Este trabalho foi financiado pelo NIH AI099854 e AI126742 a chave.

1. recozimento de vDNA
<ol><li>Combinar 1 X 10 Buffer (estoque de 10 X 10: 100 mM Tris-HCl, pH 8,0, 1 M NaCl, EDTA 10 mM), 10 µM 1 Oligo (5' ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3', 100 µM de estoque) e 10 µM 2 Oligo (5' CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3', 100 µM de estoque) em um volume final de 1,5 mL . Alíquota de 25 µ l para tubos de reação em cadeia (PCR) de 0,2 mL do polymerase sessenta. Nota: Dependendo da aplicação, oligómeros podem ser modificados com fluorophores ou tags 5'-na extremidade do Oligo 2 ou como um interno amino-T na base 13 de 5' extremidade do Oligo 1. Oligómeros modificados devem ser purificados por cromatografia líquida de alto desempenho (HPLC) antes do recozimento. Nós achamos que 5'-final Cy3 ou Cy5 fluoróforo rotulagem de Oligo 2 reduz a eficiência de montagem de intasome 10-fold. Fluoróforo interno rotulagem não reduz eficiência de montagem.</li>
	<li>Recoze usando um thermocycler com os seguintes tempos e temperaturas: 1 ciclo ˚ c 94.0 3 min, 99 ciclos no (˚ c 94.0 1min, 93,6 ˚ c 1min) diminuindo ambas temperaturas 0,8 ˚ c por ciclo (o último ciclo é 14,8 ˚ c 1 min, 14.4 ˚ c 1 min) e armazenar no 4.0 ˚ c.</li>
	<li>Combine as recozimento reações de todos os tubos de sessenta. Carrega 500 µ l para dois 0,5 mL 3 kDa peso molecular corte (MWCO) filtro ultracentrifugal concentração unidades. Concentre o recozido vDNA por centrifugação em microcentrifuga a 14.000 x g durante 10 minutos à temperatura ambiente (RT). Nota: O volume de retentate deve ser ~ 50 µ l em cada unidade de concentração.</li>
	<li>Descarte a fluir. Adicione 250 µ l do restante vDNA recozido para cada unidade de filtro. Repetir a centrifugação e descartar o fluxo através de. Tampão de troca em tampão TE (10 mM Tris-HCl, pH 8,0, 1 mM EDTA) por lavar três vezes com 450 µ l TE.</li>
	<li>Inverter a unidade de filtro e girar a 1.000 x g por 2 min em RT O volume final retentate para cada unidade de filtro deve ser ~ 50 µ l. Combine o retentates e transferir para um tubo de tampa de rosca de 1,5 mL.</li>
	<li>Medir a absorvância de 260 nm ultravioleta (UV) do vDNA. Use este valor para calcular a concentração molar final do DNA. O coeficiente de extinção (ε260) deste vDNA é 622.803 cm-1 M-1 e seu peso molecular é 23.972 promotor. loja-20 ˚ c.</li>
</ol>2. Intasome Assembleia
<ol><li>Se possível, realizar a montagem de intasome em um quarto pequeno com um termostato variável. Ajuste o termostato para aproximadamente 18-22 ˚ c. Nota: Na nossa experiência, montagem de intasome no 4 ˚ c é ineficiente.</li>
	<li>Prepare 1 L de tampão de diálise (Bis-tris propano de 20 mM, pH 7,5, 200 mM NaCl, 2mm ditiotreitol (DTT), 25 µM ZnCl2) num copo de 2 L com uma barra de agitação em uma placa de agitação. Equilibrar o buffer na sala 18-22 ˚ c, durante pelo menos 6 h.</li>
	<li>Para montar o intasomes, combine propano 50 mM tris-Bis, pH 7,5, 500 mM de NaCl, PFV IN de 120 µM e 50 µM vDNA em um volume total de 150 µ l. Nota: IN PFV deve ser livre de contaminantes nuclease atividade7,8. Se a concentração de IN PFV é demasiado diluída para acomodar 120 µM em, em volume de 150 µ l, em seguida, é possível aumentar o volume final de 200 µ l. Os fatores críticos desta etapa são para manter a proporção molar da IN para vDNA (2.4:1) e ter bastante complexo para visualizar durante a cromatografia.</li>
	<li>Limpe um longo pedaço de ~ 10 cm de tubo de diálise 10mm 6-8 kDa MWCO e clipes com água bidestilada (ddH2O), ou a água de pureza mais alta disponível. Prenda uma extremidade do tubo. Nota: A tubulação da diálise deve ser manipulada com cuidado para evitar qualquer possível contaminação do espaço de laboratório.</li>
	<li>Fazer 15 mL de tampão de lavagem de tubos de diálise (propano 50 mM tris-Bis, pH 7,5, 500 mM de NaCl). Lave o interior do tubo de diálise três vezes com 1-2 mL de tampão de lavagem. Retire o máximo de buffer de enxaguamento quanto possível, com uma pipeta e gel fino de ponta de carga.</li>
	<li>Se necessário, utilize uma lâmina de barbear limpa ou bisturi para cortar o tubo de diálise para que uma ponta fina gel de carregamento pode chegar ao fim do tubo.</li>
	<li>Transferi o assembly intasome da etapa 2.3 para a tubulação da diálise com uma pipeta e um gel fino ponta de carregamento. Corte a extremidade aberta do tubo de diálise, minimizando a quantidade de ar introduzido dentro do tubo. Coloque o tubo no buffer de diálise.</li>
	<li>Urinar durante a noite (16-20 h) com agitação suave para que o tubo gira, mas não é em um vórtice. Verifique se a tubulação da diálise está submerso e móvel. Depois de aproximadamente uma hora, observe um precipitado visível dentro da tubulação. Nota: Com Cy3 ou Cy5 fluorescente etiquetado vDNA, o precipitado é mais óbvio. Isto é verdadeiro para end rotulado e vDNA fluorescente etiquetado internamente.</li>
</ol>3. Intasome solubilização
<ol><li>Prepare dois furo largo pontas de pipetas, removendo 2-4 mm da extremidade de uma ponta de 200 µ l, com uma nova lâmina de barbear ou bisturi sobre uma superfície limpa. Nota: As dicas serão usadas na etapa 3.3 e 3.5.</li>
	<li>Remova o tubo de diálise o buffer de diálise. Para evitar a diluição da amostra intasome com buffer de diálise que pode permanecer na extremidade do tubo de perto o clip, use uma micropipeta com uma ponta de pipeta pequena para remover qualquer reserva de diálise em excesso. Retire o clipe de uma das extremidades do tubo de diálise.</li>
	<li>Uso uma ampla ponta da pipeta do furo do passo 3.1 para transferir a amostra, incluindo o precipitado dentro da tubulação da diálise para um tubo de 1,5 mL no gelo. Anotar o volume total do material recuperado; o volume total é tipicamente ~ 140 µ l.</li>
	<li>A amostra com o precipitado é a 200 mM NaCl; Aumente o sal para uma concentração final de 320 mM NaCl adicionando o volume apropriado de uma solução de NaCl 5 M. Por exemplo, para uma amostra de 150 µ l, adicionar 3.9 µ l 5 M NaCl e 1.1 µ l ddH2O para um volume final de 155 µ l. transferência balde de gelo com amostra em uma sala fria 4 ˚ c.</li>
	<li>Uso uma ampla furo ponta da pipeta de passo 3.1 para Ressuspender e solubilizar o precipitado por pipetagem. Repeti a cada 20 min pelo menos 1 h. observar que a maioria do precipitado deve entrar em solução. Nota: Pipetagem para Ressuspender o precipitado pode ser interrompido quando é evidente que o precipitado é não está mais visivelmente reduzido entre pontos de tempo. Quando vDNA não é rotulado ou internamente é rotulado, o precipitado é reduzido em 90% com base na inspeção visual. No caso de fim de Cy5 rotulado vDNA, o precipitado é reduzido em apenas ~ 20%; a maioria do precipitado com fim de fluoróforo rotulado vDNA não vai solubilizar. A quantidade de precipitado que efetivamente é solubilizado é variável e deve ser determinada empiricamente.</li>
</ol>4. Intasome purificação
<ol><li>Prepare 250 mL de cromatografia de exclusão (SEC) executando o tampão (propano 20 mM tris-Bis, pH 7,5, 320 mM NaCl, 10% de glicerol). Filtro estéril o buffer com um 0,2 µm-unidade de filtragem e armazene a 4 ˚ c. Nota: Todas as etapas de purificação são realizadas em uma sala fria 4 ˚ c.</li>
	<li>Equilibrar uma coluna de agarose reticulado SEC (diâmetro = 10 mm; comprimento = 300 mm; cama volume = 24 mL; volume de amostra = 25-500 µ l; pressão máxima = 1,5 MPa; limite de exclusão = 4 x 107 Da; separa os pesos moleculares entre 5.000 e 5 kDa, consulte o de esteira erials) com SEC executando em uma taxa de fluxo de 0,4 mL/min. Nota: Esta purificação pode ser adaptada para colunas de exclusão de tamanho diferente se eles são capazes de efetivamente separar 300 kDa 44 kDa, tais como Superose 12 10/300 GL ou Superose 6 aumentar. Superose 12 10/300 GL tem resolução menor, levando a mais sobreposição de picos. Por outro lado, Superose 6 aumentar tem maior resolução e oferece a melhor separação.</li>
	<li>Centrifugar a amostra de intasome em uma microcentrífuga a 14.000 x g durante 10 minutos a 4 ˚ c para qualquer precipitado restante de Pelotas. Remova cuidadosamente o sobrenadante. Carrega o sobrenadante para um loop de injeção de 200 µ l (tubulação que pode conter ~ 200 μL). Aplique a amostra para a coluna do SEC. Nota: Volumes menores de carga permitem maior resolução por seg.</li>
	<li>Eluir com 25 mL SEC executando o buffer e coleta 95 frações de 270 µ l. Observe que o cromatograma SEC exibe três A280/A260 picos (Figura 1). Nota: O primeiro deve ser um agregado (~9.0 - eluição de 11,5 mL), seguido do pico de intasome PFV tetrâmero (~12.0 - eluição 14,75 mL) e monômero PFV IN com pico vDNA livre (~15.0 - 18,0 mL).</li>
</ol>5. integração Strand ensaio de transferência, seleção de fração e armazenamento
<ol><li>Combinar 2 µ l de cada fração de pico intasome e 50 ng 3KB supercoiled plasmídeo (concentração das ações é de 50 ng / µ l) em tampão de reação (10 mM tris Bis propano, pH 7,5, 110 mM de NaCl, 5 mM de MgSO4, 4 µM ZnCl2, 10 mM DTT) em um volume final de reação de 15 µ l. Incube a 37 ˚ c por 5 min.</li>
	<li>Inclua um controle negativo com nenhum intasome PFV adicionado. Parar a reação com 0,75 proteinase µ l K (20 mg/mL de solução) e 0,75 µ l SDS (solução a 10% das ações). Incube a 55 ˚ c para amostras de loja h. 1 conforme necessário em-20 ˚ c para posterior análise. Nota: Este ensaio é uma avaliação qualitativa da atividade de integração. A concentração molar de intasome de cada fração não é determinada antes neste ensaio. Incluído no ensaio de transferência da vertente de integração de fracções podem ser armazenadas no gelo (incluindo armazenamento durante a noite) até a integração atividade é confirmada e frações selecionadas são aliquotadas. Aqui usamos o pMP2, um derivado de pUC199. Usamos também com êxito a 5,4 kb do plasmídeo pcDNA 3.1. Qualquer plasmídeo que pode ser resolvido em relaxado círculo, linear, e formas supercoiled podem ser usadas como um destino para integração.</li>
	<li>Prepare um peso de 1% de 120 mL por gel de agarose de volume (p/v) em 1-tampão TAE X (40 mM Tris-Acetato, 1 mM EDTA) com 0,1 μg/mL ethidium brometo (EtBr, 10 mg/mL de solução)10. Derreter a solução de agarose e despeje em uma bandeja de fundição de gel 15 cm x 10 cm. Inserir um pente 15-bem com 5 mm largo, 0,75 mm espesso poços. Nota: Mais estreitos poços rendem melhor resolução de banda, em comparação com poços de espesso 1,5 mm.</li>
	<li>Permitir que o gel solidificar à temperatura ambiente. Imergir o gel em 1 X TAE com 0,1 μg/mL EtBr.</li>
	<li>Adicione 3 µ l 50% glicerol para cada reação de integração da etapa 5.2. Carrega o volume inteiro de reação para o gel. Carregar de 1 µ l de marcador de tamanho de DNA 10 kb (concentração das ações de 150 ng / µ l) para pistas de cada lado das amostras; em outras palavras, o marcador de tamanho de DNA deve flanquear as pistas de amostra.</li>
	<li>Em uma faixa exterior, carrega tintura de laranja G 6 µ l (0,25% G laranja, 30% de glicerol). Funcione o gel em constante tensão, 10 V/cm (100 V) à temperatura ambiente por 1 h, ou até a frente de corante laranja G chega ao fim do gel.</li>
	<li>O gel de agarose imediatamente da imagem com um scanner fluorescente definido para detectar EtBr (532 nm de excitação, filtro de emissão 610 nm). Se fluoróforo rotulado vDNAs foram usado, também da imagem com as configurações adequadas fluoróforo. Nota: por exemplo detectar Cy5 rotulado DNA, imagem usando 633 nm de excitação e filtros de emissão 670 nm. Produtos de integração concertada (CI, DNA linear) devem ser executado fiel tamanho em kb ~ 3, não tenha reagido supercoiled plasmídeo (SC) deve ser executado mais rápido (~ 2 kb) e produtos de integração meia-site (HSI, círculo relaxado DNA) devem executar mais lento (~3.5 kb). Não tenha reagido vDNA deve ser executado fiel tamanho em ~ 40 bp.</li>
	<li>Quantificar as bandas em cada raia com software de imagem7. Calcular a fração de DNA em cada pista que é CI, HSI ou SC; vDNA não está incluído no cálculo. Nota: Eficiência de integração, ou a fração de SC, convertido em um produto linear, foi calculada dividindo o volume de pixel de produtos de integração concertada (CI) pelo volume total de pixel de três bandas (HSI + CI + SC). Se intasomes são fluoróforo rotulado, os HSI e CI produtos também podem ser quantificados por fluorescência.</li>
	<li>Selecione frações que têm a atividade de integração mais concertada. Nota: Na nossa experiência, a atividade de integração concertada de pico coincide com o pico de proteína identificado como tetramérica PFV intasomes. Medir a um280 de cada uma dessas fracções e calcular a concentração final de intasome. O ε280 para um tetrâmero de tipo selvagem PFV IN com dois vDNAs descrito aqui é 908.339 cm-1M-1 e o peso molecular é 225.5 kDa. As concentrações devem seguir o mesmo padrão, como o pico do cromatograma SEC e no ensaio de transferência de fio.</li>
	<li>Distribuir a cada fração em 5 alíquotas µ l e snap freeze em nitrogênio líquido. Loja alíquotas no-80 ˚ c. Selecionado para o armazenamento de frações são tipicamente entre 200-600 nM.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

Os autores não têm nada para divulgar.

Retroviral INs formam uma complexo com DNA genômico viral para realizar a integração e continuar o ciclo de vida viral de multiméricas. O número de em monômeros por intasome pode ser tetrâmeros, octamers ou possivelmente maior ordem oriundas de11,12,13,14. PFV intasomes são um tetrâmero de recombinante com oligômeros de DNA dupla-hélice que imitam o DNA genômico viral termina3. Esses intasomes têm sido utilizados em estudos estruturais e dinâmico3,5,13,14.
A montagem de PFV intasomes ocorre durante a diálise de um buffer de relativamente alta concentração de sal para uma baixa concentração de sal. Isso resulta na formação de um precipitado que inclui o intasomes PFV. Os intasomes são solubilizados, aumentando a concentração de sal. PFV IN tem demonstrado ser monomérica em concentrações até 225 µM5. Os complexos são então isolaram do monoméricos em e livre vDNA pela SEC. Modificamos a purificação do PFV intasomes para incluir o glicerol no SEC reserva6. A adição de glicerol permite o intasomes PFV ser congelado para uso futuro sem perda de atividade (Figura 4).
Existem várias características-chave do presente protocolo. Apesar de purificação de proteínas é frequentemente realizada a baixas temperaturas, encontramos empiricamente que a montagem de intasome PFV é ineficiente no 4 ˚ c. Em vez disso, a diálise de montagem deve ocorrer na faixa de 18 a 22 ˚ c. Também é importante usar recombinante PFV em que está livre de contaminação bacteriana da nuclease7,8. Finalmente, a relação da IN para vDNA é um factor-chave do assembly. Se o arranque na concentração da proteína é menor do que o recomendado aqui, a concentração de vDNA deve ser reduzida proporcionalmente. Enquanto é possível montar PFV intasomes em concentrações inferiores, os complexos devem ser em alta bastante concentração para detecção durante a separação do SEC.
Esse método pode ser usado para PFV intasomes com vDNA sem rótulo ou rotulado. Nós achamos que o vDNA pode eficientemente ser etiquetado com um fluoróforo ou biotina6. Outros rótulos pequena molécula também podem ser possíveis. No caso de fluoróforo Cy5, encontramos o efeito rotulado vDNA reduz o rendimento de intasomes montado com a pico de concentração reduzida 10-fold. No entanto, internamente Cy5 rotulado vDNA tem um rendimento equivalente a vDNA sem rótulo. Esse método de montagem também pode ser usado com mutações de ponto ou mutações de truncamento de PFV em4. Desde que em PFV é inibida por IN clinicamente relevante vertente transferência inibidor (INSTI) drogas visando IN HIV-1, é possível usar estes intasomes PFV para estudar o mecanismo de INSTIs3. Além disso, algumas mutações INSTI resistentes de HIV-1 IN ocorrem em resíduos conservados em IN PFV, permitindo estudos de resistência de droga com engenharia PFV intasomes.

Integração do genoma viral no genoma do hospedeiro é um passo obrigatório no ciclo de vida de todos os retrovírus1. A enzima viral integrase (IN) catalisa a União covalente de cada extremidade do genoma de DNA viral para o host de DNA. Durante uma infecção celular, faz parte de um complexo de pré-integração que medeia a integração. Recombinante em complexado com oligômeros de DNA encalhados dobro imitando as extremidades de DNA virais também pode realizar a integração em um DNA alvo em vitro2. Um comum integração ensaio em vitro utiliza um plasmídeo supercoiled como o DNA alvo. Integração de ambos os oligómeros de DNA virais (vDNA) para o plasmídeo resulta em um produto linear e é denominada integração concertada (Figura 2A). A integração do ensaio em vitro pode também produzir produtos com apenas um vDNA covalentemente unida com o plasmídeo de alvo, resultando em um círculo relaxado. Este produto de integração de meia-site parece ser um artefato de ensaio in vitro.
Recombinante em e vDNA podem realizar integração em vitro, mas eles não são reagentes ideais para o estudo da dinâmica ou estrutura de complexos de integração quando monomérico IN poderia obscurecer visualização relevante. Purificado de integração complexos, ou "intasomes", são necessários estudos estruturais ou análise de dinâmica única molécula. PFV IN e vDNAs pode ser montado por diálise de um buffer de relativamente alta concentração de sal para uma baixa concentração de sal,3,4. Durante a diálise, um precipitate formulários. Esse precipitado é removido da diálise e a concentração de sal é aumentada. A maior concentração de sal solubiliza o precipitado contendo PFV intasomes. Os intasomes são então purificados por cromatografia de exclusão (SEC). IN de vírus espumoso (PFV) recombinante protótipo foi mostrado para existe como um monômero em solução em concentrações até 225 µM5. Fracionamento de SEC efetivamente separa o intasomes PFV (225.5 kDa), que inclui um tetrâmero de PFV IN e dois vDNAs, PFV monomérico em (44,4 kDa) e enciclopédia vDNA (24,0 kDa). O intasomes PFV pode ser congelado e manter a atividade de integração pelo menos seis meses de armazenamento a-80 ˚ c.
Recombinante PFV intasomes também pode ser modificado para incluir em substituições de aminoácidos ou mutações de truncamento ou vDNAs rotulado com fluorophores ou biotina4,6. Os purificado PFV intasomes executar prontamente integração em um alvo de plasmídeo supercoiled DNA em vitro. Ensaios de integração bioquímicos em massa com intasomes podem testar os efeitos de mutações, inibidores, ou outros aditivos químicos. Biotinilado intasomes pode ser usado para sondar a afinidade com os ácidos nucleicos e proteínas. PFV intasomes são funcionais à temperatura ambiente, permitindo a análise de microscopia única molécula por uma pinça magnética para medir o tempo entre juntar-se das duas extremidades vDNA ou fluorescência de reflexão interna total para visualizar a pesquisa de intasome no alvo DNA6. Além disso, PFV intasomes foram os primeiros a ser estruturalmente caracterizam afetar significativamente o campo de integração retroviral3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A definição de recurso e etapa necessária do ciclo de vida do retrovírus é a integração do genoma viral no genoma do hospedeiro. Todos os retrovírus codificam uma enzima integrase (IN) que cataliza a União covalente de viral para host de DNA, que é conhecido como transferência de vertente. Integração pode ser modelado em vitro com IN retroviral recombinante e oligómeros de DNA imitando as extremidades do genoma viral. Para recapitular mais de perto a reação de integração que ocorre na vivo, integração complexos são montados de recombinação IN e oligômeros sintéticos por diálise em um buffer de reduzida concentração de sal. A integração complexa, chamada um intasome, pode ser purificada por cromatografia de exclusão. No caso do vírus espumoso de protótipo (PFV), o intasome é um tetrâmero de IN e dois oligómeros de DNA e prontamente é separado do IN monomérico e livre oligómero de DNA. A eficiência de integração de intasomes PFV pode ser analisada sob uma variedade de condições experimentais para melhor compreender a dinâmica e mecânica de integração retroviral.

PFV intasomes são montados de recombinação IN e vDNA. Após a montagem, intasomes são purificados pela SEC (Figura 1). Atividade de integração de cada fração é analisada com um supercoiled DNA alvo e agarose electroforese do gel (Figura 2). Este gel é fotografado com um scanner fluorescente definido para detectar EtBr (e fluoróforo, se rotulado de fluoróforo vDNA é usado). Volumes de pixel de banda usando o software de análise de imagem, podem ser usados para calcular a eficiência de integração (Figura 3). Fracções com a mais alta eficiência de integração são snap congelado para uso posterior. Fracções congeladas mantém atividade de integração (Figura 4), permitindo a conservação a longo prazo de intasomes montado. Qualquer molécula de rótulo e sua posição dentro do vDNA podem afetar a eficiência de montagem de intasome (Figura 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57453/57453fig1.jpg"> Figura 1: cromatograma de exclusão de tamanho. Um conjunto de intasome PFV foi separado com uma coluna de SEC de agarose. Esta coluna permite a separação do agregado (1), PFV intasome consistindo de um tetrâmero de PFV IN e vDNA dois (2) e monomérico PFV IN e vDNA (3). Este exemplo incluído vDNA com um rótulo de fluoróforo Cy5 interno detectado pela excitação de nm 650. O eixo y denota a densidade óptica (OD) em unidades de milli-absorvância (mAU). <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57453/57453fig2.jpg"> Figura 2: ensaio de integração de fracções de SEC. (A) esquema de reação de transferência de vertente de integração. Esquerda, dos desenhos animados de um intasome PFV incluindo um tetrâmero de em (círculos azuis) e dois vDNA (linhas pretas espessas) e um plasmídeo de alvo (linhas pretas finas). Os supercoils (SC), do plasmídeo de destino não são desenhados. Centro, dos desenhos animados de um produto de integração meia-site (HSI) quando um vDNA covalentemente ingressou para o plasmídeo de alvo. A reação de ingresso introduz um nick e relaxa os supercoils. Bem, dos desenhos animados de um produto de integração concertada (CI), onde dois vDNAs se uniram ao ADN do alvo. Este produto de integração resulta em um DNA linear com vDNAs nas extremidades. (B) plasmídeo Supercoiled DNA foi adicionado a cada fração de SEC #49-55. Após incubação, as reações de integração foram desproteínado e separaram por eletroforese em gel de agarose 1% contendo EtBr. Controlo negativo foi Plasmídeo com nenhuma proteína (T). Marcadores de tamanho de DNA são mostrados em kb. Produtos de integração de supercoiled plasmídeo (SC), concertado (CI), produtos de integração meia-site (HSI) e vDNA são indicados. (C) o agarose gel foi digitalizada para a presença de Cy5. Só o vDNA, CI e HSI produtos são visíveis. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57453/57453fig3v2.jpg"> Figura 3: quantificação de ensaio integração. O gel de agarose da Figura 2 foi digitalizado e quantificar a presença de EtBr (A) e (B) Cy5. (A) para o cálculo de EtBr, volumes de pixel de banda HSI, CI e SC foram obtidos usando software de análise de gel. Eficiência de integração foi calculada dividindo o volume de pixel de produtos de integração concertada (CI) pelo volume total de pixel de todas as três bandas (HSI + CI + SC). Por exemplo, os valores de pixel no EtBr canalizar para as bandas da fração #49 são: 110565.2 SC, 25152.56 CI e 6313.04 HSI. O valor de pixel de DNA total para fração #49 é a soma desses valores, 142030.8. A eficiência de integração é o volume de pixel de CI da 25152.56 dividido pelo valor de DNA total 142030.8 igualando 0.18. (B) Cy5 CI volumes de pixel de banda são graficamente como unidades arbitrárias. Fracções com atividade de integração de pico são individualmente aliquotadas e congelados. Neste exemplo, frações #50-53 foram selecionadas. Alíquotas são snap congelado com nitrogênio líquido e armazenado a-80 ˚ c para uso futuro.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57453/57453fig4.jpg"> Figura 4: efeito do congelamento na atividade de intasome. Metade da fração de um segundo foi flash congelado com nitrogênio líquido, armazenado a-80 ˚ c por 1h e então lentamente descongeladas no gelo. A metade restante da fração SEC foi mantido no gelo em uma sala fria, enquanto o primeiro semestre foi congelado e descongelado. Intasomes foram testados para a atividade sem (-) e com (+) congelamento/descongelamento. Eficiência de integração foi medida conforme descrito acima. (A) EtBr manchada de gel de agarose dos produtos da reacção de integração. Supercoiled plasmídeo (SC), concertado integração produtos (CI), metade-site de integração (HSI) e não tenha reagido vDNA são indicados. Marcadores de tamanho de DNA são mostrados em kb. (B) a quantificação da eficiência da imagem EtBr integração. Cálculos são descritos na legenda da Figura 3 . Não há nenhuma perda de atividade de integração após congelação e descongelação. A eficiência média de integração é mostrada para 5 experimentos independentes com 2 intasome preparações. Barras de erro indicam o desvio padrão. Teste t pareado análises renderam um P bicaudal = 0.011, sugerindo que o congelamento/descongelamento pode ligeiramente realçaram atividade de integração. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig4large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57453/57453fig5.jpg"> Figura 5: rotular impactos molécula e posição de montagem intasome. Conjuntos de intasome PFV incluíam vDNAs que estavam sem rótulo (vermelho), final rotulado na Oligo 2 com Cy5 (azul), internamente rotulados em Oligo 1 com Cy5 (preto) ou fim rotulado na Oligo 2 com biotina (laranja). Todos os assemblies foram separados com uma coluna de agarose SEC. O eixo y denota OD em mAU. Cromatogramas são representativas de pelo menos 2 conjuntos independentes de cada tipo de intasome. Rotulagem final reduz o rendimento do PFV intasomes com Cy5 10-fold e biotina 1.8-fold. Conjuntos de Cy5 e biotina final ter precipitado visivelmente mais restante após alta sal resolubilization (passo 3.5), resultando em perda aparente do material na coluna de exclusão de tamanho. Rotulagem interna do vDNA com o fluoróforo Cy5 leva a um rendimento igual de intasomes como vDNA sem rótulo. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig5large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Integrase retroviral recombinante e oligómeros de DNA imitando extremidades de DNA virais podem formar um complexo enzimaticamente ativo conhecido como um intasome. Intasomes pode ser utilizado para estudos bioquímicos, estruturais e cinéticos. Este protocolo fornece detalhes sobre como montar e purificar o protótipo vírus espumoso intasomes.

Montagem e purificação do protótipo vírus espumoso Intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

5.4K visualizações.  The Ohio State University College of Medicine. Integrase retroviral recombinante e oligómeros de DNA imitando extremidades de DNA virais podem formar um complexo enzimaticamente ativo conhecido como um intasome. Intasomes pode ser utilizado para estudos bioquímicos, estruturais e cinéticos. Este protocolo fornece detalhes sobre como montar e purificar o protótipo vírus espumoso intasomes.

Vídeo: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

Simples e robusto In vivo E In vitro Abordagem para o Estudo Assembléia Virus

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Imunologia e Infecção

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

Purificação por afinidade de Complexos de Influenza Virus ribonucleoproteína da cromatina de células infectadas

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

Purificação de vacúolos patógeno de<em&gt; Legionella</em&gt; Infectados Fagócitos

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Resgate de Vírus da Doença de Newcastle recombinante de cDNA

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

Isolamento, identificação e purificação de células epiteliais do timo murino

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Isolamento de neutrófilos e análise para determinar seu papel na linfoma sensibilidade das células a agentes terapêuticos

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Avaliação da eficácia e toxicidade de RNAs Segmentação HIV-1 Produção para uso em Gene ou Quimioterapia

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Salvamento e Caracterização do Vírus Recombinante de um Clone Infeccioso do Vírus do Novo Mundo Zika

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

Deteção e remoção de contaminação de Nuclease durante a purificação do protótipo recombinante vírus espumoso Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

Extração rápida, segura e simples Manual cabeceira de ácidos nucleicos para a detecção de vírus em amostras de sangue total

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...