이 프로젝트에 대 한 지원 자금 기본 과학 연구 프로그램을 통해 국가 연구 재단의 한국 (NRF) 과학과 ICT (2016R1A2B2006354)에 의해 자금에 의해 제공 되었다.

1입니다. 미디어 준비
<ol><li>준비 효 모 추출 보충 교재 (예), 네 아데닌 (예 로우 에이드), Pombe 조미료 매체 (PMG12), 그리고 PMG 없이 아데닌 (PMG-Ade) 없이 표 1에 설명 된 대로 구성 요소를 혼합 하 여. 예-에이드 (Ade 낮은)와 PMG-에이드 접시 같은 구성 요소를 모두 하지만 아데닌 후자에서 생략 됩니다.<ol>
<li>다음 소금 (50 x) 주식을 사용: 52.5 g/L MgCl2·6H2O, 2 g/L CaCl2·2H2O, 50 g/L KCl, 2 g/L 나24 에 증류수 그래서. 필터는 0.22 μ m 기 공 크기 필터를 사용 하 여 소독 및 4 ° c.에 저장</li>
		<li>다음과 같은 비타민을 사용 하 여 (1, 000 x) 주식: 1 g/L pantothenate, 10 g/L 니코틴산 산, 이노 시 톨 10 g/L, 증류수 비오 틴 10 mg/L. 필터는 0.22 μ m 기 공 크기 필터를 사용 하 여 소독 및 4 ° c.에 저장</li>
		<li>다음 미네랄을 사용 하 여 (10, 000 x) 주식: 붕 5 g/L, 4 g/L MnSO4, 4 g/L ZnSO4·7H2O, 2 g/L FeCl2·4H2O, 0.4 g/L MoO3, 1 g/L 0.4 g/L CuSO4·5H2O 기 증류수에 연산 10 g/L. 필터는 0.22 μ m 기 공 크기 필터를 사용 하 여 소독 및 4 ° c.에 저장 참고: 네 액체 매체는 agar를 생략 하 여 만들 수 있습니다.</li>
	</ol>
</li>
	<li>압력솥 매체 200 rpm의 속도로 저 어 바 교 반 하면서 60 ° C 아래에 그것을 냉각 하 고.</li>
	<li>예 + G418 (geneticin) 판 예 매체 1 mL/L G418 재고 솔루션을 추가 합니다.<ol>
<li>다음 G418 사용 (1, 000 x) 주식: 100 mg/mL 증류수에 G418. 필터-20 ° c.에 0.22 μ m 기 공 크기 필터, 1.5 mL 원심 분리기 튜브 및 저장소에 aliquot를 사용 하 여 소독</li>
	</ol>
</li>
	<li>또 다른 5-10 분, 약 수에 대 한 미디어 90 mm 페 트리 접시 (대략 40 접시를 중간 aliquots의 1 L에 저. 4 ° c.에 접시를 저장</li>
</ol>2. 복제 rpt4 + 와 그것의 5' / 3' Utr의
<ol><li>PCR 뇌관 p1와 p2 수행 (그림 1A) 분열을 사용 하 여 50 µ L (~ 1 µ g DNA, 20 U 효소 반응 버퍼 x 1)의 총 볼륨에 템플릿으로 genomic DNA (gDNA)를 효 모 그리고 3,315 베이스 증폭 반응 사이클을 표 2 에 설명 된 적용 쌍 (bp) 조각 rpt4 + 및 그것의 5' / 3' Utr. (그림 1A) 제조업체 지시에 따라 정화 키트13 를 사용 하 여 PCR 제품을 정화.</li>
	<li>PBlueScript KS(-) 벡터14 16 18 물 목욕에서 37 ° C에서 rpt4 + 와 그것의 5' / 3' Utr BamH1 와 Xho1 (~ 1 µ g의 DNA, 효소, U-20-1 x 소화 버퍼) 20 µ L의 전체 볼륨에 포함 된 증폭된 한 DNA 파편을 소화 h (그림 1B)입니다.</li>
	<li>젤 소화 벡터 (1.2 %agarose 젤)를 정화 하 고 태 기반 agarose 젤 전기 이동 법 (100 V, 1 시간)을 수행, 원하는 크기의 DNA 밴드를 절 개 하 고 젤 추출 키트15DNA를 분리 하 여 DNA 삽입.</li>
	<li>벡터 및 벡터 DNA의 50-100 ng를 포함 20 µ L 결 찰 반응을 수행 하 여 T4 DNA 리가 사용 하 여 DNA 삽입을 위하여는 ~ 삽입 DNA, 400 U T4 DNA 리가 고 결 찰 버퍼 x 1의 3 어 금 니 과잉. 16-18 h 18 ° C에이 혼합물을 품 어.</li>
	<li>열 충격 70을 적용 하 여 합자 DNA를 대장균 DH5α의 100 µ L에 변환 42 ° c.에 s 파운드의 1 mL을 추가 하 고 복구에 대 한 37 ° C에서 1 시간에 품 어. 원심 (13,800 x g)를 변형된 대장균 의 모든 파운드-암 피 실린 (라) 접시에 셀 16 h 37 ° C에서 품 어, 표면에 뜨는 접시를 삭제 합니다.</li>
	<li>이쑤시개와 4-8 식민지를 선택 하 고 하룻밤 3 mL 라 중간에서 37 ° C에서 성장.</li>
	<li>한 플라스 미드 정화 키트16 제조업체의 프로토콜에 따라 사용 되는 플라스 미드를 분리 하 고 고립 된 플라스 미드, 각 제한 효소 (BamH1 및 의 U 5의 5 µ L로 분석 금지 효소 소화를 수행 Xho1) 제한 버퍼 1. 3 헤 시퀀싱 후보 플라스 미드로 복제 하는 확인에 대 한 물 목욕에서 37 ° C에서 반응 혼합물을 품 어.</li>
</ol>3. 침묵 돌연변이 (Xho1 제한 사이트) 소개
<ol><li>한 쌍의 33-bp 뇌관 (p3 및 p4) 그렇지 않으면 보완 순서로 원하는 돌연변이 포함 하는 디자인.</li>
	<li>25 µ L의 전체 볼륨에 높은 중 합 효소17 (그림 1C) PCR을 수행 (10 복제 플라스 미드, 10 pmol 뇌관 믹스, 2 U 효소, 1 x 반응 버퍼 2 µ L의 ng) 자전거 매개 변수를 사용 하 여 표 3에 나열 된.</li>
	<li>DpnI 20 µ L (20 U 효소, 1 x 소화 버퍼) 37 ° c 물에서의 전체 볼륨에 h 1에 대 한 목욕으로 템플릿 플라스 미드를 소화.</li>
	<li>변환 하 고, 전파 하 고 분리, 한 시퀀싱 단계 2.5-2.7에서에서 설명한 대로 자동 돌연변이 포함 하는 플라스 미드. 참고: 또한 단일 반응18여러 DNA 파편의 합류에 대 한 허용 하는 복제 메서드를 사용 하 여 자동 돌연변이 도입 수 있습니다.</li>
</ol>4. 무작위 Mutagenesis의 rpt4 + 오류가 PCR에 의해
<ol><li>서식 파일, 뇌관 p5 및 p6, 50 µ L (단계 4.1.1, 10 pmol 뇌관 믹스, 2.5 U 효소, 1 x 반응 버퍼 2 µ L에서에서 정의 하는 서식 파일의 금액)의 총 볼륨으로 침묵 돌연변이 (Xho1 사이트)와 플라스 미드를 사용 하 여 오류가 PCR을 수행 그리고 높은 오류를 생성 하도록 설계 된 특별 한 중 합 효소 평가19 (그림 1D). 표 2에 설명 된 대로 PCR을 수행 합니다.<ol>
<li>서식 파일 플라스 미드의 4-5 µ g를 사용 하 여 1 bp/kb (kilobase) 돌연변이 주파수를 제어. 참고: 고 농도 (> 500 ng / µ L) 소형 예비 키트20를 사용 하 여 얻을 수 있습니다, 플라스 미드의 필수입니다.</li>
	</ol>
</li>
	<li>젤 전기 이동 법을 사용 하 여 확인 (1.2 %agarose 젤) 2670 bp의 PCR 제품. 2.5 단계에서 설명한 대로 젤이 PCR 제품을 정화.</li>
</ol>5. 퓨전 PCR 파편 (칸, 3' UTR)의 준비
<ol><li>서식 파일, 프라이 머 p 7과 p8,으로 pFA6a KANMX621 을 사용 하 여 PCR을 수행 하 고 마커 (칸) 조각을 표 4에 나열 된 조건. 젤 단계 2.5 (그림 1E)에 설명 된 대로 결과 1480-bp 조각 정화.<ol>
<li>정지 codon 돌연변이 그것의 인접 한 유전자의 코딩 지구에 대 한 타겟 유전자의 500 이상의 구분 됩니다 경우 확인 혈압. 이 지구는 500 미만 때 생 터미네이터 사용할 수 없습니다 혈압; 오히려, ADH 터미네이터 생 터미네이터 대신 사용 되어야 한다. ADH 터미네이터를 사용 하는 데 필요한 프로토콜 변경 표 5에 표시 됩니다. 참고: 이러한 변경 내용은 ADH 터미네이터 pFA6a-3HA-KANMX6 플라스 미드에서 사용할 수 있는 내 생 터미네이터 대신 사용 하는 경우에 적용 됩니다.</li>
	</ol>
</li>
	<li>PCR를 수행 하는 복제 rpt4 +-템플릿과 뇌관 p9, p10 50 µ L의 총 볼륨에서으로 벡터를 포함 (20 복제 플라스 미드, 10 pmol 뇌관 믹스, 2 U 효소, 1 x 반응 버퍼 2 µ L의 ng), 표 6에 제시 하는 조건을 사용 하 여. 젤 정화 획득 506-혈압 3' UTR 조각 (그림 1E).</li>
</ol>6. 퓨전 PCR (그림 1E)에 의해 변환 구문이 생성
<ol><li>50 ng / µ L에서 3 조각 (mutagenized rpt4 +, 칸, 그리고 3' UTR)를 준비 합니다.</li>
	<li>퓨전 3의 PCR 파편 뇌관 p11 및 p12를 사용 하 여 표 7에 설명 된 대로 수행 합니다. (융해 PCR 프로토콜은 원래 프로토콜22의 수정입니다.) 주요 4,398 bp의 PCR 제품을 정화.<ol>
<li>Rpt4 +사용: KAN:3'UTR 1의 비율로 조각: 최적의 결과 대 한 3:1. 참고: 삽입 DNA의 총 금액 500을 넘지 말아야 한다 니. Rpt4 +의 권장된 금액: KAN:3' UTR는 50 ng:150 ng:50 ng. Mutagenized 지역에서 약 1.6 kb가 이므로 다른 3 돌연변이 되 고 각 자료의 모든 가능한 조합에 대 한 계정을 것 이라고 하는 효 모 식민지의 최소 수는 1, 600 x 3 = 4800 식민지. 한 변환 반응 일반적으로 400-500 식민지 수율, PCR 건설 융합의 가치가 10 반응 필요 합니다. 이 필요 10의 요인에 의해 단순히 증가 반응 (즉, PCR 튜브의 수)에 의해 충족 될 수 있다.</li>
	</ol>
</li>
</ol>7. 변화의 Electroporation (그림 1 층)으로 분열 효 모
<ol><li>16 시간 이상 배양 하 여 누 룩 채도 예 매체의 10 mL을 접종.</li>
	<li>600에서 광학 밀도를 셀 희석 예 매체의 0.2에서 200 mL의 nm (OD600)와 OD600 5-6 h 동안 흔들어 30 ° C에 품 어 = 0.6-0.8.</li>
	<li>OD600 세포 집중 = 30, 4 개의 50 mL 원뿔 관에 분배 하 고 10 분 동안 얼음에 진정.</li>
	<li>4 ° c.에 3 분 1050 x g에서 원심 분리를 수행 하 여 셀을 수확 얼음에 튜브와 10 전기-큐 벳을 놓습니다. 얼음에 7.3 7.8 단계를 수행 합니다.</li>
	<li>삭제는 상쾌한 고 1.2 M sorbitol의 15 mL를 추가 합니다. 부드럽게 튜브 resuspend 세포를 흔들어.</li>
	<li>1050 x g 4 ° c.에 3 분에 세포를 원심</li>
	<li>7.4 및 7.5 단계를 반복 합니다. 폐기는 상쾌한. 각 관에 1.2 M sorbitol의 500 µ L을 추가 하 고 셀, resuspend 한 15 ml 원뿔 튜브에 세포의 모든 수집.</li>
	<li>1.2 M sorbitol 추가 최대 2.4 mL (OD600 = 0.2 mL 당 10). 얼음에 튜브를 유지.</li>
	<li>Sorbitol 중단 셀 (그들은 완전히 일시 중지 되었는지 확인)의 200 µ L 추가 퓨전 PCR을 포함 하는 EP 튜브 구성, 잘, 그리고 전기 멧에 샘플을 전송.</li>
	<li>Electroporate 다음 옵션으로 셀: 버섯, ShS (2.00kV, 1 펄스).</li>
	<li>800 µ L의 전체 볼륨에 대 한 각 전기 멧을 1.2 M sorbitol의 600 µ L을 추가 하 고 4 예 판 (200 µ L/접시)에 셀을 확산. 10 전기-큐 벳 것 이다 분배 40 예 판.</li>
	<li>24 h 30 ° C에서 번호판을 품 어.</li>
	<li>예 + G418 도금 복제를 수행 하 고 3 일 동안 30 ° C에서 번호판을 품 어.</li>
</ol>8. 섬으로 불안정 돌연변이 및 판정에 대 한 검사의 선택
<ol><li>각 예 + G418 플레이트에 대 한 예-에이드 (Ade 낮은) PMG-에이드 (Ade 없음) 접시를 복제 도금을 수행 합니다. 예-에이드 접시에 식민지의 일부 빨간 채색 (그림 1G) 표시 될 때까지 30 ° C에서 1-2 일에 대 한 복제 판을 품 어.</li>
	<li>예-에이드와 PMG-에이드와 예 에이드 접시에 분홍색 또는 흰색을 표시 하 고 또한 PMG-에이드 접시에 성장 하는 선택 셀을 비교 합니다. 그들은 가양성 (예를 들어, 칸 카세트는 게놈에서 비 대상 사이트에 통합 되어 반영) PMG-에이드에 성장 없이 식민지를 선택 하지 마십시오.</li>
	<li>각 식민지에서 약 1 × 105 셀을 선택 하 고 포함 된 식민지 PCR (그림 1 H)에 대 한 시작 템플릿으로 수행 하기 위해이 솔루션의 적어도 30 분 사용 1 µ L 37 ° C에서 2.5 mg/mL zymolyase 100 T SPZ 솔루션의 10 µ L에서 품 어.<ol>
<li>2m sorbitol의 30 mL, 4.05 mL의 1 M 나2HPO4, 0.95 mL NaH2포4 증류수 (최종 pH 7.5) 15 mL를 혼합 하 여 SPZ (50 mL)을 확인 합니다. 샘플 (5 mL) zymolyase 보충 고 사용까지-20 ° C에서 500 µ L aliquots에 저장 될 수 있습니다.</li>
	</ol>
</li>
	<li>젤 전기 이동 법 (1.2 %agarose 젤, 180V, 20 분)의 결과 + 식민지 PCR 시각화를 수행 합니다. 선택 적절 한 크기의 PCR 악대를 전시 하 고 Xho와 각 반응 제품의 5 µ L를 소화 하는 반응 (4 U 효소, 1 x 소화 버퍼, 37 ° C 물 목욕, 1 시간)을 화면으로 가양성 (그림 1 H).</li>
	<li>XhoI 소화 (1.2 %Agarose 젤, 180 V, 20 분)을 시각화 하기 위해 젤 전기 이동 법을 수행 합니다. 식민지 PCR 제품은 XhoI, 절단 및 예 + G418 번호판 (그림 1I) 패치를 표시 합니다.</li>
	<li>분열 효 모 세포에서 gDNA를 분리 하 고 PCR 제품23의 시퀀싱을 수행. 돌연변이 (그림 1I)를 식별 하는 야생-타입 시퀀스와 얻은 시퀀스를 비교 합니다.</li>
	<li>직접 다시 돌연변이 세포23에서 PCR에 의해 증폭 퓨전 구문으로 변환 하 여 야생-타입 셀에 mutation(s)를 소개 합니다. 새로 만든된 돌연변이 세포 (그림 1J)에 표현 형을 확인 하기 위해 안보를 사용 합니다.<ol>
<li>퓨전 변환 구문을 증폭 하실 수 있습니다 쉽게 PCR에 의해 뇌관 p1와 p10 50 µ L (~ 1 µ g DNA, 20 U 효소 반응 버퍼 x 1)의 총 볼륨에 템플릿으로 돌연변이의 게놈 DNA를 사용 하 고 표 2에에서 설명 된 반응 사이클을 적용 . 구성의 변화 단계 7.1-7.13에 따라 수행할 수 있습니다.</li>
	</ol>
</li>
</ol>

<ol>
	<li>Pritchard, L., Corne, D., Kell, D., Rowland, J., Winson, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+model+of+error-prone+PCR.">A general model of error-prone PCR.</a> J Theor Biol. 234 (4), 497-509 (2005).</li><li>Pfeifer, G. P., You, Y. H., Besaratinia, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+induced+by+ultraviolet+light.">Mutations induced by ultraviolet light.</a> Mutat Res. 571 (1-2), 19-31 (2005).</li><li>Moreno, S., Klar, A., Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+genetic+analysis+of+fission+yeast+Schizosaccharomyces+pombe.">Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.</a> Methods Enzymol. 194, 795-823 (1991).</li><li>Selifonova, O., Valle, F., Schellenberger, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+evolution+of+novel+traits+in+microorganisms.">Rapid evolution of novel traits in microorganisms.</a> Appl Environ Microbiol. 67 (8), 3645-3649 (2001).</li><li>Cohen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+DNA+shuffling+works.">How DNA shuffling works.</a> Science. 293 (5528), 237 (2001).</li><li>Sahu, P. P., Sharma, N., Puranik, S., Chakraborty, S., Prasad, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tomato+26S+Proteasome+subunit+RPT4a+regulates+ToLCNDV+transcription+and+activates+hypersensitive+response+in+tomato.">Tomato 26S Proteasome subunit RPT4a regulates ToLCNDV transcription and activates hypersensitive response in tomato.</a> Sci Rep. 6, 27078 (2016).</li><li>Xu, Q., Singer, R. A., Johnston, G. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sug1+modulates+yeast+transcription+activation+by+Cdc68.">Sug1 modulates yeast transcription activation by Cdc68.</a> Mol Cell Biol. 15 (11), 6025-6035 (1995).</li><li>Bhat, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+ATPase+Sug1+plays+a+critical+role+in+regulating+MHC+class+II+transcription.">The 19S proteasome ATPase Sug1 plays a critical role in regulating MHC class II transcription.</a> Mol Immunol. 45 (8), 2214-2224 (2008).</li><li>Chang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Gal4+activation+domain+binds+Sug2+protein,+a+proteasome+component,+in+vivo+and+in+vitro.">The Gal4 activation domain binds Sug2 protein, a proteasome component, in vivo and in vitro.</a> J Biol Chem. 276 (33), 30956-30963 (2001).</li><li>Ekwall, K., Cranston, G., Allshire, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fission+yeast+mutants+that+alleviate+transcriptional+silencing+in+centromeric+flanking+repeats+and+disrupt+chromosome+segregation.">Fission yeast mutants that alleviate transcriptional silencing in centromeric flanking repeats and disrupt chromosome segregation.</a> Genetics. 153 (3), 1153-1169 (1999).</li><li>Grewal, S. I., Jia, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterochromatin+revisited.">Heterochromatin revisited.</a> Nat Rev Genet. 8 (1), 35-46 (2007).</li><li>Forsburg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Forsburg Lab Recipes: Fission Yeast Media. , (2011).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick PCR Purification Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> pBlueScript II Vector. , (2005).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QIAquick Gel Extraction Kit. , (2013).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> QuickGene SP Kit Plasmid Kit II (SP-PL2). , (2016).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PfuUltra High-fidelity DNA Polymerase. , (2004).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gibson Assembly Master Mix. , (2017).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> GeneMorph II Random Mutagenesis Kits. , (2012).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Plasmid Plus Midi Kit. , (1999).</li><li>Bahler, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterologous+modules+for+efficient+and+versatile+PCR-based+gene+targeting+in+Schizosaccharomyces+pombe.">Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.</a> Yeast. 14 (10), 943-951 (1998).</li><li>Szewczyk, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+PCR+and+gene+targeting+in+Aspergillus+nidulans.">Fusion PCR and gene targeting in Aspergillus nidulans.</a> Nat Protoc. 1 (6), 3111-3120 (2006).</li><li>Nurse, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Fission Yeast Handbook. , (2000).</li><li>Seo, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+19S+proteasome+is+directly+involved+in+the+regulation+of+heterochromatin+spreading+in+fission+yeast.">The 19S proteasome is directly involved in the regulation of heterochromatin spreading in fission yeast.</a> J Biol Chem. , (2017).</li><li>Tang, N. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterisation+of+temperature+sensitive+mutants+of+genes+encoding+the+fission+yeast+spindle+pole+body.">Generation and characterisation of temperature sensitive mutants of genes encoding the fission yeast spindle pole body.</a> PeerJ Preprints. 5, e3377v3371 (2017).</li><li>Rasooly, A., Weisz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+antibacterial+activities+of+phloxine+B+and+other+halogenated+fluoresceins+against+methicillin-resistant+Staphylococcus+aureus.">In vitro antibacterial activities of phloxine B and other halogenated fluoresceins against methicillin-resistant Staphylococcus aureus.</a> Antimicrob Agents Chemother. 46 (11), 3650-3653 (2002).</li><li>Wilson, D. S., Keefe, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Random+mutagenesis+by+PCR.">Random mutagenesis by PCR.</a> Curr Protoc Mol Biol. , (2001).</li></ol>

저자는 공개 없다.

오류가 PCR 통해 임의의 mutagenesis 주어진된 지역에서 돌연변이의 다양 한 풀을 생성 하기 위한 강력한 도구입니다. 이 기술은 특정 상황에서 단백질의 기능을 평가 하는 연구에 대 한 특히 유용 합니다. 예, 우리는 여기는 19S 프로테아좀 소 단위, Rpt4, 섬으로 유지 보수에서의 기능을 평가 하기 위해 오류가 PCR을 사용. 변화 하 여 지역 오류가 PCR에 의해 표적으로 하 고 심사 조건 조정, 우리 관심 및 원하는 표현 형에 대 한 스크린의 게놈 영역에서 셀을 변경할 수 있었다. 최근, 스핀 들 극 신체 구성 요소25에서 돌연변이 은닉 하는 분열 효 모 세포를 분리 하는 유사한 방법 사용 되었다.
무작위 mutagenesis의 주요 장점은 모두 비 필수 및 필수 유전자에 적용할 수 있습니다. 필수적인 유전자의 무작위 mutagenesis 세포 생존 능력 지속 될 수 있도록 하는 미묘한 또는 부분적 기능 오류 등 다양 한 돌연변이 또는 돌연변이 그 함수는 특정 조건 에서만 영향을 얻을 수 있습니다. 후자의 예로 온도 민감한 돌연변이 있습니다. 이러한 돌연변이 5 mg/L phloxine B, 빨간색으로 죽어가는 세포 얼룩 하 고 느린-성장 셀 셀26죽어 구별 될 수 있습니다을 사용 하 여 격리 될 수 있습니다.
이 프로토콜의 중요 한 단계 오류가 PCR 단계가입니다. 이 단계에서 그것은 PCR 주기 수 및 서식 파일의 초기 크기에 따라서 넓게 변화할 수 있다 돌연변이 주파수를 제어 하는 것이 중요. 좋습니다는 사용자 PCR 주기 수를 수정 하 고 서식 파일의 초기 크기를 다 우리가이 최적화를 위한 더 편리 하 게 전략을 발견. 우리 주의 오류가 PCR의 기술을 널리 수십 년 동안 왔다. 사용자가 선택, 그들은 수동으로 오류가 PCR27 상용 mutagenesis 키트를 사용 하지 않고 수행 하는 방법을 찾고 있습니다.
주의로이 프로토콜의 잘못 된 긍정적인 평가 보다 높습니다. 따라서, 돌연변이 후보자는 일련의 잘못 된 반응을 제거 하기 위한 검 진을 받아야 한다. 우리는 대상 유전자에 제한 사이트의 자동 법인 시퀀싱의 상대적으로 힘 드는 단계로 주제 가양성 필요가 없도록 도울 수 있다 발견. 이것은 비용, 또는 넘어 수백에 돌연변이 후보 번호 수 있습니다.

앞으로 유전학 연구원 추구 특정 표현 형을 표시 하는 자연적 사건 돌연변이 및 유전 분석을 수행 고전적인 방법입니다. 반전 유전학에서 관심사의 유전자에 돌연변이 소개 하 고 표현 형 검사. 후자의 경우 대상 유전자의 무작위 mutagenesis 이후에 온도 감도 등 원하는 고기에 대 한 선택 또는 효소 활동을 변경 하는 돌연변이의 풀을 생성 하 자주 사용 됩니다. 다양 한 방법은 오류가 PCR1;를 포함 하 여 임의의 mutagenesis 달성 하는 데 사용할 수 있습니다. UV 방사선 조사2. 화학 mutagens, 에틸 methanesulfonate (EMS) 등 질소 산3; - mutD5 4; 표현 등 임시 mutator 긴장의 사용 그리고 DNA5를 걸어 갔다입니다.
여기, 우리는 우리 분열 효 모에 대상 유전자 돌연변이 풀을 생성 하는 오류가 PCR을 이용 하는 반전 유전학 전략을 설명 합니다. 로 한의 이름에서이 메서드는 PCR 동안 일부러 오류를 도입 하 여 돌연변이 생성 합니다. 다른 mutagenesis 방법과 달리 오류가 PCR mutagenized 될 영역을 정의 하는 사용자 수 있습니다. 이것은 관심사의 단백질/도메인의 기능을 연구 하는 노력에 특히 유용 하다.
이 무작위 mutagenesis 절차를 보여, 우리 여기 사용 rpt4 +, 19S 프로테아좀 소 단위를 인코딩하는 예를 들어. Rpt4 분열 효 모6,7,,89, 다른 유기 체에 있는 베이스-독립적인 기능을가지고 표시 되었습니다 및 베이스 결함 단백질을 변경 하 여 간접 효과 일으킬 수 있습니다. 수준입니다. 우리는, 그러므로, 섬으로에 프로테아좀의 기능을 조사 하는 목적으로 베이스-독립적인 변화를 유발 하는 돌연변이 대 한 검사.
오류가 PCR 뇌관을 바인딩할 위치를 조정 하 여 어떤 유전자 영역에 적용할 수 있습니다. 적절 한 기자와 원하는 phenotypic 변화 하는 돌연변이 확인할 수 있습니다. 여기, 우리는 ade6 + 기자 삽입 활용는 centromere 1 외부 반복 (otr) 지역10. Ade6 + 기자 야생-타입 상태;에서 침묵은 그래서 제정 섬으로이 지역11에 형성 된다 이 빨간 식민지10으로 표시 됩니다. Centromere는에 제정 섬으로 destabilizes 하는 돌연변이 ade6 + 기자, 백색 식민지로 시각 이다는 식으로 이어질 것입니다.

<table border="0" cellpadding="0" cellspacing="0" width="825">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">1. Media</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td style="width:285px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Glucose</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">G8270-10KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Yeast extract</td>
			<td style="width:155px;">BD Biosciences</td>
			<td style="width:119px;">212720</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Leucine</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">87070-0310</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Adenine sulfate</td>
			<td style="width:155px;">ACR</td>
			<td style="width:119px;">16363-0250</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Uracil&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">U0750</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">L-Histidine</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">H8125</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KH2PO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">1.05108.0050</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">NaCl</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">19015-0350</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">MgSO4&#8226;7H2O</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">63140</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CaCl2</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">12095</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Potassium phthalate</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">P6758-500g</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Inositol</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">I7508-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Biotin</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B4501-100MG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Boric Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">B6768-1KG</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MnSO4</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">M7634-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">ZnSO4&#8226;7H2O&#160;</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">83060-031</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">FeCl2&#8226;4H2O</td>
			<td style="width:155px;">KANTO</td>
			<td style="width:119px;">CB8943686</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Sodium molybdate dihydrate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">31621</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">KI</td>
			<td style="width:155px;">JUNSEI</td>
			<td style="width:119px;">80090-0301</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">CuSO4&#8226;5H2O</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">09605</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">D-myo-inositol</td>
			<td style="width:155px;">MP biomedicals</td>
			<td style="width:119px;">102052</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Pantothenate</td>
			<td style="width:155px;">YAKURI</td>
			<td style="width:119px;">26003</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Nicotinic Acid</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">N4126-500G</td>
			<td></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:267px;">(NH4)2SO4&#160;</td>
			<td style="width:155px;">Sigma-Aldrich</td>
			<td style="width:119px;">A4418-100G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Agarose</td>
			<td style="width:155px;">Biobasic</td>
			<td>D0012</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">G418, geneticin</td>
			<td style="width:155px;">LPS</td>
			<td style="width:119px;">G41805</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">2. Enzyme reactions</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">PfuUltra II Fusion HS DNA Polymerase</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">600380</td>
			<td>For site-directed mutagenesis</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">GeneMorphII Random mutagenesis Kit</td>
			<td style="width:155px;">Aglient</td>
			<td style="width:119px;">200500</td>
			<td>For error-prone PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Phusion High-Fidelity DNA Polymerase</td>
			<td style="width:155px;">Thermo Fisher</td>
			<td>F-530L</td>
			<td>For fusion PCR</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Ex Taq&#160;DNA Polymerase</td>
			<td style="width:155px;">Takara</td>
			<td style="width:119px;">RR001b</td>
			<td>For general PCR</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">BamH1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0136S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Xho1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td>R0146S</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Dpn1</td>
			<td style="width:155px;">New England BioLabs</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:267px;">3. Equipment</td>
			<td style="width:155px;"></td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Velveteen square, black</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">89033-116</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Replica-plating tool</td>
			<td style="width:155px;">VWR</td>
			<td style="width:119px;">25395-380</td>
			<td>For replica</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">MicroPulser Electroporator</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652100&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:267px;">Electroporation Cuvettes, 0.2 cm gap</td>
			<td style="width:155px;">Biorad</td>
			<td style="width:119px;">1652086&#160;</td>
			<td>For fission yeast transformation</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:267px;">Thermal Cycler</td>
			<td style="width:155px;">Bioer</td>
			<td style="width:119px;">BYQ6078</td>
			<td>For fusion PCR ramp reaction&#160;</td>
		</tr>
	</tbody>
</table>

gene-targeted random mutagenesis to select heterochromatin-destabilizing proteasome mutants in fission yeast

대상 유전자의 무작위 mutagenesis 원하는 표현 형을 생성 하는 돌연변이 식별 하기 위해 일반적으로 사용 됩니다. 무작위 mutagenesis 달성 하는 데 사용할 수 있습니다 방법의 오류가 PCR는 돌연변이의 다양 한 풀을 생성 하기 위한 편리 하 고 효율적인 전략 이다 (즉., 돌연변이 도서관). 연구원은 다른 게놈 영역을 영향을 받지 떠나는 동안 유전자의 코딩 지구 같은 미리 정의 된 영역을 변형 하고자 하는 경우 오류가 PCR 방법의 선택입니다. 돌연변이 라이브러리 오류가 PCR에 의해 증폭 되어, 후 적당 한 플라스 미드로 복제 해야 합니다. 오류가 PCR에 의해 생성 된 라이브러리의 크기는 복제 단계의 효율에 의해 제한 됩니다. 그러나, 분열 효 모, Schizosaccharomyces pombe, 복제 단계는 매우 효율적인 원스텝 퓨전 변환에 대 한 구문을 생성 하는 PCR의 사용으로 대체할 수 있습니다. 원하는 고기의 돌연변이 다음 적절 한 기자를 사용 하 여 선택할 수 있습니다. 여기,이 전략 자세하게, 예를 들어, centromeric 섬으로에 삽입 기자 복용 설명 합니다.

그림 1 에 설명 된 절차에 따라 인수 Rpt4 돌연변이 식민지의 색상을 평가 하 여 분석할 수 있습니다. 식민지의 색상은 그림 2에 셀 수 감소에 관련 된 접시에 발견 했다. 섬으로 지역에 삽입 기자 ade6 + 야생-타입에 침묵 하 고 예 에이드 접시에 빨간 식민지를 보여줍니다. 일단는 섬으로 불안정 하 고 ade6 + 기자 표현, 백색 식민지 clr4Δ 돌연변이로 예 에이드 접시에 관찰할 수 있습니다. 스크린된 Rpt4 돌연변이 같이 있습니다. rpt4-1 돌연변이 가장 심각한 섬으로 불안을 보여줍니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57499/57499fig1.jpg"> 그림 1 : 프로토콜의 도식 대표. (A) PCR 뇌관 1과 2와 수행의 첫 번째 라운드에서 얻은 PCR 제품의 도식 대표. (B) rpt4 + 조각의 복제 제한을 기반으로 합니다. (C) 사이트 감독 mutagenesis 복제 된 벡터의 XhoI 금지 사이트를 추가 하는 침묵 돌연변이 소개 하는 데 사용 됩니다. (D) rpt4 + 지역 코딩 Random mutagenesis 오류가 PCR를 사용 하 여 수행 됩니다. (E) 돌연변이 rpt4 + 조각, 칸 조각 및 3' UTR 조각 퓨전 생성 변환 준비 카세트를 PCR에 의해 결합 됩니다. (F) 분열 효 모 세포는 퓨전 동종 재결합에 의해 생 rpt4 + 시퀀스 대체 PCR 구문으로 변환 됩니다. (G) 칸 선택 식민지 복제 예-에이드 (Ade 낮은)와 PMG-에이드 (Ade 없음) 플레이트, 도금 고 긍정적인 식민지 선택 됩니다. (H) PCR 및 PCR 제품의 후속 XhoI 제한 틀린 확실성을 피하기 위해 사용 됩니다. (I) 표현 형을 일으키는 돌연변이 선택 된 식민지, 셀의 전파, genomic DNA (gDNA)의 추출 및 rpt4 +의 관련 부분의 시퀀싱의 패치으로 식별 됩니다. (J) 원인이 돌연변이 확인 (및 가양성 배제) 직접 야생-타입 세포에 돌연변이 도입 하 여. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57499/57499fig2.jpg"> 그림 2 : Rpt4의 섬으로 드 억압 돌연변이. Otr1::ade6 + 기자 (맨 위)의 회로도. 선택 스크린된 Rpt4 돌연변이의 5 직렬 희석 섬으로 불안 (아래)의 수준을 증가의 순서 대로 표시 된 접시에 목격 됐다. 이 수치는 기사에서 '19S 프로테아좀은 직접 참여 섬으로 분열 효 모에의 규칙에 ' 서구 외., 201724로 수정 되었습니다. 비 자른 그림은 원래 문서에서 찾을 수 있습니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57499/57499fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td rowspan="2">구성 요소</td>
			<td colspan="2">접시의 유형</td>
		</tr>
<tr>
<td>예</td>
			<td>PMG</td>
		</tr>
<tr>
<td>효 모 추출 물</td>
			<td>5 g/L</td>
			<td></td>
		</tr>
<tr>
<td>포도 당</td>
			<td>30 g/L</td>
			<td>20 g/L</td>
		</tr>
<tr>
<td>아데닌</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>히스티딘</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>신</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>Uracil</td>
			<td>0.15 g/L</td>
			<td>0.1 g/L</td>
		</tr>
<tr>
<td>칼륨 수소 pthalate</td>
			<td></td>
			<td>3 g/L</td>
		</tr>
<tr>
<td>나2HPO4
</td>
			<td></td>
			<td>2.2 g/L</td>
		</tr>
<tr>
<td>L-글루탐산</td>
			<td></td>
			<td>3.75 g/L</td>
		</tr>
<tr>
<td>소금</td>
			<td></td>
			<td>20 ml/L</td>
		</tr>
<tr>
<td>비타민</td>
			<td></td>
			<td>1 ml/L</td>
		</tr>
<tr>
<td>미네랄</td>
			<td></td>
			<td>0.1 ml/L</td>
		</tr>
<tr>
<td>한 천</td>
			<td>16 g/L</td>
			<td>16 g/L</td>
		</tr>
</tbody></table>표 1입니다. 예의 구성 요소와 PMG 플레이트
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">30 사이클</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>2 분</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>8oC</td>
			<td>보류</td>
			<td></td>
		</tr>
</tbody></table>표 2입니다. 사이트 지시 된 mutagenesis에 대 한 권장된 PCR 프로그램
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>95oC</td>
			<td>30 s</td>
			<td rowspan="3">19 주기</td>
		</tr>
<tr>
<td>55oC</td>
			<td>1 분</td>
		</tr>
<tr>
<td>72oC</td>
			<td>7 분</td>
		</tr>
<tr>
<td>72oC</td>
			<td>10 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>8oC</td>
			<td>보류</td>
			<td></td>
		</tr>
</tbody></table>표 3입니다. 오류가 PCR 위한 권장된 PCR 프로그램
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">30 사이클</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>2 분</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>8oC</td>
			<td>보류</td>
			<td></td>
		</tr>
</tbody></table>표 4입니다. 칸 조각을 위한 PCR 프로그램 추천
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>변경</td>
			<td>받는 사람</td>
			<td colspan="2">예 rpt4 +의 경우</td>
		</tr>
<tr>
<td>서식 파일 벡터</td>
			<td>pFA6a-3HA-KANMX6</td>
			<td colspan="2"></td>
		</tr>
<tr>
<td>P7의 벡터 바인딩 순서</td>
			<td>ATTACGCTGCTCAGTGCTGA</td>
			<td colspan="2" rowspan="2">ttgctgacctgaagaaacttgaaggtacaattgattaccaaaagctttag ATTACGCTGCTCAGTGCTGA</td>
		</tr>
<tr>
<td>P 7의 순서를 거</td>
			<td>정지 codon를 포함 하 여 마지막 50bp 시퀀스</td>
		</tr>
<tr>
<td>P8의 순서를 거</td>
			<td>바로 정지 codon (보완 시퀀스) 후 첫 번째 50bp 시퀀스</td>
			<td colspan="2">AATCTTCATCGGTAAACTTATCATTTCATGGCTTTTTGGATATATGTGCA GAATTCGAGCTCGTTTAAAC</td>
		</tr>
<tr>
<td>P9의 순서</td>
			<td>정지 codon 후 바로 시작</td>
			<td colspan="2">tgcacatatatccaaaaagccatgaa</td>
		</tr>
<tr>
<td>P10의 순서</td>
			<td>생산 ~ 500bp 조각을 p9 (보완 seqeucne)</td>
			<td colspan="2">TAGACGTTTTTCCTCGTTTCTTTGTC</td>
		</tr>
</tbody></table>표 5입니다. ADH 터미네이터 생 터미네이터 대신 사용 하는 경우 필요한 변경
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>95oC</td>
			<td>2 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>95oC</td>
			<td>20 s</td>
			<td rowspan="3">30 사이클</td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
		</tr>
<tr>
<td>72oC</td>
			<td>1 분</td>
		</tr>
<tr>
<td>72oC</td>
			<td>8 분</td>
			<td>1 주기</td>
		</tr>
<tr>
<td>8oC</td>
			<td>보류</td>
			<td></td>
		</tr>
</tbody></table>표 6입니다. 3' UTR 조각을 위한 PCR 프로그램 추천
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>온도</td>
			<td>시간</td>
			<td>진입로</td>
			<td>Cycle(s)</td>
		</tr>
<tr>
<td>94oC</td>
			<td>2 분</td>
			<td></td>
			<td>1 주기</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">10 주기</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>2시 30분 분</td>
			<td>0.2 oC/s</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">5 사이클</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>2시 30분 분</td>
			<td>0.2 oC/s + 5 s/사이클</td>
		</tr>
<tr>
<td>94oC</td>
			<td>20 s</td>
			<td></td>
			<td rowspan="4">10 주기</td>
		</tr>
<tr>
<td>70oC</td>
			<td>1 s</td>
			<td></td>
		</tr>
<tr>
<td>55oC</td>
			<td>30 s</td>
			<td>0.1 oC/s</td>
		</tr>
<tr>
<td>68oC</td>
			<td>2시 30분 분</td>
			<td>0.2 oC/s + 20 s/사이클</td>
		</tr>
<tr>
<td>72oC</td>
			<td>10 분</td>
			<td></td>
			<td>1 주기</td>
		</tr>
<tr>
<td>8oC</td>
			<td>보류</td>
			<td></td>
			<td></td>
		</tr>
</tbody></table>표 7입니다. 융해 PCR PCR 프로그램 권장된
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr>
<td>CBL1877</td>
			<td>h +</td>
			<td>ade6-210 leu1 32 ura4-D18 otr1R (dg-glu) Sph1:ade6</td>
		</tr></tbody></table>이 연구에 사용 된 테이블 S1: 스트레인
<img src="/files/ftp_upload/57499/57499tbl2.jpg"> 이 연구에 사용 된 뇌관의 테이블 S2: 목록

Watch this Scientific Journal Video about Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast at JoVE.com

Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

분열 효 모 섬으로 불안정 프로테아좀 돌연변이 선택할 임의의 Mutagenesis 유전자 타겟팅

이 문서에는 분열 효 모에 대상 유전자의 무작위 mutagenesis에 대 한 자세한 방법을 설명합니다. 예를 들어, 우리가 대상 rpt4 +, 19S 프로테아좀 섬으로 불안정 돌연변이 대 한 스크린의 소 단위를 인코딩하는.

Random mutagenesis of a target gene is commonly used to identify mutations that yield the desired phenotype. Of the methods that may be used to achieve ...

gene-targeted-random-mutagenesis-to-select-heterochromatin

Nanyang Technological University

Research

JoVE Journal

Genetics

10.6K 조회수.  Korea Advanced Institute of Science and Technology. 이 문서에는 분열 효 모에 대상 유전자의 무작위 mutagenesis에 대 한 자세한 방법을 설명합니다. 예를 들어, 우리가 대상 rpt4 +, 19S 프로테아좀 섬으로 불안정 돌연변이 대 한 스크린의 소 단위를 인코딩하는.

비디오: Gene-targeted Random Mutagenesis to Select Heterochromatin-destabilizing Proteasome Mutants in Fission Yeast

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

히스톤 - miniSOG에서 사용 Optogenetic 무작위 돌연변이 유발<em&gt; C. 엘레</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

연구

유전학

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the conventional approaches of permanent gene deletion cannot be applied to essential genes. We have pioneered a unique collection of ~70 temperature-sensitive (ts) lethal mutants for studying cell cycle regulation in the unicellular green algae Chlamydomonas reinhardtii1. These mutations identify essential genes, and the ts alleles can be conditionally inactivated by temperature shift, providing valuable tools to identify and analyze essential functions. Mutant collections are much more valuable if they are close to comprehensive, since scattershot collections can miss important components. However, this requires the efficient collection of a large number of mutants, especially in a wide-target screen. Here, we describe a robotics-based pipeline for generating ts lethal mutants and analyzing their phenotype in Chlamydomonas. This technique can be applied to any microorganism that grows on agar. We have collected over 3000 ts mutants, probably including mutations in most or all cell-essential pathways, including about 200 new candidate cell cycle mutations. Subsequent molecular and cellular characterization of these mutants should provide new insights in plant cell biology; a comprehensive mutant collection is an essential prerequisite to ensure coverage of a broad range of biological pathways. These methods are integrated with downstream genetics and bioinformatics procedures for efficient mapping and identification of the causative mutations that are beyond the scope of this manuscript.

High-Throughput Robotically Assisted Isolation of Temperature-sensitive Lethal Mutants in Chlamydomonas reinhardtii

Temperature-sensitive (ts) lethal mutants are valuable tools to identify and analyze essential functions. Here we describe methods to generate and classify ts lethal mutants in high throughput.

온도에 민감한 치명적인 돌연변이의 높은 처리량 로봇 보조 절연에<em&gt; 클라 미도 모나스의 reinhardtii에서</em

Systematic identification and characterization of genetic perturbations have proven useful to decipher gene function and cellular pathways. However, the ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

대상<em&gt; 현장에서</em신진 효모에서&gt; 돌연변이 유발 히스톤의 유전자

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

CRISPR을 유전자형하기 위해 형광 PCR-모세관 젤 전기 영동 기술을 사용 / 높은 처리량 형식으로 녹아웃 돌연변이를 Cas9 매개

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical regions, is caused by infection with Plasmodium parasites. The development of more effective drugs to combat malaria can be accelerated by improving our understanding of the biology of this complex parasite. Genetic manipulation of these parasites is key to understanding their biology; however, historically the genome of P. falciparum has been difficult to manipulate. Recently, CRISPR/Cas9 genome editing has been utilized in malaria parasites, allowing for easier protein tagging, generation of conditional protein knockdowns, and deletion of genes. CRISPR/Cas9 genome editing has proven to be a powerful tool for advancing the field of malaria research. Here, we describe a CRISPR/Cas9 method for generating glmS-based conditional knockdown mutants in P. falciparum. This method is highly adaptable to other types of genetic manipulations, including protein tagging and gene knockouts.

CRISPR/Cas9 Gene Editing to Make Conditional Mutants of Human Malaria Parasite P. falciparum

We describe a method for generating glmS-based conditional knockdown mutants in Plasmodium falciparum using CRISPR/Cas9 genome editing.

CRISPR/Cas9 유전자 인간 말라리아 기생충의 조건부 돌연변이 게 P. falciparum 에 편집

Malaria is a significant cause of morbidity and mortality worldwide. This disease, which primarily affects those living in tropical and subtropical ...

Mating-based Overexpression Library Screening in Yeast

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool commonly used in yeast studies. The expression of a number of neurodegenerative disease-associated proteins in yeast causes cytotoxicity and aggregate formation, recapitulating findings seen in patients with these disorders. Here, we describe a method for screening a yeast model of the Amyotrophic Lateral Sclerosis-associated protein FUS for modifiers of its toxicity. Instead of using transformation, this new screening platform relies on the mating of yeast to introduce an arrayed library of plasmids into the yeast model. The mating method has two clear advantages: first, it is highly efficient; second, the pre-transformed arrayed library of plasmids can be stored for long-term as a glycerol stock, and quickly applied to other screens without the labor-intensive step of transformation into the yeast model each time. We demonstrate how this method can successfully be used to screen for genes that modify the toxicity of FUS.

This article presents a mating-based method to facilitate overexpression screening in budding yeast using an arrayed plasmid library.

효 모에 짝짓기 기반 Overexpression 라이브러리 심사

Budding yeast has been widely used as a model in studying proteins associated with human diseases. Genome-wide genetic screening is a powerful tool ...

Characterizing Histone Post-translational Modification Alterations in Yeast Neurodegenerative Proteinopathy Models

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives each year. Effective treatment options able to halt disease progression are lacking. Despite the extensive sequencing efforts in large patient populations, the majority of ALS and PD cases remain unexplained by genetic mutations alone. Epigenetics mechanisms, such as the post-translational modification of histone proteins, may be involved in neurodegenerative disease etiology and progression and lead to new targets for pharmaceutical intervention. Mammalian in vivo and in vitro models of ALS and PD are costly and often require prolonged and laborious experimental protocols. Here, we outline a practical, fast, and cost-effective approach to determining genome-wide alterations in histone modification levels using Saccharomyces cerevisiae as a model system. This protocol allows for comprehensive investigations into epigenetic changes connected to neurodegenerative proteinopathies that corroborate previous findings in different model systems while significantly expanding our knowledge of the neurodegenerative disease epigenome.

This protocol outlines experimental procedures to characterize genome-wide changes in the levels of histone post-translational modifications (PTM) occurring in connection with the overexpression of proteins associated with ALS and Parkinson&#39;s disease in Saccharomyces cerevisiae models. After SDS-PAGE separation, individual histone PTM levels are detected with modification-specific antibodies via Western blotting.

효 모 신경 Proteinopathy 모델에서 특성화 히스톤 포스트 번역 상 수정 변경

Neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS) and Parkinson&#39;s disease (PD), cause the loss of hundreds of thousands of lives ...

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely related biochemical pathways. Previous methods such as the Synthetic Genetic Array (SGA) analysis, and random mutagenesis techniques using ultraviolet (UV) or chemicals like ethyl methanesulfonate (EMS) or N-ethyl-N- nitrosourea (ENU), have been widely used but are often costly and laborious. Also, these mutagen-based screening methods are frequently associated with severe side effects on the organism, inducing multiple mutations that add to the complexity of isolating the suppressors. Here, we present a simple and effective protocol to identify suppressor mutations in mutants which confer a growth defect in Schizosaccharomyces pombe. The fitness of cells with a growth deficiency in standard rich liquid media or synthetic liquid media can be monitored for recovery using an automated 96-well plate reader over an extended period. Once a cell acquires a suppressor mutation in the culture, its descendants outcompete those of the parental cells. The recovered cells that have a competitive growth advantage over the parental cells can then be isolated and backcrossed with the parental cells. The suppressor mutations are then identified using whole-genome sequencing. Using this approach, we have successfully isolated multiple suppressors that alleviate the severe growth defects caused by loss of Elf1, an AAA+ family ATPase that is important in nuclear mRNA transport and maintenance of genomic stability. There are currently over 400 genes in S. pombe with mutants conferring a growth defect. As many of these genes are uncharacterized, we propose that our method will hasten the identification of novel functional interactions with this user-friendly, high-throughput approach.

A Deep-sequencing-assisted, Spontaneous Suppressor Screen in the Fission Yeast Schizosaccharomyces pombe

We present a simple suppressor screen protocol in fission yeast. This method is efficient, mutagen-free, and&#160; selective&#160; for&#160; mutations that&#160; often&#160; occur at&#160; &#160;a&#160; single&#160; genomic&#160; locus.&#160; The protocol is suitable for isolating suppressors that alleviate growth defects in liquid culture that are caused by a mutation or a drug.

분열 효 모 Schizosaccharomyces pombe 에 깊은 시퀀싱 지원, 자발적인 억압 화면

A genetic screen for mutant alleles that suppress phenotypic defects caused by a mutation is a powerful approach to identify genes that belong to closely ...

Enhanced Yeast One-hybrid Screens To Identify Transcription Factor Binding To Human DNA Sequences

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and computational approaches. One such method is the yeast one-hybrid (Y1H) assay, in which interactions between TFs and DNA regions are tested in the milieu of the yeast nucleus using reporter genes. Y1H assays involve two components: a &#8216;DNA-bait&#8217; (e.g., promoters, enhancers, silencers, etc.) and a &#8216;TF-prey,&#8217; which can be screened for reporter gene activation. Most published protocols for performing Y1H screens are based on transforming TF-prey libraries or arrays into DNA-bait yeast strains. Here, we describe a pipeline, called enhanced Y1H (eY1H) assays, where TF-DNA interactions are interrogated by mating DNA-bait strains with an arrayed collection of TF-prey strains using a high density array (HDA) robotic platform that allows screening in a 1,536 colony format. This allows for a dramatic increase in throughput (60 DNA-bait sequences against &#62;1,000 TFs takes two weeks per researcher) and reproducibility. We illustrate the different types of expected results by testing human promoter sequences against an array of 1,086 human TFs, as well as examples of issues that can arise during screens and how to troubleshoot them.

Here, we present an enhanced yeast one-hybrid screening protocol to identify the transcription factors (TFs) that can bind to a human DNA region of interest. This method uses a high-throughput screening pipeline that can interrogate the binding of &#62;1,000 TFs in a single experiment.

인간의 DNA 시퀀스에 바인딩 전사 요소를 식별 하기 위해 향상 된 효 모 한 하이브리드 화면

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and ...

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, Eastern equine encephalitis, lymphatic filariasis, and Saint Louis encephalitis. Notably, avian malaria has played a major role in the extinction of numerous endemic island bird species, while WNV has become an important vector-borne disease in the United States. To gain further insight into C. quinquefasciatus biology and expand their genetic control toolbox, we need to develop more efficient and affordable methods for genome engineering in this species. However, some biological traits unique to Culex mosquitoes, particularly their egg rafts, have made it difficult to perform microinjection procedures required for genome engineering. To address these challenges, we have developed an optimized embryo microinjection protocol that focuses on mitigating the technical obstacles associated with the unique characteristics of Culex mosquitoes. These procedures demonstrate optimized methods for egg collection, egg raft separation and other handling procedures essential for successful microinjection in C. quinquefasciatus. When coupled with the CRISPR/Cas9 genome editing technology, these procedures allow us to achieve site-specific, efficient and heritable germline mutations, which are required to perform advanced genome engineering and develop genetic control technologies in this important, but currently understudied, disease vector.

Embryo Microinjection Techniques for Efficient Site-Specific Mutagenesis in Culex quinquefasciatus

This protocol describes microinjection procedures for Culex quinquefasciatus embryos that are optimized to work with CRISPR/Cas9 gene editing tools. This technique can efficiently generate site-specific, heritable, germline mutations that can be used for building genetic technologies in this understudied disease vector.

컬렉스 퀸케파시아투스의 효율적인 부위 별 돌연변이 발생을 위한 배아 미세 주입 기술

Culex quinquefasciatus is a vector of a diverse range of vector-borne diseases such as avian malaria, West Nile virus (WNV), Japanese encephalitis, ...