This work was supported by NIH AI099854 and AI126742 to KEY.

1. Annealing of vDNA
<ol>
	<li>Combine 1X TEN Buffer (10X TEN stock: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA), 10 &#181;M Oligo 1 (5&#39; ATTGTCATGGAATTTTGTATATTGAGTGGCGCCCGAACAG 3&#39;, 100 &#181;M stock), and 10 &#181;M Oligo 2 (5&#39; CTGTTCGGGCGCCACTCAATATACAAAATTCCATGACA 3&#39;, 100 &#181;M stock) in a final volume of 1.5 mL. Aliquot 25 &#181;L into sixty 0.2-mL polymerase chain reaction (PCR) tubes. 
	NOTE: Depending on the application, oligomers may be modified with fluorophores or tags at the 5&#39;-end of Oligo 2 or as an internal amino-T at base 13 from the 5&#39;-end of Oligo 1. Modified oligomers should be purified by high-performance liquid chromatography (HPLC) before annealing. We have found that 5&#39;-end Cy3 or Cy5 fluorophore labeling of Oligo 2 reduces the intasome assembly efficiency 10-fold. Internal fluorophore labeling does not reduce assembly efficiency.</li>
	<li>Anneal using a thermocycler with the following times and temperatures: 1 cycle at 94.0 &#730;C 3 min, 99 cycles at (94.0 &#730;C 1 min, 93.6 &#730;C 1 min) decreasing both temperatures by 0.8 &#730;C per cycle (the last cycle is 14.8 &#730;C 1 min, 14.4 &#730;C 1 min), and store at 4.0 &#730;C.</li>
	<li>Combine the annealing reactions from all sixty tubes. Load 500 &#181;L to two 0.5-mL 3 kDa molecular weight cutoff (MWCO) ultracentrifugal filter concentration units. Concentrate the annealed vDNA by centrifugation in a microcentrifuge at 14,000 x g for 10 min at room temperature (RT). 
	NOTE: The retentate volume should be ~50 &#181;L in each concentration unit.</li>
	<li>Discard the flow through. Add 250 &#181;L of the remaining annealed vDNA to each filter unit. Repeat the spin and discard the flow through. Buffer exchange into TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) by washing three times with 450 &#181;L TE.</li>
	<li>Invert the filter unit and spin at 1,000 x g for 2 min at RT. The final retentate volume for each filter unit should be ~50 &#181;L. Combine the retentates and transfer to a 1.5 mL screw cap tube.</li>
	<li>Measure the 260-nm ultraviolet (UV) absorbance of the vDNA. Use this value to calculate the final molar DNA concentration. The extinction coefficient (&#949;260) of this vDNA is 622,803 cm-1 M-1 and its molecular weight is 23,972 Da. Store at -20 &#730;C.</li>
</ol>
2. Intasome Assembly
<ol>
	<li>If possible, perform the intasome assembly in a small room with a variable thermostat. Adjust the thermostat to approximately 18-22 &#730;C. 
	NOTE: In our experience, intasome assembly at 4 &#730;C is inefficient.</li>
	<li>Prepare 1 L of dialysis buffer (20 mM Bis-tris propane, pH 7.5, 200 mM NaCl, 2 mM dithiothreitol (DTT), 25 &#181;M ZnCl2) in a 2 L beaker with a stir bar on a stir plate. Equilibrate the buffer in the 18-22 &#730;C room for at least 6 h.</li>
	<li>To assemble the intasomes, combine 50 mM Bis-tris propane, pH 7.5, 500 mM NaCl, 120 &#181;M PFV IN, and 50 &#181;M vDNA in a total volume of 150 &#181;L. 
	NOTE: The PFV IN should be free of contaminating nuclease activity7,8. If the concentration of PFV IN is too dilute to accommodate 120 &#181;M IN in 150 &#181;L volume, then it is possible to increase the final volume to 200 &#181;L. The critical factors of this step are to maintain the molar ratio of IN to vDNA (2.4:1) and to have enough complex to visualize during chromatography.</li>
	<li>Clean a ~10-cm long piece of 10-mm 6-8 kDa MWCO dialysis tubing and clips with double distilled water (ddH2O), or the highest purity water available. Clip one end of the tubing. 
	NOTE: Dialysis tubing should be handled with care to prevent any possible contamination from the lab space.</li>
	<li>Make 15 mL of dialysis tubing rinse buffer (50 mM Bis-tris propane, pH 7.5, 500 mM NaCl). Rinse the inside of the dialysis tubing three times with 1-2 mL rinse buffer. Remove as much of the rinse buffer as possible with a pipette and thin gel loading tip.</li>
	<li>If necessary, use a clean razor blade or scalpel to cut the dialysis tubing so that a thin gel loading tip may reach the end of the tubing.</li>
	<li>Transfer the intasome assembly from step 2.3 to the dialysis tubing with a pipette and a thin gel loading tip. Clip the open end of the dialysis tubing, minimizing the amount of air introduced within the tubing. Place the tubing into the dialysis buffer.</li>
	<li>Dialyze overnight (16-20 h) with gentle stirring so that the tubing rotates but is not in a vortex. Ensure that the dialysis tubing is submerged and mobile. After approximately one hour, observe a visible precipitate inside the tubing. 
	NOTE: With Cy3 or Cy5 fluorescently labeled vDNA, the precipitate is more obvious. This is true for both end labeled and internally labeled fluorescent vDNA.</li>
</ol>
3. Intasome Solubilization
<ol>
	<li>Prepare two wide bore pipette tips by removing 2-4 mm from the end of a 200 &#181;L tip with a new razor or scalpel blade on a clean surface. 
	NOTE: The tips will be used in step 3.3 and 3.5.</li>
	<li>Remove the dialysis tubing from the dialysis buffer. In order to prevent dilution of the intasome sample with dialysis buffer that may remain at the end of the tubing near the clip, use a micropipette with a small pipette tip to remove any excess dialysis buffer. Remove the clip from one end of the dialysis tubing.</li>
	<li>Use a wide bore pipette tip from step 3.1 to transfer the sample including the precipitate inside the dialysis tubing to a 1.5-mL tube on ice. Note the total volume of the recovered material; the total volume is typically ~140 &#181;L.</li>
	<li>The sample with precipitate is at 200 mM NaCl; increase the salt to a final concentration of 320 mM NaCl by adding the appropriate volume of a stock 5 M NaCl solution. For example, for a sample of 150 &#181;L, add 3.9 &#181;L 5 M NaCl and 1.1 &#181;L ddH2O for a final volume of 155 &#181;L. Transfer ice bucket with sample into a 4 &#730;C cold room.</li>
	<li>Use a wide bore pipette tip from step 3.1 to resuspend and solubilize the precipitate by pipetting. Repeat every 20 min for at least 1 h. Observe that most of the precipitate should go into solution. 
	NOTE: Pipetting to resuspend the precipitate can be stopped when it is apparent that the precipitate is no longer noticeably reduced between time points. When vDNA is not labeled or is internally labeled, the precipitate is reduced by ~90% based on visual inspection. In the case of Cy5 end labeled vDNA, the precipitate is reduced by only ~20%; most of the precipitate with fluorophore end labeled vDNA will not solubilize. The amount of precipitate that is effectively solubilized is variable and should be empirically determined.</li>
</ol>
4. Intasome Purification
<ol>
	<li>Prepare 250 mL of size exclusion chromatography (SEC) running buffer (20 mM Bis-tris propane, pH 7.5, 320 mM NaCl, 10% glycerol). Sterile filter the buffer with a 0.2-&#181;m filter unit and store at 4 &#730;C. 
	NOTE: All purification steps are performed in a 4 &#730;C cold room.</li>
	<li>Equilibrate a cross-linked agarose SEC column (diameter = 10 mm; length = 300 mm; bed volume = 24 mL; sample volume = 25 - 500 &#181;L; maximum pressure = 1.5 MPa; exclusion limit = 4 x 107 Da; separates molecular weights between 5 and 5,000 kDa, see the Table of Materials) with SEC running buffer at a flow rate of 0.4 mL/min. 
	NOTE: This purification may be adapted to different size exclusion columns if they are able to effectively separate 300 kDa from 44 kDa, such as Superose 12 10/300 GL or Superose 6 Increase. Superose 12 10/300 GL has lower resolution, leading to more overlap of peaks. Conversely, Superose 6 Increase has higher resolution and offers better separation.</li>
	<li>Centrifuge the intasome sample in a microfuge at 14,000 x g for 10 min at 4 &#730;C to pellet any remaining precipitate. Carefully remove the supernatant. Load the supernatant to a 200 &#181;L injection loop (tubing that can hold ~200 &#956;L). Apply the sample to the SEC column. 
	NOTE: Smaller load volumes allow greater resolution by SEC.</li>
	<li>Elute with 25 mL SEC running buffer and collect 95 fractions of 270 &#181;L. Observe that the SEC chromatogram displays three A280/A260 peaks (Figure 1). 
	NOTE: The first should be an aggregate (~9.0 - 11.5 mL elution), followed by the PFV tetramer intasome peak (~12.0 - 14.75 mL elution) and PFV IN monomer with free vDNA peak (~15.0 - 18.0 mL).</li>
</ol>
5. Integration Strand Transfer Assay, Fraction Selection, and Storage
<ol>
	<li>Combine 2 &#181;L of each intasome peak fraction and 50 ng 3 kb supercoiled plasmid DNA (stock concentration is 50 ng/&#181;L) in reaction buffer (10 mM Bis-tris propane, pH 7.5, 110 mM NaCl, 5 mM MgSO4, 4 &#181;M ZnCl2, 10 mM DTT) in a final reaction volume of 15 &#181;L. Incubate at 37 &#730;C for 5 min.</li>
	<li>Include a negative control with no added PFV intasome. Stop the reaction with 0.75 &#181;L proteinase K (20 mg/mL stock solution) and 0.75 &#181;L SDS (10% stock solution). Incubate at 55 &#730;C for 1 h. Store samples as needed at -20 &#730;C for later analyses. 
	NOTE: This assay is a qualitative assessment of integration activity. The intasome molar concentration of each fraction is not determined prior to this assay. Fractions included in the integration strand transfer assay can be stored on ice (including overnight storage) until integration activity is confirmed and selected fractions are aliquoted. Here we use pMP2, a pUC19 derivative9. We have also successfully used the 5.4 kb plasmid pcDNA 3.1. Any plasmid that may be resolved to relaxed circle, linear, and supercoiled forms may be used as a target for integration.</li>
	<li>Prepare a 120 mL 1% weight per volume (w/v) agarose gel in 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA) with 0.1 &#956;g/mL ethidium bromide (EtBr, 10 mg/mL stock solution)10. Melt the agarose solution and pour it into a 15 cm x 10 cm gel casting tray. Insert a 15-well comb with 5-mm wide, 0.75-mm thick wells. 
	NOTE: Narrower wells yield better band resolution compared to 1.5-mm thick wells.</li>
	<li>Allow the gel to solidify at ambient temperature. Immerse the gel in 1X TAE with 0.1 &#956;g/mL EtBr.</li>
	<li>Add 3 &#181;L 50% glycerol to each integration reaction from step 5.2. Load the entire reaction volume to the gel. Load 1 &#181;L of 10 kb DNA size marker (150 ng/&#181;L stock concentration) to lanes on either side of the samples; in other words, the DNA size marker should flank the sample lanes.</li>
	<li>In an outer lane, load 6 &#181;L Orange G dye (0.25% Orange G, 30% glycerol). Run the gel at constant voltage, 10 V/cm (100 V) at ambient temperature for 1 h, or until the Orange G dye front reaches the end of the gel.</li>
	<li>Immediately image the agarose gel with a fluorescent scanner set to detect EtBr (532 nm excitation, 610 nm emission filter). If fluorophore labeled vDNAs were used, also image with appropriate fluorophore settings. 
	NOTE: For example, to detect Cy5 labeled DNA, image using 633 nm excitation and 670 nm emission filters. Concerted integration products (CI, linear DNA) should run true to size at ~3 kb, unreacted supercoiled plasmid (SC) should run faster (~2 kb), and half-site integration products (HSI, relaxed circle DNA) should run slower (~3.5 kb). Unreacted vDNA should run true to size at ~40 bp.</li>
	<li>Quantify the bands in each lane with imaging software7. Calculate the fraction of DNA in each lane that is CI, HSI, or SC; vDNA is not included in this calculation. 
	NOTE: Integration efficiency, or the fraction of SC converted to a linear product, was calculated by dividing the pixel volume of concerted integration products (CI) by the total pixel volume of three bands (HSI+CI+SC). If intasomes are fluorophore labeled, the HSI and CI products may also be quantitated by fluorescence.</li>
	<li>Select fractions that have the most concerted integration activity. 
	NOTE: In our experience, the peak concerted integration activity coincides with the protein peak identified as tetrameric PFV intasomes. Measure the A280 of each of these fractions and calculate the final intasome concentration. The &#949;280 for a tetramer of wild type PFV IN with two vDNAs described here is 908,339 cm-1M-1 and the molecular weight is 225.5 kDa. The concentrations should follow the same pattern as the SEC chromatogram peak and in the strand transfer assay.</li>
	<li>Distribute each fraction in 5 &#181;L aliquots and snap freeze in liquid nitrogen. Store aliquots at -80 &#730;C. Fractions selected for storage are typically between 200 - 600 nM.</li>
</ol>

<ol>
	<li>Coffin, J. M., Hughes, S. H., Varmus, H. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Retroviruses. , (1997).</li><li>Valkov, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+and+structural+characterization+of+the+integrase+from+the+prototype+foamy+virus.">Functional and structural characterization of the integrase from the prototype foamy virus.</a> Nucleic Acids Res. 37 (1), 243-255 (2009).</li><li>Hare, S., Gupta, S. S., Valkov, E., Engelman, A., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasome+assembly+and+inhibition+of+DNA+strand+transfer.">Retroviral intasome assembly and inhibition of DNA strand transfer.</a> Nature. 464 (7286), 232-236 (2010).</li><li>Li, M., Lin, S., Craigie, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Outer+domains+of+integrase+within+retroviral+intasomes+are+dispensible+for+catalysis+of+DNA+integration.">Outer domains of integrase within retroviral intasomes are dispensible for catalysis of DNA integration.</a> Protein Sci. 25 (2), 472-478 (2016).</li><li>Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Solution+conformations+of+prototype+foamy+virus+integrase+and+its+stable+synaptic+complex+with+U5+viral+DNA.">Solution conformations of prototype foamy virus integrase and its stable synaptic complex with U5 viral DNA.</a> Structure. 20 (11), 1918-1928 (2012).</li><li>Jones, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+intasomes+search+for+a+target+DNA+by+1D+diffusion+which+rarely+results+in+integration.">Retroviral intasomes search for a target DNA by 1D diffusion which rarely results in integration.</a> Nat Commun. 7, 11409 (2016).</li><li>Lopez, M. A., Mackler, R. M., Altman, M. P., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Detection and removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Vis Exp. , (2017).</li><li>Lopez, M. A., Mackler, R. M., Yoder, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+nuclease+contamination+during+purification+of+recombinant+prototype+foamy+virus+integrase.">Removal of nuclease contamination during purification of recombinant prototype foamy virus integrase.</a> J Virol Methods. 235, 134-138 (2016).</li><li>Poirier, M. G., Bussiek, M., Langowski, J., Widom, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+access+to+DNA+target+sites+in+folded+chromatin+fibers.">Spontaneous access to DNA target sites in folded chromatin fibers.</a> J Mol Biol. 379 (4), 772-786 (2008).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J Vis Exp. (62), (2012).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+reveals+a+novel+octameric+integrase+structure+for+betaretroviral+intasome+function.">Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function.</a> Nature. 530 (7590), 358-361 (2016).</li><li>Ballandras-Colas, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+supramolecular+assembly+mediates+lentiviral+DNA+integration.">A supramolecular assembly mediates lentiviral DNA integration.</a> Science. 355 (6320), 93-95 (2017).</li><li>Passos, D. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-EM+structures+and+atomic+model+of+the+HIV-1+strand+transfer+complex+intasome.">Cryo-EM structures and atomic model of the HIV-1 strand transfer complex intasome.</a> Science. 355 (6320), 89-92 (2017).</li><li>Yin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Rous+sarcoma+virus+intasome.">Crystal structure of the Rous sarcoma virus intasome.</a> Nature. 530 (7590), 362-366 (2016).</li><li>Maertens, G. N., Hare, S., Cherepanov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+retroviral+integration+from+X-ray+structures+of+its+key+intermediates.">The mechanism of retroviral integration from X-ray structures of its key intermediates.</a> Nature. 468 (7321), 326-329 (2010).</li><li>Maskell, D. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+retroviral+integration+into+nucleosomes.">Structural basis for retroviral integration into nucleosomes.</a> Nature. 523 (7560), 366-369 (2015).</li></ol>

The authors have nothing to disclose.

Retroviral INs form a multimeric complex with viral genomic DNA to perform integration and continue the viral life cycle. The number of IN monomers per intasome may be tetramers, octamers, or possibly higher order multimers11,12,13,14. PFV intasomes are a tetramer of recombinant IN with double-stranded DNA oligomers that mimic viral genomic DNA ends3. These intasomes have been used in structural and dynamic studies3,5,13,14.
The assembly of PFV intasomes occurs during dialysis from a relatively high salt concentration buffer to a lower salt concentration. This results in the formation of a precipitate which includes the PFV intasomes. The intasomes are solubilized by increasing the salt concentration. PFV IN has been shown to be monomeric at concentrations up to 225 &#181;M5. The complexes are then isolated from monomeric IN and free vDNA by SEC. We have modified the purification of PFV intasomes to include glycerol in the SEC buffer6. The addition of glycerol allows the PFV intasomes to be frozen for future use without loss of activity (Figure 4).
There are several key features of this protocol. Although protein purification is often performed at low temperatures, we have found empirically that PFV intasome assembly is inefficient at 4 &#730;C. Instead, the assembly dialysis should occur in the range of 18-22 &#730;C. It is also important to use recombinant PFV IN that is free of contaminating bacterial nuclease7,8. Finally, the ratio of IN to vDNA is a key factor of the assembly. If the starting IN protein concentration is lower than recommended here, the vDNA concentration must be proportionally decreased. While it is possible to assemble PFV intasomes at lower concentrations, the complexes must be at a high enough concentration for detection during SEC separation.
This method may be used for PFV intasomes with unlabeled or labeled vDNA. We have found that the vDNA may be efficiently labeled with a fluorophore or biotin6. Other small molecule labels may also be possible. In the case of Cy5 fluorophore, we find that end labeled vDNA reduces the yield of assembled intasomes with the peak concentration reduced 10-fold. However, internally Cy5 labeled vDNA has an equivalent yield to unlabeled vDNA. This assembly method may also be used with point mutations or truncation mutations of PFV IN4. Since PFV IN is inhibited by clinically relevant IN strand transfer inhibitor (INSTI) drugs targeting HIV-1 IN, it is possible to use these PFV intasomes to study the mechanism of INSTIs3. In addition, some INSTI resistant mutations of HIV-1 IN occur at conserved residues in PFV IN, allowing studies of drug resistance with engineered PFV intasomes.

Integration of the viral genome into the host genome is a mandatory step in the life cycle of all retroviruses1. The viral enzyme integrase (IN) catalyzes the covalent joining of each end of the viral DNA genome to the host DNA. During a cellular infection, IN is part of a pre-integration complex that mediates integration. Recombinant IN complexed with double stranded DNA oligomers mimicking the viral DNA ends can also perform integration into a target DNA in vitro2. A common integration assay in vitro utilizes a supercoiled plasmid as the target DNA. Integration of both viral DNA oligomers (vDNA) to the plasmid results in a linear product and is termed concerted integration (Figure 2A). The integration assay in vitro may also yield products with only one vDNA covalently joined to the target plasmid resulting in a relaxed circle. This half-site integration product appears to be an artefact of the assay in vitro.
Recombinant IN and vDNA may perform integration in vitro, but they are not ideal reagents for the study of the dynamics or structure of integration complexes when monomeric IN would obscure relevant visualization. Purified integration complexes, or &#34;intasomes,&#34;&#160;are required for dynamic single molecule analysis or structural studies. PFV IN and vDNAs may be assembled by dialysis from a relatively high salt concentration buffer to a lower salt concentration3,4. During dialysis, a precipitate forms. This precipitate is removed from dialysis and the salt concentration is increased. The higher salt concentration solubilizes the precipitate containing PFV intasomes. The intasomes are then purified by size exclusion chromatography (SEC). Recombinant prototype foamy virus (PFV) IN has been shown to exist as a monomer in solution at concentrations up to 225 &#181;M5. SEC fractionation effectively separates the PFV intasomes (225.5 kDa), which includes a tetramer of PFV IN and two vDNAs, from monomeric PFV IN (44.4 kDa) and free vDNA (24.0 kDa). The PFV intasomes may be frozen and retain integration activity for at least six months of storage at -80 &#730;C.
Recombinant PFV intasomes may also be modified to include IN amino acid substitutions or truncation mutations or vDNAs labeled with fluorophores or biotin4,6. The purified PFV intasomes readily perform integration into a supercoiled plasmid target DNA in vitro. Bulk biochemical integration assays with intasomes may test the effects of IN mutations, IN inhibitors, or other chemical additives. Biotinylated intasomes can be used to probe affinity with nucleic acids or proteins. PFV intasomes are functional at ambient temperature allowing for single molecule microscopy analysis by magnetic tweezers to measure the time between joining of the two vDNA ends or total internal reflection fluorescence to visualize the intasome search on target DNA6. In addition, PFV intasomes were the first to be structurally characterized significantly impacting the field of retroviral integration3.

<table>
	<tbody>
		<tr>
			<td>DNA Oligomers</td>
			<td>IDT</td>
			<td>N/A</td>
			<td>Custom DNA Oligos</td>
		</tr>
		<tr>
			<td>Tris Ultra Pure</td>
			<td>Gojira Fine Chemicals</td>
			<td>UTS1003</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>P212121</td>
			<td>RP-S23020</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure EDTA</td>
			<td>Invitrogen/Gibco</td>
			<td>15575</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 0.5 mL centrifugal filters</td>
			<td>Sigma-Aldrich</td>
			<td>Z677094-24EA</td>
			<td>3 kDa MWCO</td>
		</tr>
		<tr>
			<td>DTT&#160;</td>
			<td>P212121</td>
			<td>SV-DTT</td>
			<td></td>
		</tr>
		<tr>
			<td>BIS-TRIS propane,&#62;=99.0% (titration)</td>
			<td>Sigma-Aldrich</td>
			<td>B6755-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnCl2</td>
			<td>Sigma-Aldrich</td>
			<td>208086</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4</td>
			<td>Amresco</td>
			<td>0662</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>G37-20</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel-loading tips, 1 - 200 &#956;L</td>
			<td>Corning</td>
			<td>CLS4853-400EA</td>
			<td></td>
		</tr>
		<tr>
			<td>Razor blade; Single-edged; 100/Pk.; Pack of 100</td>
			<td>Fisher Scientific</td>
			<td>12-640</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile Disposable Filter Units with PES Membrane &#62; 250mL</td>
			<td>Thermo Fisher Scientific</td>
			<td>568-0020</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis tubing clips</td>
			<td>Spectrum Labs</td>
			<td>132734</td>
			<td></td>
		</tr>
		<tr>
			<td>6-8 kDa 10 mm Dialysis Tubing</td>
			<td>Spectrum Medical</td>
			<td>132645</td>
			<td></td>
		</tr>
		<tr>
			<td>Superose 6 10/300 GL</td>
			<td>GE Healthcare Life Sciences</td>
			<td>17517201</td>
			<td></td>
		</tr>
		<tr>
			<td>Hi-Res Standard Agarose</td>
			<td>AGTC Bioproducts</td>
			<td>AG500D1</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP1302</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Fisher Scientific</td>
			<td>0-267</td>
			<td></td>
		</tr>
		<tr>
			<td>Hyladder 10kb, 500 lanes</td>
			<td>Denville Scientific</td>
			<td>CB4225-4</td>
			<td></td>
		</tr>
	</tbody>
</table>

assembly and purification of prototype foamy virus intasomes

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an integrase (IN) enzyme that catalyzes the covalent joining of viral to host DNA, which is known as strand transfer. Integration may be modeled in vitro with recombinant retroviral IN and DNA oligomers mimicking the ends of the viral genome. In order to more closely recapitulate the integration reaction that occurs in vivo, integration complexes are assembled from recombinant IN and synthetic oligomers by dialysis in a reduced salt concentration buffer. The integration complex, called an intasome, may be purified by size exclusion chromatography. In the case of prototype foamy virus (PFV), the intasome is a tetramer of IN and two DNA oligomers and is readily separated from monomeric IN and free oligomer DNA. The integration efficiency of PFV intasomes may be assayed under a variety of experimental conditions to better understand the dynamics and mechanics of retroviral integration.

PFV intasomes are assembled from recombinant IN and vDNA. After assembly, intasomes are purified by SEC (Figure 1). Integration activity of each fraction is assayed with a supercoiled DNA target and agarose gel electrophoresis (Figure 2). This gel is imaged with a fluorescent scanner set to detect EtBr (and fluorophore, if fluorophore-labeled vDNA is used). Using image analysis software, band pixel volumes can be used to calculate the integration efficiency (Figure 3). Fractions with the highest integration efficiency are snap frozen for later use. Frozen fractions retain integration activity (Figure 4), allowing for long term storage of assembled intasomes. Any label molecule and its position within the vDNA may affect intasome assembly efficiency (Figure 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57453/57453fig1.jpg" /> 
Figure 1: Size exclusion chromatogram. A PFV intasome assembly was separated with an agarose SEC column. This column allows for the separation of the aggregate (1), PFV intasome consisting of a tetramer of PFV IN and two vDNA (2), and monomeric PFV IN and vDNA (3). This example included vDNA with an internal Cy5 fluorophore label detected by 650 nm excitation. The y-axis denotes optical density (OD) in milli-absorbance units (mAU). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57453/57453fig2.jpg" /> 
Figure 2: Integration assay of SEC fractions. (A) Schematic of integration strand transfer reaction. Left, cartoon of a PFV intasome including a tetramer of IN (blue circles) and two vDNA (thick black lines), and a target plasmid (thin black lines). The supercoils (SC) of the target plasmid are not drawn. Center, cartoon of a half-site integration (HSI) product when one vDNA has been covalently joined to the target plasmid. The joining reaction introduces a nick and relaxes the supercoils. Right, cartoon of a concerted integration (CI) product where two vDNAs have been joined to the target DNA. This integration product results in a linear DNA with vDNAs at the ends. (B) Supercoiled plasmid DNA was added to each SEC fraction #49-55. Following incubation, the integration reactions were deproteinated and separated by 1% agarose gel electrophoresis containing EtBr. Negative control was plasmid DNA with no protein (T). DNA size markers are shown in kb. Supercoiled plasmid (SC), concerted integration products (CI), half-site integration products (HSI), and vDNA are indicated. (C) The agarose gel was scanned for the presence of Cy5. Only the vDNA, CI, and HSI products are visible. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57453/57453fig3v2.jpg" /> 
Figure 3: Quantitation of integration assay. The agarose gel from Figure 2 was scanned and quantified for the presence of both (A) EtBr and (B) Cy5. (A) For the EtBr calculation, HSI, CI, and SC band pixel volumes were obtained using gel analysis software. Integration efficiency was calculated by dividing the pixel volume of concerted integration products (CI) by the total pixel volume of all three bands (HSI+CI+SC). For example, the pixel values in the EtBr channel for the bands of fraction #49 are: 110565.2 SC, 25152.56 CI, and 6313.04 HSI. The total DNA pixel value for fraction #49 is the sum of these values, 142030.8. The integration efficiency is the CI pixel volume of 25152.56 divided by the total DNA value 142030.8 equaling 0.18. (B) Cy5 CI band pixel volumes are graphed as arbitrary units. Fractions with peak integration activity are individually aliquoted and frozen. In this example, fractions #50-53&#160;were selected. Aliquots are snap frozen with liquid nitrogen and stored at -80 &#730;C for future use.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57453/57453fig4.jpg" /> 
Figure 4: Effect of freezing on intasome activity. Half of one SEC fraction was flash frozen with liquid nitrogen, stored at -80 &#730;C for 1 h, and then slowly thawed on ice. The remaining half of the SEC fraction was kept on ice in a cold room while the first half was frozen and thawed. Intasomes were tested for activity without (-) and with (+) freeze/thawing. Integration efficiency was measured as described above. (A) EtBr stained agarose gel of integration reaction products. Supercoiled plasmid (SC), concerted integration products (CI), half-site integration products (HSI), and unreacted vDNA are indicated. DNA size markers are shown in kb. (B) Quantitation of the integration efficiency from the EtBr image. Calculations are described in Figure 3 legend. There is no loss of integration activity following freezing and thawing. The average integration efficiency is shown for 5 independent experiments with 2 intasome preparations. Error bars indicate the standard deviation. Paired t-test analyses yielded a two-tailed P = 0.011, suggesting that the freeze/thaw may have slightly enhanced integration activity. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57453/57453fig5.jpg" /> 
Figure 5: Label molecule and position impacts intasome assembly. PFV intasome assemblies included vDNAs that were unlabeled (red), end labeled on Oligo 2 with Cy5 (blue), internally labeled on Oligo 1 with Cy5 (black), or end labeled on Oligo 2 with biotin (orange). All assemblies were separated with an agarose SEC column. The y-axis denotes OD in mAU. Chromatograms are representative of at least 2 independent assemblies of each intasome type. End labeling reduces the yield of PFV intasomes with Cy5 10-fold and biotin 1.8-fold. End Cy5 and biotin assemblies have noticeably more precipitate remaining after high salt resolubilization (step 3.5), resulting in apparent loss of material on the size exclusion column. Internal labeling of the vDNA with the Cy5 fluorophore leads to an equal yield of intasomes as unlabeled vDNA. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57453/57453fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Assembly and Purification of Prototype Foamy Virus Intasomes at JoVE.com

Assembly and Purification of Prototype Foamy Virus Intasomes

Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

A defining feature and necessary step of the retrovirus life cycle is the integration of the viral genome into the host genome. All retroviruses encode an ...

assembly-and-purification-of-prototype-foamy-virus-intasomes

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

5.4K Views.  The Ohio State University College of Medicine. Recombinant retroviral integrase and DNA oligomers mimicking viral DNA ends can form an enzymatically active complex known as an intasome. Intasomes may be used for biochemical, structural, and kinetic studies. This protocol details how to assemble and purify prototype foamy virus intasomes.

Video: Assembly and Purification of Prototype Foamy Virus Intasomes

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal phase during establishment of infection in a given host. Consequently, study of encapsidation deciphers the information regarding the know-how of the mechanism regulating virus assembly to form infectious virions. Such information is vital in formulating novel methods of curbing virus spread and disease control. Virus encapsidation can be studied in vivo and in vitro. Genome encapsidation in vivo is a highly regulated selective process involving macromolecular interactions and subcellular compartmentalization. Therefore, study leading to dissect events encompassing virus encapsidation in vivo would provide basic knowledge to understand how viruses proliferate and assemble. Recently in vitro encapsidation has been exploited for the research in the area of biomedical imaging and therapeutic applications. Non-enveloped plant viruses stand far ahead in the venture of in vitro encapsidation of the negatively charged foreign material. Brome mosaic virus (BMV), a non-enveloped multicomponent RNA virus pathogenic to plants, has been used as a model system for studying genome packaging in vivo and in vitro. For encapsidation assays in Nicotiana benthamiana plants, Agrobacterium -mediated transient expression, refer to as agroinfiltration, is an efficient and robust technique for the synchronized delivery and expression of multiple components to the same cell. In this approach, a suspension of Agrobacterium tumefaciens cells carrying binary plasmid vectors carrying cDNAs of desiredviral mRNAs is infiltrated into the intercellular space withina leaf using nothing more sophisticated than a 1 ml disposable syringe (without needle). This process results in the transfer of DNA insert into plant cells; the T-DNA insert remains transiently in the nucleus and is then transcribed by the host polymerase II, leading to the transient expression. The resulting mRNA transcript (capped and polyadenylated) is then exported to the cytoplasm for translation. After approximately 24 to 48 hours of incubation,sections of infiltrated leaves can be sampled for microscopyor biochemical analyses. Agroinfiltration permits large numbers (hundreds to thousands) of cells to be transfected simultaneously. For in vitro encapsidation, purified virions of BMV are dissociated into capsid protein by dialyzing against dissociation buffer containing calcium chloride followed by removal of RNA and un-dissociated virions by centrifugation. Genome depleted capsid protein subunits are then reassembled with desired viral genome components or non-viral components such as indocyanine dye.

Simple and Robust in vivo and in vitro Approach for Studying Virus Assembly

A simple, efficient and robust way to synchronize the delivery of multiple viral components to plant cells via Agrobacterium-mediated transient expression is described. This approach is amenable for studying replication, encapsidation followed by in vitro reassembly of non-viral components into genome depleted optical viral ghosts suitable for biomedical applications.

In viruses with positive-sense RNA genomes pathogenic to humans, animals and plants, progeny encapsidation into mature and stable virions is a cardinal ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe pneumonia "Legionnaires' disease"1. In protozoan and mammalian phagocytes, L. pneumophila employs a conserved mechanism to form a specific, replication-permissive compartment, the "Legionella-containing vacuole" (LCV). LCV formation requires the bacterial Icm/Dot type IV secretion system (T4SS), which translocates as many as 275 "effector" proteins into host cells. The effectors manipulate host proteins as well as lipids and communicate with secretory, endosomal and mitochondrial organelles2-4.
The formation of LCVs represents a complex, robust and redundant process, which is difficult to grasp in a reductionist manner. An integrative approach is required to comprehensively understand LCV formation, including a global analysis of pathogen-host factor interactions and their temporal and spatial dynamics. As a first step towards this goal, intact LCVs are purified and analyzed by proteomics and lipidomics.
The composition and formation of pathogen-containing vacuoles has been investigated by proteomic analysis using liquid chromatography or 2-D gel electrophoresis coupled to mass-spectrometry. Vacuoles isolated from either the social soil amoeba Dictyostelium discoideum or mammalian phagocytes harboured Leishmania5, Listeria6, Mycobacterium7, Rhodococcus8, Salmonella9 or Legionella spp.10. However, the purification protocols employed in these studies are time-consuming and tedious, as they require e.g. electron microscopy to analyse LCV morphology, integrity and purity. Additionally, these protocols do not exploit specific features of the pathogen vacuole for enrichment.
The method presented here overcomes these limitations by employing D. discoideum producing a fluorescent LCV marker and by targeting the bacterial effector protein SidC, which selectively anchors to the LCV membrane by binding to phosphatidylinositol 4-phosphate (PtdIns(4)P)3,11 . LCVs are enriched in a first step by immuno-magnetic separation using an affinity-purified primary antibody against SidC and a secondary antibody coupled to magnetic beads, followed in a second step by a classical Histodenz density gradient centrifugation12,13 (Fig. 1).
A proteome study of isolated LCVs from D. discoideum revealed more than 560 host cell proteins, including proteins associated with phagocytic vesicles, mitochondria, ER and Golgi, as well as several GTPases, which have not been implicated in LCV formation before13. LCVs enriched and purified with the protocol outlined here can be further analyzed by microscopy (immunofluorescence, electron microscopy), biochemical methods (Western blot) and proteomic or lipidomic approaches.

Purification of Pathogen Vacuoles from Legionella-infected Phagocytes

This article describes a method for the isolation and purification of intact Legionella-containing vacuoles (LCVs) from amoeba and macrophages. The two-step protocol comprises LCV enrichment by immuno-magnetic separation using an antibody against a bacterial LCV marker and further purification by density gradient centrifugation.

The opportunistic pathogen Legionella pneumophila is an amoeba-resistant bacterium, which also replicates in alveolar macrophages thus causing the severe ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Isolation, Identification, and Purification of Murine Thymic Epithelial Cells

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple stages of T cell development: T cell commitment, positive selection and negative selection. However, the function of TECs in the thymus remains incompletely understood. In the article, we provide a method to isolate TEC subsets from fresh mouse thymus using a combination of mechanical disruption and enzymatic digestion. The method allows thymic stromal cells and thymocytes to be efficiently released from cell-cell and cell-extracellular matrix connections and to form a single-cell suspension. Using the isolated cells, multiparameter flow cytometry can be applied to identification and characterization of TECs and dendritic cells. Because TECs are a rare cell population in the thymus, we also describe an effective way to enrich and purify TECs by depleting thymocytes, the most abundant cell type in the thymus. Following the enrichment, cell sorting time can be decreased so that loss of cell viability can be minimized during purification of TECs. Purified cells are suitable for various downstream analyses like Real Time-PCR, Western blot and gene expression profiling. The protocol will promote research of TEC function and as well as the development of in vitro T cell reconstitution.

Here we describe an efficient method for isolation, identification, and purification of mouse thymic epithelial cells (TECs). The protocol can be utilized for studies of thymus function for normal T cell development, thymus dysfunction, and T cell reconstitution.

The thymus is a vital organ for T lymphocyte development. Of thymic stromal cells, thymic epithelial cells (TECs) are particularly crucial at multiple ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Evaluation of the Efficacy And Toxicity of RNAs Targeting HIV-1 Production for Use in Gene or Drug Therapy

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential to be used as drug therapies for HIV-1 infection. Post-integration inhibitors include ribozymes, short hairpin (sh) RNAs, small interfering (si) RNAs, U1 interference (U1i) RNAs and RNA aptamers. Many of these have been identified using transient co-transfection assays with an HIV-1 expression plasmid and some have advanced to clinical trials. In addition to measures of efficacy, small RNAs have been evaluated for their potential to affect the expression of human RNAs, alter cell growth and/or differentiation, and elicit innate immune responses. In the protocols described here, a set of transient transfection assays designed to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps in the HIV-1 replication cycle are described. We have used these assays to identify new ribozymes and optimize the format of shRNAs and siRNAs targeting HIV-1 RNA. The methods provide a quick set of assays that are useful for screening new anti-HIV-1 RNAs and could be adapted to screen other post-integration inhibitors of HIV-1 replication.

Methods to evaluate the efficacy and toxicity of RNA molecules targeting post-integration steps of the HIV-1 replication cycle are described. These methods are useful for screening new molecules and optimizing the format of existing ones.

Small RNA therapies targeting post-integration steps in the HIV-1 replication cycle are among the top candidates for gene therapy and have the potential ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Detection and Removal of Nuclease Contamination During Purification of Recombinant Prototype Foamy Virus Integrase

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared to IN from other retroviruses, PFV IN is more soluble and more amenable to experimental manipulation. Additionally, it is sensitive to clinically relevant human immunodeficiency virus (HIV-1) IN inhibitors, suggesting that the catalytic mechanism of PFV IN is similar to that of HIV-1 IN. IN catalyzes the covalent joining of viral complementary DNA (cDNA) to target DNA in a process called strand transfer. This strand transfer reaction introduces nicks to the target DNA. Analysis of integration reaction products can be confounded by the presence of nucleases that similarly nick DNA. A bacterial nuclease has been shown to co-purify with recombinant PFV IN expressed in Escherichia coli (E. coli). Here we describe a method to isolate PFV IN from the contaminating nuclease by heparin affinity chromatography. Fractions are easily screened for nuclease contamination with a supercoiled plasmid and agarose gel electrophoresis. PFV IN and the contaminating nuclease display alternative affinities for heparin sepharose allowing a nuclease-free preparation of recombinant PFV IN suitable for bulk biochemical or single molecule analysis of integration.

Recombinant prototype foamy virus integrase protein is often contaminated with a bacterial nuclease during purification. This method identifies nuclease contamination and removes it from the final preparation of the enzyme.

The integrase (IN) protein of the retrovirus prototype foamy virus (PFV) is a model enzyme for studying the mechanism of retroviral integration. Compared ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...