 높은 충실도 DNA 어셈블리 마스터 믹스의 2.5 μL에. 15 분 동안 50 ° C 열 순환기 인큐베이션. 주 : DNA 조립 매뉴얼 2 15 분 배양 권장합니다 - 3 조각. </li><li> 관할 E.으로 2 μL 1 - 변환 LB 칸 (50)에 대장균 세포와 판. 하룻밤 37 ° C에서 도금 세포를 성장. -20 ° C에서 나머지 반응을 저장합니다. </li><li> 단계 1.6과 동일한 조건으로 프라이머 StUbi3P218R 및 ISceIR와 PCR에 의한 식민지 화면. 올바른 Clones는 1200 bp의 증폭 물을 것입니다. LB 칸에 긍정적 인 식민지를 50 액체 배양 하룻밤 성장 및 플라스미드를 정제. </li><li> 프라이머의 StUbi3P218R와 생거 시퀀스 플라스미드 (제 1 위치 gRNA을 포함) 및 p201R은 (두 번째 위치 gRNA을 포함). MtU6 프로모터, 대상 및 발판 시퀀스에 크로마토 그램을 맞 춥니 다. 진단은 에코 RV 다이제스트와의 Sty 나는 (BP)에 다음과 같은 단편 발생합니다 : 4192은, 2476은, 1743은, 1544은, 1381는, 995, 831, 702, 460, 423, 318, 174 굵게 조각 두 번째 gRNA이 포함되어 있습니다. </li></ol></li><li> 아그로 박테 리움이 변형 ARqua1 15 rhizogenes에 모든 품질 관리의 기대를 충족 한 후, 플라스미드를 변환. 설정으로 1mm 큐벳에 electrocompetent 세포와 electroporate 50 μL에 플라스미드 준비 1 μl를 추가 : 2.4 kV의 25 μF, 200 Ω을. SOC의 ~ 500 μL의 세포를 복구하고 2 시간 동안 28 ° C에서 흔들. LB 칸 50 g에 플레이트2 일 동안 28 ° C에서 행. 1.3.3와 동일한 프라이머 및 PCR 조건을 사용하여 콜로니 화면을 수행한다. 긍정적 인 클론에서 글리세롤 주식을합니다. </li></ol> 2. 털이 루트 변환 <ol><li> 일정하게 혼합하여, 15 분 동안 20 %의 가정용 표백제 토마토 종자를 소독. 층류 후드에서, 표백제를 제거하고 무균 실험실 등급 물에 세 번 세척 하였다. </li><li> ½ MS 미디어 (2.22 g의 L -1 MS 염 + 갬 보그 비타민, 10g의 L -1 자당 3 g L -1 젤란 검, 산도 5.8)를 포함하는 GA-7 상자 판 (30) 씨. 어둠 속에서 2 ~위한 일을 발아 후 빛에 GA-7 상자를 이동합니다. 빛 ~ 4 일 이상 모종을 재배한다. </li><li> 변환 전날, 연속 아웃 A. 고체 LB 칸 (50)에 문화를 rhizogenes 하룻밤 28 ° C에서 성장한다. </li><li> 변환 일이 층류 후드에서 멸균 재료를 조립 : 12 ml의 배양 관, 50 ㎖ 원뿔형 튜브, ½ MS 액체 (더 젤란 g 없다음), 200 μM의 시린, 여과지, 배양 접시, 집게와 메스, 피펫과 피펫 팁. ½ MS의 50ml로 시린의 25 μl를 추가하고 각 문화 튜브에 ~ 6 ml에 붓는다. </li><li> A.을 긁어 구부러진 200 μl의 팁을 사용하여 ½ MS 액의 6 용액에 접시와에 resuspend에서 rhizogenes 세포. 와류 튜브 완전 세포를 재현 탁한다. 각 벡터로 세포를 재현 탁 후에, 600 nm의 고정 된 파장에서 셀 1 (M1)의 광학 밀도 (OD)를 측정한다. OD가 0.2과 0.4 사이에 있는지 확인; 희석 또는 필요에 따라 더 많은 세포를 추가합니다. 각 구조에 대해 반복합니다. </li><li> 살균 필터 종이와 페트리 접시에 ½ MS 액체 ~ 2 ML을 추가합니다. 가습 필터 종이에 묘목과 장소에서 소비세 자엽. 일단 모든 자엽이 수집 한 두 컷 끝 떡잎 조각의 결과로, 자엽의 오프 말단 ~ 1cm를 잘라. A.에 외식 추가 rhizogenes 솔루션은 혼합하고, 20 분 동안 품어가끔 반전에. 참고 : 구조 당 약 12 외식가 일상적으로 사용되며, 많은 80 외식이 A의 6 ㎖에 접종되고 있지만 rhizogenes 솔루션입니다. </li><li> A. 동안 rhizogenes의 배양은 배양 접시에 종이 필터를 추가, 하나의 당 구조가 변형. 또한 건조 층류 후드, ½ MS 고체 배지, 아니 항생제를 설정합니다. </li><li> A.에서 자엽 특종 건조 여과지에 멸균 집게와 장소 rhizogenes 솔루션을 제공합니다. 다음 변환을 진행하면서 건조하지 않는 조직을 보장하기 위해 페트리 뚜껑 커버. 여과지 및 전송, 배축면이 위로에 오 자엽은 MS의 미디어를 ½합니다. 외과 용 테이프로 감싸 판을 실온에서 2 일 동안 어둠 속에서 공동 - 배양. </li><li> 최대 공 배양, 전사 자엽, 배축 측 후, MS 매체 (300 mg을 L -1 ticarcillin / 클라 불란 산 팀 300 보충 1/2 잔유의 성장을 방지 할연간 A. rhizogenes) 및 공장 선택에 대한 칸 50 () 및 수술 테이프로 포장. 16 시간 광주와 실온에서 형광등 불빛 아래에서 문화를 유지한다. </li><li> 길이가 2 주 뿌리 적어도 2cm 멸균 집게와 메스를 사용하여 자엽에서 절제와 MS 칸 50 팀 (300) 미디어를 1/2 전송 - ~ 1.5 후. 하나의 판에 10 ~ 15 뿌리를 전송합니다. 마커와 뿌리 끝의 위치를​​ 표시 외과 테이프로 포장, 문화 방에서 유지한다. </li><li> 일주 후, 형질 전환 뿌리는 선택적 미디어에 성장 볼 수 있습니다. 바람직한 DNA 추출 방법을 이용하여 DNA 추출을 위해 변환 된 뿌리의 표본 수확. 참고 : 자엽과 플레이트가 2 유지 될 수 - 뿌리가 얽힌 엉망으로 성장 지적과 분리하기 어려운 후 3 주간 수확. 비 수확 루트 조직 무한히 유지할 수있다. 분석의 다양한 단리 된 DNA 시료에서 수행 될 수있다들 DNA 돌연변이의 빈도와 유형을 확인합니다. 몇 이러한 분석 결과는 아래에 설명되어 있습니다. </li></ol>

<ol>
	<li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Editing+plant+genomes+with+CRISPR/Cas9.">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li><li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+CRISPR/Cas9+system+for+plant+genome+editing+and+beyond.">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li><li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+editing+of+sweet+orange+using+Cas9/sgRNA.">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li><li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat.">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li><li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model.">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li><li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+genome+modifications+in+soybean+with+CRISPR/Cas9.">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li><li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate:CoA+ligase+specificity+and+redundancy.">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li><li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CCTop:+An+Intuitive,+Flexible+and+Reliable+CRISPR/Cas9+Target+Prediction+Tool.">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li><li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-P:+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants.">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li><li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES.">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li><li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR/Cas9+system.">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li><li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+genome+editing+made+easy:+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR/Cas+system.">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39 (2013).</li><li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9.">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li><li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs.">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li><li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications.">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li><li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+multiplicity+of+hairy+root+cultures:+Prolific+possibilities.">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li><li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.:+sexual+transmission+of+the+transformed+genotype+and+phenotype.">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li><li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Misexpression+of+miR482,+miR1512,+and+miR1515+Increases+Soybean+Nodulation.">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li><li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations.">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li><li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vitro.+composite+plants:+an+inexpensive,+rapid+method+for+root+biology.">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li></ol>

저자는 공개 아무것도 없어.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single, one-hour reaction and gRNA oligos can be pooled to further streamline the cloning procedure. Furthermore, the DNA assembly mechanism is independent of restriction enzymes, which makes this method compatible with virtually any DNA sequence. Conveniently, a master mix of the invariable DNA components (linearized vector, MtU6 promoter, and scaffold) can be made and stored at -20 &#176;C for later assemblies. 
While we use the GN20GG gRNA target motif, there are several alternative gRNA target motifs that can be used17. Shorter gRNAs have been demonstrated to increase specificity in animal cells20. By using a 5' G with a U6 promoter in the gRNA sequence (or A in the case of a U3 promoter), regardless if it matches the intended target sequence, the more abundant target motif N21GG may be used. However, the GN20GG target motif does not present a major technical limitation as several suitable targets can be found in most plant genes. The cloning scheme presented here can be easily modified to accommodate any gRNA design; simply substitute bases in the gRNA oligo.
Another advantage of the DNA assembly cloning system is that the same reagents can be used to insert multiple gRNAs into a single vector. A protocol for two gRNAs is presented here, and with the same methodology, using unique nucleotide sequences21 as spacers between gRNAs, it should be possible to assemble six gRNAs or more in a single cloning reaction.
As presented in step 1.9, the sequential cloning of gRNA vectors into a final multi-gRNA vector will take several days to perform because of the multiple cloning and screening steps. A modification of this protocol permits the construction of multi-gRNA vectors in a single day by bypassing the single-gRNA vector cloning step. First assemble individual gRNAs with just the MtU6 amplicon, gRNA oligo, and scaffold amplicon. Individual reactions must be performed for each gRNA. Following step 1.4, omit the linearized vector and reduce the 50 &#176;C incubation to 15 minutes. A 1:5 dilution of the reactions can be used as template in step 1.9.1. 
A potential problem with step 1.9 is the carry-over of residual single-gRNA plasmids from the PCR amplification of the gRNAs since all plasmids are selected with kanamycin. While we have never observed single-gRNA vectors in any of our colony screens following the specified protocol, gel purification of the PCR products or DpnI treatment of the PCR reactions could be used should the problem occur.
The ability to generate CRISPR vectors in a high-throughput manner necessitates a high-throughput method of generating transgenic materials to use the CRISPR vectors. Hairy roots are well suited for this task as they are technically simple to generate, require relatively little laboratory space to maintain and can be produced in a wide range of plant species22,23. However one limitation is that hairy roots are generally not used to generate whole plants and root systems are not suitable models for investigating most above-ground phenotypes. The former limitation may be advantageous when targeting genes that are null-lethal in whole-plant systems.
An important consideration for any transformation experiment is that results may vary with the different genotypes of plants and bacterial strains used. We routinely induce hairy roots in the cultivar (cv.) Rio Grande but have had difficulty obtaining hairy roots with cv. Moneymaker. Here, we report the use of the A. rhizogenes strain ARqua1, but it should be noted that strain ATCC 15834 has also been reported to work in tomato9.
Another critical consideration for hairy root transformation is the potential for overgrowth of A. rhizogenes on the cotyledon explants. Bacterial overgrowth typically leads to cotyledon death and low transformation efficiencies. Cotyledons must be blotted dry after soaking with A. rhizogenes. Likewise, co-cultivation should be limited to two days to prevent excessive bacterial overgrowth. Some bacterial growth is typically observed on co-cultivation plates, but should be absent once cotyledons are transferred to media containing ticarcillin/clavulanic acid.
The ease of constructing CRISPR vectors and generating hairy roots enables large-scale reverse-genetic screens, similar to those that are used in animal cell culture systems2. Hairy roots have been used to study a variety of plant functions including root development9, symbiotic associations24,25, and nematode resistance26 and the use of hairy roots for screening immunity-related genes is an area of active research in our lab. In addition to overexpression, gene silencing, and other transgenic technologies, targeted gene deletion via CRISPR/Cas9 is a powerful tool for functional genomic studies.

CRISPR와 표적 DNA의 변형을 생성 할 수있는 능력은 / Cas9는 기능 유전체학 연구에 큰 잠재력을 가지고있다. CRISPR / Cas9 시스템의 두 가지 구성 요소가 있습니다; 황색 포도상 구균 화농 및 대상 DNA 사이트 (들) 1 Cas9을 지시 약 100 NT 가이드 RNA (gRNA) 분자에서 파생 된 Cas9 클레아. 표적 인식은 상기 제에 의해 부여된다 ~ 타겟팅 벡터 2,3- 높은 처리량 제조 허용 gRNA의 20 NT. 설계 할 수 있습니다 대부분의 생물은 이미 CRISPR / Cas9 기술 4,5로왔다. 식물 예는 CaMV 35S 프로모터와 같은 구성 성 프로모터에서, 일반적 Cas9 클레아 (6)의 발현을 유도하기 위해 사용된다. gRNAs는 gRNA의 제 1베이스를 제한하는 RNA 중합 효소 III U6 또는 U3 프로모터를 사용하여 표현에 중 하나 G, 효율적인 전사 U3에 대한 U6, 또는 A,합니다. 그러나 RNA 중합 효소 II의 댄스 파티이러한 제한의 무료 oters는 또한 7, 8을 사용하고있다. 다른 gRNAs 다른 효율성과 DNA 돌연변이를 유도하고, 그래서 먼저 전체 공장의 변환에 투자 또는 광범위한 표현형 화면을 설정하기 전에 CRISPR 경로를 확인하는 것이 중요 할 수 있습니다. CRISPR 과도 발현이 곤란 돌연변이와 같은 방식으로 비실용적 표현형 어 세이의 검출을 안정 설비 (6)에 비해 일반적으로 DNA 개질 저주파 결과, 예를 들면 agroinfiltration을 사용하여, 식물 구성한다. 소위 모상근 안정적인 식물 개월 반대로 독립 안정적으로 형질 전환 물질 다수, 주 내에서 발생 될 수 있기 때문에 편리 대체 시스템이다. CRISPR 벡터는 털이 뿌리 9,10에서 DNA 돌연변이를 유도에 매우 효과적이다. DNA 조립 방법은 효율적 overl 함유 DNA 단편을 결찰apping 11을 종료합니다. 일부 DNA 조립 방법의 주요 장점은 조립 된 제품에 ssDNA를 (즉, 올리고)를 통합 할 수있는 능력이다. gRNAs 만 ~ 20 NT 긴 새로운 타겟 합성 올리고 만들어 질 수 있기 때문에, 이러한 DNA 조립 방법 CRISPR 복제에 적합하다. 여기에 설명 된 프로토콜이 성공적으로 대두 10, 포플라 (12)에 사용 된 현재 토마토 CRISPR 벡터의 P201 시리즈에 기초한다. 제시 복제 절차는 현재의 클로닝 방법 (10)에 비해 몇 가지 장점을 제공한다. 즉, 완전히 기능 벡터는 하루에 단일 클로닝 반응에서 생성 될 수있다. 벡터 건설은 더 손에 시간과 재료 비용을 절감, 병렬로 여러 CRISPR 벡터를 생성하기 위해 풀링 할 수 있습니다. 또한 표적 유전자 결실 유전자 물질을 제조하기위한 효율적인 방법으로 토마토 모상근의 생성을위한 프로토콜을 제시한다. 털이 뿌리는 유효한하는 데 사용됩니다CRISPR 벡터를 먹고 이후의 실험 자료를 제공한다.

<table border="0" cellpadding="0" cellspacing="0" width="761">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:219px;">NEBuilder&#174; (HiFi DNA assembly mix)</td>
			<td style="width:139px;">New England Biolabs</td>
			<td style="width:247px;">E5520</td>
			<td style="width:157px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">p201N:Cas9</td>
			<td>Addgene</td>
			<td>59175</td>
			<td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pUC gRNA Shuttle</td>
			<td>Addgene</td>
			<td>47024</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SwaI</td>
			<td>New England Biolabs</td>
			<td>R0604S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SpeI</td>
			<td>New England Biolabs</td>
			<td>R0133S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Zymo clean and concentrator-5 column purification</td>
			<td>Zymo Research</td>
			<td>D4003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 2.1</td>
			<td>New England Biolabs</td>
			<td>B7202S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB CutSmart (Buffer 4)</td>
			<td>New England Biolabs</td>
			<td>B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NEB Buffer 3.1</td>
			<td>New England Biolabs</td>
			<td>B7203S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EconoSpin Mini Spin Column (plasmid prep)</td>
			<td>Epoch Life Sciences</td>
			<td>1910-050/250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EcoRV-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3195S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">StyI-HF&#174;</td>
			<td>New England Biolabs</td>
			<td>R3500S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MS Salts + Gamborg Vitamins</td>
			<td>Phytotechnology Laboratories</td>
			<td>M404</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Phytagel&#8482; (gellan gum)</td>
			<td>Sigma Aldrich</td>
			<td>P8169</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">GA-7 Boxes</td>
			<td>Sigma Aldrich</td>
			<td>V8505</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Micropore&#8482; surgical tape</td>
			<td>3M</td>
			<td>1535-0</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Timentin&#174; (Ticarcillin/Clavulanic acid)</td>
			<td>Various</td>
			<td>0029-6571-26</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Primers 5&#39; -&#62; 3&#39;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SwaI_MtU6F&#160;</td>
			<td colspan="3">GATATTAATCTCTTCGATGAAATTTATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MtU6R&#160;&#160;</td>
			<td colspan="2">AAGCCTACTGGTTCGCTTGAAG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ScaffoldF&#160;</td>
			<td colspan="2">GTTTTAGAGCTAGAAATAGCAAGTT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SpeI_Scaffold R</td>
			<td colspan="3">GTCATGAATTGTAATACGACTCAAAAAAAAGCACCGACTCGGTG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">StUbi3P218R&#160;</td>
			<td colspan="2">ACATGCACCTAATTTCACTAGATGT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ISceIR</td>
			<td colspan="2">GTGATCGATTACCCTGTTATCCCTAG</td>
			<td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_Scaffold R&#160;</td>
			<td colspan="2">GAGAATGGATGCGAGTAATGAAAAAAAGCACCGACTCGGTG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">UNS1_MtU6 F&#160;&#160;</td>
			<td colspan="3">CATTACTCGCATCCATTCTCATGCCTATCTTATATGATCAATGAGG</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">p201R&#160;</td>
			<td colspan="2">CGCGCCGAATTCTAGTGATCG</td>
			<td></td>
		</tr>
		<tr height="21">
			<td colspan="3" height="21" style="height:21px;">Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td>
			<td></td>
		</tr>
	</tbody>
</table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

DNA 어셈블리 CRISPR 벡터 구조는 일반적으로 독립적 인 클론의 수백 수십를 생성합니다. PCR에 의한 식민지 심사 쉽게 올바른 클론을 식별하고와 문제 해결에 유용 삽입 (그림 2A)없이 플라스미드를 구별 할 수 있습니다. 일반적으로, 클론의 모든 인서트를 포함하고 사용자가 완전히 식민지 심사 단계를 건너 뛰도록 선택할 수 있습니다. 진단 다이제스트 (그림 2B)와 생거 시퀀싱은 품질 관리에 사용됩니다. 오류가 발생하는 않는 경우, 그들은 일반적으로, 중첩 DNA 영역에서 관찰되는, 즉, 5 &#39;를 MtU6 촉진제 단부의 gRNA 또는 3&#39;골격 시퀀스의 끝. 여러 gRNA 올리고 단일 반응에 풀링하는 경우 gRNAs은 생거 시퀀싱에 의해 결정된다. 개별 gRNAs의 혼입이 균일하게 분포되고 gRNAs 대부분 (도 2c는 단일 변환으로부터 분리 될 수있다 </strong&gt;). 고 충실도 DNA 어셈블리 믹스는 고성능 버전과 표준 DNA 어셈블리 믹스보다 선호 덜 오류가 발생하기 쉬운 (그림 2C)입니다. 토마토 털이 뿌리는 일반적으로 변환 (그림 3A) 후 2 주를 관찰된다. 길이가 뿌리 ≥2 cm 절제와 선택 배지 및 카나마이신 내성 뿌리 일주일 후에 (그림 3B)에서 확인할 수 있습니다로 전송됩니다. 대부분의 뿌리는 선택적 미디어와 변수가 될 수있는 형질 전환 뿌리에 뿌리 성장에 어느 정도 성장할 것입니다; 가능하다면, 분석을 위해 가장 적극적으로 성장하는 뿌리를 선택합니다. 이 카나마이신 내성 뿌리 하나는 일반적으로 접종 자엽 당 복구됩니다. 일반 전송으로 변환 뿌리는 선택적 미디어에 무기한으로 유지 될 수있다. DNA는 카나마이신 내성 뿌리로부터 추출하고 PCR을 사용하는 충전 앰프Y 대상 지역 (들). PCR 생성물은 클로닝 및 시퀀싱 (도 3C), 제한 단편 길이 다형성 분석, 폴리 아크릴 아미드 겔 전기 영동 (16) (도 3D), T7E1 효소 (16), 또는 높은 처리량 앰플 리콘 서열과 같은 돌연변이 효율을 결정하기 위해 분석하는 다양한 사용될 수있다 10. 선택한 gRNA / 표적 서열에 따라 다른 CRISPR 플랜트 시스템 (6)에보고 된 돌연변이와 돌연변이 효율의 범위를 관찰 할 수있다. <img alt="그림 1" src="/files/ftp_upload/53843/53843fig1.jpg" /> . CRISPR 어셈블리의 원리도 1은 DNA 어셈블리 반응에서, 네 개의 DNA를 함께 혼합하고; p201N : SWA I 및 SPE I (검은 색 원), MtU6 프로모터 (녹색 화살표), 비계 (노란색 막대)와 GN (19) 표적 서열을 포함하는 60 메르 gRNA 올리고 (b를 Cas9이 선형화루 바). 각 DNA 분자의 말단은 인접하는 부재 20 BP 중첩. DNA를 조립 반응은 단일 분자를 원형으로 이들의 DNA를 재조합. 사이트 바인딩 StUbi3p218R과 ISceIR 프라이머는 검은 색 화살표로 표시됩니다의 2x35S : Cas9 카세트, 보라색입니다 StUbi3 : NPTII 카세트 오렌지와 왼쪽과 오른쪽 테두리가 회색 막대로 표시됩니다. 참고 :. 벡터 맵이 확장되지 않습니다 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53843/53843fig2.jpg" /> 그림 2. 식민지의 검사 및 DNA 어셈블리 및 변환 20 클론의 플라스미드 품질 관리. A)는 식민지 검사. M, 100 bp의 사다리; +, p201N : Cas9 : GFPT2 양성 대조군; NI, p201N : Cas9 노 삽입 제어; GA 희석 DNA 조립체 반응; NT, 아니 템플릿 컨트롤. B) 네 p201N 대표 다이제스트 : Cas9 : 제한과 gRNA 벡터는 에코 RV 및 촌 I. 효소 M, 2 로그 사다리. C) 표준과 고성능 DNA 조립 믹스 11 gRNA 올리고는 하나의 반응으로 풀링 된 복구 벡터의 분포의 충실도의 비교. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/53843/53843fig3.jpg" /> 그림 3. 털이 루트 문화와 DNA 변형의 검출. A) 털이 뿌리 11 일 후에 변환. B 자엽에서 신흥 볼 수 있습니다) 뿌리 약 1 주일 ½ MS 칸 (50) 미디어에 선택됩니다. 회색 막대가 복제의 예) 도금. C시 뿌리 끝의 위치를 의미하고순서는 네 가지 털이 루트 행사에 두 개의 서로 다른 유전자를 대상으로 DNA의 돌연변이를 확인합니다. 회색 박스 Δ 돌연변이 유형 및 DNA 변이를 결정하기 위해 지정된 돌연변이. D) 폴리 아크릴 아미드 겔 전기 영동의 예에 클론의 수를 나타내고, GN 20 GG 표적 서열을 나타낸다. 대형 삭제 및 heteroduplex를 띠는 표적 서열에서 DNA 돌연변이의 존재를 나타낸다. 12 독립적 인 이벤트 식스는 돌연변이 (Δ)로 득점했다. WT, 야생형 제어부; NT, 아니 템플릿 컨트롤. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

토마토 털이 뿌리의 생성에 의한 높은 처리량 CRISPR 벡터 건설 및 DNA 수정의 특성

DNA 조립체를 사용하여, 여러 CRISPR 벡터가 CRISPR 다수의 구성을 하나 복제 반응에 병렬로 구성 될 수있는 간단한 작업 벡터. 토마토 털이 뿌리는 CRISPR 경로를 확인하고 돌연변이 물질을 생성 할 수있는 훌륭한 모델 시스템입니다.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Nanyang Technological University

Research

JoVE Journal

Biology

17.8K 조회수.  Boyce Thompson Institute for Plant Research.  DNA 조립체를 사용하여, 여러 CRISPR 벡터가 CRISPR 다수의 구성을 하나 복제 반응에 병렬로 구성 될 수있는 간단한 작업 벡터. 토마토 털이 뿌리는 CRISPR 경로를 확인하고 돌연변이 물질을 생성 할 수있는 훌륭한 모델 시스템입니다. 

비디오: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Generation of RNA/DNA Hybrids in Genomic DNA by Transformation using RNA-containing Oligonucleotides

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be produced to contain any desired DNA or RNA sequence and can be prepared to include a wide variety of base and sugar modifications. Moreover, oligos can be designed to mimic specific nucleic acid alterations and thus, can serve as important tools to investigate effects of DNA damage and mechanisms of repair. We found that Thermo Scientific Dharmacon RNA-containing oligos with a length between 50 and 80 nucleotides can be particularly suitable to study, in vivo, functions and consequences of chromosomal RNA/DNA hybrids and of ribonucleotides embedded into DNA. RNA/DNA hybrids can readily form during DNA replication, repair and transcription, however, very little is known about the stability of RNA/DNA hybrids in cells and to which extent these hybrids can affect the genetic integrity of cells. RNA-containing oligos, therefore, represent a perfect vector to introduce ribonucleotides into chromosomal DNA and generate RNA/DNA hybrids of chosen length and base composition. Here we present the protocol for the incorporation of ribonucleotides into the genome of the eukaryotic model system yeast /Saccharomyces cerevisiae/. Yet, our lab has utilized Thermo Scientific Dharmacon RNA-containing oligos to generate RNA/DNA hybrids at the chromosomal level in different cell systems, from bacteria to human cells.

This work shows how to form an RNA/DNA hybrid at the chromosomal level and reveal transfer of genetic information from RNA to genomic DNA in yeast cells.

RNA 함유 Oligonucleotides를 사용하여 변환하여 게놈 DNA에서 RNA / DNA 하이브리드의 생성

Synthetic short nucleic acid polymers, oligonucleotides (oligos), are the most functional and widespread tools of molecular biology. Oligos can be ...

연구

생물학

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping project is to collect a tissue sample from each individual plant. The traditional approach to this task is to sample plants one-at-a-time. If one wishes to genotype hundreds or thousands of individuals, however, using this strategy results in a significant bottleneck in the genotyping pipeline. The Ice-Cap method that we describe here provides a high-throughput solution to this challenge by allowing one scientist to collect tissue from several thousand seedlings in a single day 1,2. This level of throughput is made possible by the fact that tissue is harvested from plants 96-at-a-time, rather than one-at-a-time.
The Ice-Cap method provides an integrated platform for performing seedling growth, tissue harvest, and DNA extraction. The basis for Ice-Cap is the growth of seedlings in a stacked pair of 96-well plates. The wells of the upper plate contain plugs of agar growth media on which individual seedlings germinate. The roots grow down through the agar media, exit the upper plate through a hole, and pass into a lower plate containing water. To harvest tissue for DNA extraction, the water in the lower plate containing root tissue is rapidly frozen while the seedlings in the upper plate remain at room temperature. The upper plate is then peeled away from the lower plate, yielding one plate with 96 root tissue samples frozen in ice and one plate with 96 viable seedlings. The technique is named "Ice-Cap" because it uses ice to capture the root tissue. The 96-well plate containing the seedlings can then wrapped in foil and transferred to low temperature. This process suspends further growth of the seedlings, but does not affect their viability. Once genotype analysis has been completed, seedlings with the desired genotype can be transferred from the 96-well plate to soil for further propagation. We have demonstrated the utility of the Ice-Cap method using Arabidopsis thaliana, tomato, and rice seedlings. We expect that the method should also be applicable to other species of plants with seeds small enough to fit into the wells of 96-well plates.

Ice-Cap: A Method for Growing Arabidopsis and Tomato Plants in 96-well Plates for High-Throughput Genotyping

The Ice-Cap method allows one to grow plants in 96-well plates and non-destructively harvest root tissue from each seedling. DNA extracted from this root tissue can be used for genotyping reactions. We have found that Ice-Cap works well for Arabidopsis thaliana, tomato, and rice seedlings.

얼음 총액 : 성장을위한 방법 Arabidopsis높은 처리량 Genotyping을위한 96 - 웰 플레이트에와 토마토 식물

It is becoming common for plant scientists to develop projects that require the genotyping of large numbers of plants. The first step in any genotyping ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

CRISPR / 카스 시스템의 Endonucleases을위한 기판 생성

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

높은 처리량 시퀀싱을위한 고품질 염색질 면역 침전의 DNA 템플릿의 생성 (칩 SEQ)

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of particular interest for epigenetic studies as it has been demonstrated to be both a long lasting and a dynamic regulator of gene expression. Efforts to examine epigenetic changes in health and disease have been hindered by the lack of high-throughput, quantitatively accurate methods. With the advent and popularization of next-generation sequencing (NGS) technologies, these tools are now being applied to epigenomics in addition to existing genomic and transcriptomic methodologies. For epigenetic investigations of cytosine methylation where regions of interest, such as specific gene promoters or CpG islands, have been identified and there is a need to examine significant numbers of samples with high quantitative accuracy, we have developed a method called Bisulfite Amplicon Sequencing (BSAS). This method combines bisulfite conversion with targeted amplification of regions of interest, transposome-mediated library construction and benchtop NGS. BSAS offers a rapid and efficient method for analysis of up to 10 kb of targeted regions in up to 96 samples at a time that can be performed by most research groups with basic molecular biology skills. The results provide absolute quantitation of cytosine methylation with base specificity. BSAS can be applied to any genomic region from any DNA source. This method is useful for hypothesis testing studies of target regions of interest as well as confirmation of regions identified in genome-wide methylation analyses such as whole genome bisulfite sequencing, reduced representation bisulfite sequencing, and methylated DNA immunoprecipitation sequencing.

Bisulfite amplicon sequencing (BSAS) is a method for quantifying cytosine methylation in targeted genomic regions of interest. This method uses bisulfite conversion paired with PCR amplification of target regions prior to next-generation sequencing to produce absolute quantitation of DNA methylation at a base-specific level.

DNA 메틸화 분석 차세대 시퀀싱 대상

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

후 전사적으로 규제 유전자의 화학 변조기에 대한 높은 처리량 검사

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-SEQ : 아데닌 - 메틸화 된 DNA 단편의 높은 처리량 시퀀싱에 의해 단백질 DNA 상호 작용의 게놈 넓은 매핑

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

레트로 바이러스 통합 사이트의 증폭, 차세대 시퀀싱 및 게놈 DNA 매핑

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Isolation, Characterization, And High Throughput Extracellular Flux Analysis of Mouse Primary Renal Tubular Epithelial Cells

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). Therefore, assessing mitochondrial function in primary TECs may provide valuable insight into the bioenergetic status of the cells, providing insight into the pathophysiology of CKD. While there are a number of complex protocols available for the isolation and purification of proximal tubules in different species, the field lacks a cost-effective method optimized for&#160;tubular cell isolation without the need for purification. Here, we provide an isolation protocol that allows for studies focusing on both primary mouse proximal and distal renal TECs. In addition to cost-effective reagents and minimal animal procedures required in this protocol, the isolated cells maintain high energy levels after isolation and can be sub-cultured up to four&#160;passages, allowing for continuous studies. Furthermore, using a high throughput extracellular flux analyzer, we assess the mitochondrial respiration directly in the isolated TECs in a 96-well plate for which we provide recommendations for the optimization of cell density and compound concentration. These observations suggest that this protocol can be used for renal tubular ex vivo studies with a consistent, well-standardized production of renal TECs. This protocol may have broader future applications to study mitochondrial dysfunction associated with renal disorders for drug discovery or drug characterization purposes.

This protocol provides a cost-effective approach to isolate and characterize mouse primary renal tubular cells that can subsequently be sub-cultured to assess renal biological functions ex vivo, including mitochondrial bioenergetics.

마우스 기본 신장 관 상피 세포의 고립, 특성, 및 높은 처리량 세포 외 유출 분석

Mitochondrial dysfunction in the renal tubular epithelial cells (TECs) can lead to renal fibrosis, a major cause of&#160;chronic kidney disease (CKD). ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

다음-세대 16S rRNA Amplicon 시퀀싱에 의해 틱 미생물 특성

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...