This work was supported by grants from the Shanghai Committee of Science and Technology (15411951800, 15410723200). The authors wish to thank Prof. YuMei Wen and Prof. Chao Zhao of the Pathogenic Microorganism Department of Fudan University for their technical assistance.

This method was performed in accordance with the approved guidelines and regulations of the Research Ethics Committee of Huashan Hospital, Fudan University. Corresponding standard safety measures were followed in each step. For a schematic presentation, please refer to Figure 1.
1. Cell Culture and Plasmid Construct
<ol>
	<li>Routinely maintain the human umbilical vein endothelial cell (HUVEC) in Dulbecco&#39;s modified Eagle&#39;s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 unit/mL of penicillin, and 100 &#181;g/mL of streptomycin in a humidified 5% CO2 incubator at 37 &#176;C.</li>
	<li>Digest PLKO.1 plasmid with ApaI and EcoRI for the synthesis of shRNA fragment. Ensure that the oligonucleotide sequence of VHL shRNA vector is CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.</li>
	<li>Then, mix 20 &#181;&#924; system with forward 5 &#181;L of oligo, 5 &#181;L of reverse oligo, 5 &#181;L of 10x NEB buffer and 35 &#181;L of ddH2O together (The total volume is 50 &#181;L). Heat the mixture at 98 &#176;C for 4 min, and slowly cool down to room temperature in a few hours.</li>
	<li>Ligate the annealed oligos and PLKO.1 plasmid together with T4 ligase at 4 &#176;C for overnight. 16 h later, add 5 &#181;L of ligation mix into 25 &#181;L competent DH5&#945; cells. Then, screen the successfully ligated plasmids, and verify the inserted fragment by sequencing.</li>
</ol>
2. Lentivirus Package and Infection
<ol>
	<li>In total, mix 10 &#181;g of the PLKO.1-shVHL or PLKO.1-shScramble vector, 7.5 &#181;g of packing plasmid psPAX2, and 2.5 &#181;g of envelope plasmid pMD2.G in 500 &#181;L of the DMEM media without fetal bovine serum (FBS) for 25 min.</li>
	<li>Add 7 mLDMEM without FBS to the solution prepared above.</li>
	<li>Culture 293FT cells in the DMEM without FBS in a 10-cm diameter tissue culture dishes. Ensure that the number of 293FT cells is 1 x 107 using a cell counter.</li>
	<li>Add 1 mL of the solution prepared above to the medium of 293FT cells for transfection. 
	Note: The 293FT cell line is derived from the 293F cell line and stably express the SV40 large T antigen. Therefore, it is a suitable host for lentiviral production.</li>
	<li>Replace the culture medium with the DMEM containing 10% FBS after 6 h.</li>
	<li>Collect the media using a pipette at 48 h after transfection. 
	Note: The virus exists in the DMEM containing 10% FBS. The dead cells float on the medium. Use 0.45 &#181;m sterile membrane to filter the dead cells and impurities. Generally, there is no need to check multiplicity of infection (MOI). This is to establish a stable cells line. At the last step, all living cells without successful infection will die by puromycin. The shScramble group and HUVEC cells are the control group. Ensure that all the HUVEC cells die with the used puromycin concentration by 72 h. Every well has the same number of cells.</li>
	<li>Culture the HUVEC cells in the lentiviral media for 72 h. Then, add puromycin to the media of the HUVEC cells at a concentration of 2 &#181;g/mL for 24 h. Use HUVEC cells without any treatment as the control group. Ensure that all control cells die by this time. 
	Note: The living cells represent a stable cell line of VHL knockdown cells and shSramble cells. The plating density is 5,000/well in 96-well plates.</li>
</ol>
3. Generation of Endothelial Cell Spheroids
<ol>
	<li>Trypsinize the HUVECs cells and resuspend in the DMEM medium with 10% FBS. With a moderate number of cells in a 10-cm culture dish, add 1 mL of typsin-EDTA.</li>
	<li>Seed the cells in a 3D round-bottom 96-well plate, at a cell density of 1 &#215; 103 cells/well. Use a well that can accommodate a spheroid of 0.50 &#181;L to suspend the spheroid. Count cells using a&#160;cell counter system following the manufacturer&#39;s instructions.</li>
	<li>Incubate the cells at 37 &#176;C and 5% CO2 continuously for 72 h. Under these conditions, ensure that the suspended cells form the cell spheroids automatically. Replace half of the culture medium after 36 h.</li>
</ol>
4. In vitro Angiogenesis Assay
<ol>
	<li>Thaw the gel solution at 4 &#176;C and dilute it with the reduced serum medium at a dilution ratio of 1:5.</li>
	<li>Suck the spheroids from the DMEM culture medium with a micropipette. After washing the spheroids with 5 mL of the reduced serum medium, suspend the spheroids gently and cautiously in the diluted gel. Ensure that there are no air bubbles.</li>
	<li>Embed 300 &#181;L of mixed liquid in a 15-well plate. After incubation at 37 &#176;C and 5% CO2 for 1 h, add 400 &#181;L the reduced serum medium to each well. Fill sterile water around the wells to generate a humidified environment to hinder evaporation.</li>
	<li>Thereafter, culture the plate at 37 &#176;C in 5% CO2 at 100% humidity for 1 h.</li>
	<li>Carefully aspirate the old medium and replace it by 600 &#181;L of reduced serum medium with 1% endothelial cell growth supplements in each well.</li>
	<li>After 12 h or 24 h, take images under an inverted light microscope (40*).</li>
</ol>
5. Data Analysis
<ol>
	<li>Upload the images to an online image analysis platform to obtain sprout length data (Table of Materials).</li>
	<li>On the webpage, create an account by email.</li>
	<li>Then upload the images by clicking the upload button.</li>
	<li>Download the result by clicking the download button. 
	Note: The software will generate the processed image and the data. The data contain five parts: cumulative sprout length, mean sprout length, the standard deviation of sprout length, sprout area and spheroid area. In the processed image, each parameter is outlined in a different color to ease identification in the processed image: Red represents sprouts skeleton, yellow the number of sprouts, blue the sprout structure, white sprout end, and orange spheroid.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

The authors have nothing to disclose.

Recently, multiple fields of vascular biology research were stimulated by the study of the angiogenic endothelium15. In this article, we developed an endothelial spheroid sprouting technique as an experimental model to study the vessel formation that originates from the VHL gene&#39;s loss of function in manipulated endothelial cells to identify novel candidate molecules of the angiogenic cascade. To the best of our knowledge, this is the first report to examine the angiogenic effects of the endogenic modified endothelial cells.
Tissue (including tumor tissue) neovascularization is a complex process that occurs via angiogenic and vasculogenic mechanisms during development, as well as in both physiological and pathological conditions12,15,16. The spheroid sprouting assay is characterized by a complex cascade of events17,18, including the self-aggregation of endothelial cells that are embedded in a 3D cell matrix culture system, which results in sprouting and the reproduction of the 3D network of capillaries19. This 3D gel-embedded spheroid model has become a widely used system in tissue engineering for studying the vascular formation and its mechanisms due to its ability to provide a better mimicking environment in a suitable matrix. However, the most crucial step of this biological process is the activation of quiescent endothelial cells17,20,21,22. In this procedure, the endothelial cells were activated by the endogenic silencing of the VHL gene, a regulator growth gene of neovessels23,24. Different from the classic endothelium initiation via the exogenous induction of the matrix and the corresponding extracellular environment (including exogenous vascular growth factors), this modified method can be extended to numerous applications to unravel endogenic genetic mechanisms. Next, to diminish the effects of the exogenous matrix, the protocol was optimized by diluting the gel, which was a simple step in the experiment. In addition, it took only minutes to upload images to the platform and to obtain analysis results. The platform provides an image analysis service that allows the experimenter to make an objective, comparable, and automated image analysis of sprouting assay images online. Therefore, the protocol overcomes measurement and calculation errors caused by man-made factors.
The mechanistic understanding of the individual steps of the neovascularization cascade provided a rational basis for the development of the anti-vascular treatment that is currently being approved for clinical application in oncology. This paper established a simple and robust spheroid-based assay model to study vessel formation that originates from manipulated endothelial cells with loss of function of the VHL gene to identify novel candidate molecules for the neovascularization cascade, which can be utilized for numerous angiogenesis- and vasculogenesis-related applications. The authors speculate that this in vitro model might provide additional information to help evaluate the role of angiogenesis in some solid tumors (e.g., tumor vasculogenic mimicry) and investigate the potential roles of other possible progenitor cells to generate tumor neovessels in vivo, particularly in patients with tumors that, as a group, are unresponsive to treatment with anti-angiogenic agents only.
The spheroid sprouting assay has become a widely used method to study angiogenesis and related mechanisms. The assay has an important advantage by providing a better mimic environment than the classical 2D cultures. Recently, 3D co-culture models have been developed to study tumor angiogenesis that mimics the heterogeneity and complexity of angiogenesis within the tumor microenvironment25. In this model, endothelial cells are cultured directly with cancer cells, as well as a stromal component in a 3D environment. In addition, 3D in vitro culture systems have been shown to reflect more accurately the in vivo response to therapeutic agents than conventional cell culture systems. In addition, this method is used for the differentiation of embryonic stem cells, tissue growth, wound healing, ischemia, and inflammation. Compared with the classic method, our approach is effective and easy to implement. We believe it is a useful tool for the study of angiogenesis in vitro, and it opens a new way to understand this process better.

Hemangioblastomas (HBs) are benign vascular tumors that are found exclusively within the human central nervous system (CNS). They develop in patients with either von Hippel-Lindau (VHL) disease or sporadic lesions. VHL-HBs are difficult to cure through surgical treatment due to the frequent recurrence and multiple lesions that result from this genetic disorder1. Although the inactivation of the VHL tumor suppressor gene has been considered the root cause of the tumorigenesis of VHL-HBs, the cytological origin (including neovascularization) and evolutionary process of HBs remain largely controversial2. Therefore, a better understanding of HB-neovascular biological mechanisms may provide useful insights into the most promising anti-vascular strategies for VHL-HBs.
Recent research has suggested that HB-neovascularization is similar to the embryologic vasculogenesis3,4,5. Classic vascular endothelial growth factor (VEGF)-mediated angiogenesis that originated from the vascular endothelium and that is driven by VHL loss of function resulted in proliferation and neovascular formation, which has been challenged6. In 1965, Cancilla and Zimmerman found, using electron microscopy, that HBs originated from the endothelium7. Later it was found that stromal cells are derived from vasoformative element8. In 1982, Jurco et al. found that stromal cells are of endothelial origin9. Therefore, we hypothesized that human vascular endothelial cells are the original cells of HB-neovascularization10. Although it is better to use the primary cultures from HB cells derived from VHL patient surgeries, our previous research indicated that primary cultures from HB are not stable, and cell lines could not be established3. Moreover, the primary cultures in the 3D environment could not identify the cytological origin of HB-neovascularization because they include the progenitors of HB-vascular ingredients10,11. Therefore, as a primitive and classic model of endothelial cells, human vascular endothelial cells (HUVEC) could serve as an alternative cellular model for HBs.
The spheroid sprouting assay is a new model in tissue engineering12,13. In this paper, a 3D collagen-based coculture system in vitro using the spheroid sprouting assay was developed, with an overall goal to evaluate whether classic tumor angiogenesis exists in HBs, as well as its role in HBs.

<table border="0" cellpadding="0" cellspacing="0" style="width:1516px;" width="1516">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:265px;">human umbilical vein endothelial cell</td>
			<td style="width:147px;">Fudan IBS Cell Center</td>
			<td style="width:343px;">FDCC-HXN180</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">dulbecco&#8217;s modified eagle&#8217;s medium&#160;</td>
			<td>Gibco</td>
			<td>11995040</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">fetal bovine serum</td>
			<td>Gibco</td>
			<td>&#160;26400044</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">PLKO.1-puro vector</td>
			<td>Addgene</td>
			<td>#8453</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">packing plasmid psPAX2&#160;</td>
			<td>Addgene</td>
			<td>#12260</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">envelope plasmid pMD2.G</td>
			<td>Addgene</td>
			<td>#12259</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">3D round-bottom 96-well plates</td>
			<td>S-Bio</td>
			<td>MS-9096M</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">matrigel</td>
			<td>BD Biosciences</td>
			<td>354234</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Opti-MEM medium</td>
			<td>Gibco</td>
			<td>31985-070</td>
			<td style="width:761px;">reduced serum medium&#160;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">15-well plate</td>
			<td>Ibidi</td>
			<td>81501</td>
			<td>Air bubbles in the gel can be reduced by equilibrating the &#956;&#8211;Slide angiogenesis before usage inside the incubator overnight</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">endothelial cell growth supplements</td>
			<td>Sciencell</td>
			<td>#1052</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">10-cm culture dish</td>
			<td>Corning</td>
			<td>Scipu000813</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Puromycin</td>
			<td>Gibco</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">typsin-EDTA</td>
			<td>Gibco</td>
			<td>25200056</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Automated Cell Counter System &#160;</td>
			<td>BioTech</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Image Analysis software&#160;</td>
			<td>Winmasis</td>
			<td style="width:343px;"></td>
			<td>http://mywim.wimasis.com&#160;</td>
		</tr>
	</tbody>
</table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human central nervous system (CNS). However, both the cytological origin and the evolutionary process of HBs (including neovascularization) remain controversial, and anti-angiogenesis for VHL-HBs, based on classic HB angiogenesis, have produced disappointing results in clinical trials. One major obstacle to the successful clinical translation of anti-vascular treatment is the lack of a thorough understanding of neovascularization in this vascular tumor. In this article, we present a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in HBs, as well as its role in HBs. With this procedure, researchers can accurately understand the complexity of HB neovascularization and identify the function of this common form of angiogenesis in HBs. These protocols can be used to evaluate the most promising anti-vascular therapy for tumors, which has high translational potential either for tumors treatment or for aiding in the optimization of the anti-angiogenic treatment for HBs in future translations. The results highlight the complexity of HB neovascularization and suggest that this common form angiogenesis is only a complementary mechanism in HB neovascularization.

Original images are taken by inverted light microscope. The typical images of the control group and the VHL group are shown in Figure 2-A1 and Figure 2-A2. The sprouting length of the control group is shorter than that of the VHL group.
After uploading the Images, the online platform provides analysis results directly. The output consists of two parts: the processed image and the corresponding analysis results. The processed images of the control group and the VHL gene silence group are marked with different colors (Figure 2-A3 and Figure 2-A4). The mean sprout length is 65 &#181;m and 125 &#181;m in the control group and the VHL silence group, respectively, and the average cumulative sprout length is 680 &#181;m and 1250 &#181;m in the control group and the VHL silence group, respectively, indicating that sprout length increases by approximately two folds in the VHL silence group, compared with the control group (Figure 2B). These results indicate that VHL deficiency promotes the vessel-forming ability of human endothelial cells.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57183/57183fig1.jpg" /> 
Figure 1. The schema for the spheroid sprouting assay. Steps 1 shows HUVEC cells cultured a dish. In Steps 2, HUVEC cells are moved to 3D round-bottom 96-well plates for 72 h. Steps 3 shows the HUVEC cells form endothelial cell spheroids automatically in the 3D plate. In Steps 4, add cell spheroid to diluted gel. In Steps 5, add the mixture prepared above to a 15-well plate. Steps 6 shows spheroid sprouting in the 15-well plate. Steps 7 show the sprouting image taken under an inverted light microscope. Steps 8 shows the uploaded image and step 9 is the output image from the platform (bar = 100 &#181;m). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57183/57183fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57183/57183fig2.jpg" /> 
Figure 2. The effect of VHL gene silencing on the angiogenic ability of HUVEC cells in the spheroid sprouting assay.&#160;(A) Representative images of spout outgrowth after 12 h in control (A1) and VHL-silenced HUVEC spheroids (A2) (bar = 100 &#181;m). Figures A3 and A4 show the images analyzed by the platform for Figures A1 and A2, respectively. Red represents sprouts skeleton, yellow the number of sprouts, blue the sprout structure, white sprout end, and orange spheroid. (B) Length of the sprouts. Statistical analysis was performed using unpaired Student&#39;s t-test. * represent P &#60; 0.05. CON, control; HUVEC, human umbilical vein endothelial cell. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57183/57183fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

This paper presents a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in hemangioblastomas (HBs) and its role in HBs. The results highlight the complexity of HB-neovascularization and suggest that this common form of angiogenesis is only a complementary mechanism in the HB-neovascularization.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.9K Views.  Fudan University. This paper presents a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in hemangioblastomas (HBs) and its role in HBs. The results highlight the complexity of HB-neovascularization and suggest that this common form of angiogenesis is only a complementary mechanism in the HB-neovascularization.

Video: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Utilizing Functional Genomics Screening to Identify Potentially Novel Drug Targets in Cancer Cell Spheroid Cultures

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery of the next generation of novel drug targets. It is becoming apparent that more complex models of cancer are required to fully appreciate the contributing factors that drive tumorigenesis in vivo and increase the efficacy of novel therapies that make the transition from pre-clinical models to clinical trials.
Here we present a methodology for generating uniform and reproducible tumor spheroids that can be subjected to siRNA functional screening. These spheroids display many characteristics that are found in solid tumors that are not present in traditional two-dimension culture. We show that several commonly used breast cancer cell lines are amenable to this protocol. Furthermore, we provide proof-of-principle data utilizing the breast cancer cell line BT474, confirming their dependency on amplification of the epidermal growth factor receptor HER2 and mutation of phosphatidylinositol-4,5-biphosphate 3-kinase (PIK3CA) when grown as tumor spheroids. Finally, we are able to further investigate and confirm the spatial impact of these dependencies using immunohistochemistry.

Identifying novel drug targets that transition from pre-clinical testing to human trials is a scientific priority. To that end, here we describe a functional genomics approach for examining the impact of gene depletion on cancer cell line spheroids, which more appropriately model human cancers in vivo.

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery ...

A Comprehensive Procedure to Evaluate the In Vivo Performance of Cancer Nanomedicines

Inspired by the success of previous cancer nanomedicines in the clinic, researchers have generated a large number of novel formulations in the past decade. However, only a small number of nanomedicines have been approved for clinical use, whereas the majority of nanomedicines under clinical development have produced disappointing results. One major obstacle to the successful clinical translation of new cancer nanomedicines is the lack of an accurate understanding of their in vivo performance. This article features a rigorous procedure to characterize the in vivo behavior of nanomedicines in tumor-bearing mice at systemic, tissue, single-cell, and subcellular levels via the integration of positron emission tomography-computed tomography (PET-CT), radioactivity quantification methods, flow cytometry, and fluorescence microscopy. Using this approach, researchers can accurately evaluate novel nanoscale formulations in relevant mouse models of cancer. These protocols may have the ability to identify the most promising cancer nanomedicines with high translational potential or to aid in the optimization of cancer nanomedicines for future translation.

A Comprehensive Procedure to Evaluate the In Vivo Performance of Cancer Nanomedicines

The poor understanding of the in vivo performance of nanomedicines stymies their clinical translation. Procedures to evaluate the in vivo behavior of cancer nanomedicines at systemic, tissue, single-cell, and subcellular levels in tumor-bearing immunocompetent mice are described here. This approach may help researchers to identify promising cancer nanomedicines for clinical translation.

Inspired by the success of previous cancer nanomedicines in the clinic, researchers have generated a large number of novel formulations in the past ...

Evaporation-reducing Culture Condition Increases the Reproducibility of Multicellular Spheroid Formation in Microtiter Plates

Tumor models that closely imitate in vivo conditions are becoming increasingly popular in drug discovery and development for the screening of potential anti-cancer drugs. Multicellular tumor spheroids (MCTSes) effectively mimic the physiological conditions of solid tumors, making them excellent in vitro models for lead optimization and target validation. Out of the various techniques available for MCTS culture, the liquid-overlay method on agarose is one of the most inexpensive methods for MCTS generation. However, the reliable transfer of MCTS cultures using liquid-overlay for high-throughput screening may be compromised by a number of limitations, including the coating of microtiter plates (MPs) with agarose and the irreproducibility of uniform MCTS formation across wells. MPs are significantly prone to edge effects that result from excessive evaporation of medium from the exterior of the plate, preventing the use of the entire plate for drug tests. This manuscript provides detailed technical improvements to the liquid-overlay technique to increase the scalability and reproducibility of uniform MCTS formation. Additionally, details on a simple, semi-automatic, and universally applicable software tool for the evaluation of MCTS features after drug treatment is presented.

The uneven loss of medium from microtiter plates affects the reproducibility of uniform multicellular tumor spheroid formation. Improving culture conditions to reduce significant medium loss will improve the reproducibility of spheroid formation and the results of spheroid-based assays using the liquid-overlay technique.

Tumor models that closely imitate in vivo conditions are becoming increasingly popular in drug discovery and development for the screening of potential ...

Using the Dot Assay to Analyze Migration of Cell Sheets

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move within tissues in a tightly orchestrated manner. During tumor development, this equilibrium is disturbed, and tumor cells leave the epithelium of origin to invade the local microenvironment, to travel to distant sites, and to ultimately form metastatic tumors at distant sites. The dot assay is a simple, two-dimensional unconstrained migration assay, to assess the net movement of cell sheets into a cell-free area, and to analyze parameters of cell migration using time-lapse imaging. Here, the dot assay is demonstrated using a human invasive, lung colony forming breast cancer cell line, MCF10CA1a, to analyze the cells' migratory response to epidermal growth factor (EGF), which is known to increase malignant potential of breast cancer cells and to alter the migratory phenotype of cells.

Cell migration is essential for development, tissue maintenance and repair, and tumorigenesis, and is regulated by growth factors, chemokines, and cytokines. This protocol describes the dot assay, a two-dimensional, unconstrained migration assay to assess the migratory phenotype of attached, cohesive cell sheets in response to microenvironmental cues.

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move ...

Modeling Osteosarcoma Using Li-Fraumeni Syndrome Patient-derived Induced Pluripotent Stem Cells

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including osteosarcoma--one of the most frequent primary non-hematologic malignancies in the childhood and adolescence. Therefore, LFS provides an ideal model to study this malignancy. Taking advantage of iPSC methodologies, LFS-associated osteosarcoma can be successfully modeled by differentiating LFS patient iPSCs to mesenchymal stem cells (MSCs), and then to osteoblasts--the cells of origin for osteosarcomas. These LFS osteoblasts recapitulate oncogenic properties of osteosarcoma, providing an attractive model system for delineating the pathogenesis of osteosarcoma. This manuscript demonstrates a protocol for the generation of iPSCs from LFS patient fibroblasts, differentiation of iPSCs to MSCs, differentiation of MSCs to osteoblasts, and in vivo tumorigenesis using LFS osteoblasts. This iPSC disease model can be extended to identify potential biomarkers or therapeutic targets for LFS-associated osteosarcoma.

Here, we present a protocol for the generation of induced pluripotent Stem Cells (iPSCs) from Li-Fraumeni Syndrome (LFS) patient derived fibroblasts, differentiation of iPSCs via mesenchymal stem cells (MSCs) to osteoblasts, and modeling in vivo tumorigenesis using LFS patient-derived osteoblasts.

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...

Modeling Brain Metastases Through Intracranial Injection and Magnetic Resonance Imaging

Metastatic spread of cancer is an unfortunate consequence of disease progression, aggressive cancer subtypes, and/or late diagnosis. Brain metastases are particularly devastating, difficult to treat, and confer a poor prognosis. While the precise incidence of brain metastases in the United States remains hard to estimate, it is likely to increase as extracranial therapies continue to become more efficacious in treating cancer. Thus, it is necessary to identify and develop novel therapeutic approaches to treat metastasis at this site. To this end, intracranial injection of cancer cells has become a well-established method in which to model brain metastasis. Previously, the inability to directly measure tumor growth has been a technical hindrance to this model; however, increasing availability and quality of small animal imaging modalities, such as magnetic resonance imaging (MRI), are vastly improving the ability to monitor tumor growth over time and infer changes within the brain during the experimental period. Herein, intracranial injection of murine mammary tumor cells into immunocompetent mice followed by MRI is demonstrated. The presented injection approach utilizes isoflurane anesthesia and a stereotactic setup with a digitally controlled, automated drill and needle injection to enhance precision, and reduce technical error. MRI is measured over time using a 9.4 Tesla instrument in The Ohio State University James Comprehensive Cancer Center Small Animal Imaging Shared Resource. Tumor volume measurements are demonstrated at each time point through use of ImageJ. Overall, this intracranial injection approach allows for precise injection, day-to-day monitoring, and accurate tumor volume measurements, which combined greatly enhance the utility of this model system to test novel hypotheses on the drivers of brain metastases.

Intracranial brain metastasis modeling is complicated by an inability to monitor tumor size and response to treatment with precise and timely methods. The presented methodology couples intracranial tumor injection with magnetic resonance imaging analysis, which when combined, cultivates precise and consistent injections, enhanced animal monitoring, and accurate tumor volume measurements.

Metastatic spread of cancer is an unfortunate consequence of disease progression, aggressive cancer subtypes, and/or late diagnosis. Brain metastases are ...

A Three-Dimensional Spheroid Model to Investigate the Tumor-Stromal Interaction in Hepatocellular Carcinoma

The aggressiveness and lack of well-tolerated and widely effective treatments for advanced hepatocellular carcinoma (HCC), the predominant form of liver cancer, rationalize its rank as the second most common cause of cancer-related death. Preclinical models need to be adapted to recapitulate the human conditions to select the best therapeutic candidates for clinical development and aid the delivery of personalized medicine. Three-dimensional (3D) cellular spheroid models show promise as an emerging in vitro alternative to two-dimensional (2D) monolayer cultures. Here, we describe a 3D tumor spheroid&#160;model which exploits the ability of individual cells to aggregate when maintained in hanging droplets, and is more representative of an in vivo environment than standard monolayers. Furthermore, 3D spheroids can be produced by combining homotypic or heterotypic cells, more reflective of the cellular heterogeneity in vivo, potentially enabling the study of environmental interactions that can influence progression and treatment responses. The current research optimized the cell density to form 3D homotypic and heterotypic tumor spheroids by immobilizing cell suspensions on the lids of standard 10 cm3 Petri dishes. Longitudinal analysis was performed to generate growth curves for homotypic versus heterotypic tumor/fibroblasts spheroids. Finally, the proliferative impact of fibroblasts (COS7 cells) and liver myofibroblasts (LX2) on homotypic tumor (Hep3B) spheroids was investigated. A seeding density of 3,000 cells (in 20 &#181;L media) successfully yielded Huh7/COS7 heterotypic spheroids, which displayed a steady increase in size up to culture day 8, followed by growth retardation. This finding was corroborated using Hep3B homotypic spheroids cultured in LX2 (human hepatic stellate cell line) conditioned medium (CM). LX2 CM triggered the proliferation of Hep3B spheroids compared to control tumor spheroids. In conclusion, this protocol has shown that 3D tumor spheroids can be used as a simple, economical, and prescreen in vitro tool to study tumor-stromal interactions more comprehensively.

Comprehensive in vitro models that faithfully recapitulate the relevant human disease are lacking. The current study presents three-dimensional (3D) tumor spheroid creation and culture, a reliable in vitro tool to study the tumor-stromal interaction in human hepatocellular carcinoma.

The aggressiveness and lack of well-tolerated and widely effective treatments for advanced hepatocellular carcinoma (HCC), the predominant form of liver ...