이 작품은 상하이 과학 위원회 및 기술 (15411951800, 15410723200)에서 교부 금에 의해 지원 되었다. 저자 교수 YuMei 원 및 그들의 기술 지원에 대 한 병원 성 미생물과 복 단 대학 교수 차오 Zhao 감사 하 고 싶습니다.

이 메서드는 연구 윤리 위원회의 Huashan 병원, 복 단 대학교의 승인 된 지침에 따라 수행 되었다. 해당 표준 안전 조치는 각 단계에 따라 했다. 도식 프레 젠 테이 션, 그림 1을 참조 하십시오.
1. 세포 배양 및 플라스 미드 구조
<ol><li>정기적으로 유지 하는 Dulbecco에서 인간의 탯 줄 정 맥 내 피 세포 (HUVEC)이 글의 중간 (DMEM) 10% 태아 둔감 한 혈 청 (FBS), 페니실린, 100 단위/mL와 100 µ g/mL 스 습도 5%에서의 보완 수정의 CO2 배양 기 37 ° c.에</li>
	<li>PLKO.1 플라스 ApaI와 EcoRI shRNA 조각의 합성에 대 한 다이제스트. VHL shRNA 벡터의 oligonucleotide 시퀀스 CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14인지 확인 합니다.</li>
	<li>다음, 20 µΜ 시스템 올리고, 역방향 올리고의 5 µ L, 코 버퍼 x 10의 5 µ L ddH2O 함께 (총 볼륨은 50 µ L)의 35 µ L의 앞으로 5 µ L 믹스. 몇 시간에서 4 분, 그리고 천천히 실내 온도 아래로 냉각을 위한 98 ° C에 혼합물을 열.</li>
	<li>하룻밤을 위해 단련된 oligos 및 4 ° C에서 T4 리가 함께 PLKO.1 플라스 미드를 선. 16 h는 나중에, 25 µ L 유능한 DH5α 세포에 결 찰 믹스의 5 µ L를 추가 합니다. 그리고 성공적으로 합자 플라스 미드를 화면 연속 삽입 된 부분을 확인 합니다.</li>
</ol>2. lentivirus 패키지 및 감염
<ol><li>총, PLKO.1-shVHL 또는 PLKO.1 shScramble 벡터의 10 µ g, 7.5 µ g의 플라스 미드 psPAX2, 포장 및 봉투 플라스 미드 pMD2.G 태아 둔감 한 혈 청 (FBS) 25 분 없이 DMEM 미디어의 500 µ L에서의 2.5 µ g을 혼합.</li>
	<li>위의 준비 솔루션 FBS 없이 7 mLDMEM를 추가 합니다.</li>
	<li>10 cm 직경 조직 문화 요리에서 FBS 없이 DMEM 293 피트 셀 문화. 293 피트 셀 수 1 x 107 셀 카운터를 사용 하 여 있는지 확인 합니다.</li>
	<li>Transfection 293 피트 셀의 매체에 위의 준비 솔루션의 1 mL를 추가 합니다. 참고: 293 피트 셀 라인 293F 셀 라인에서 파생 되 고 안정적으로 SV40 큰 T 항 원을 표현 한다. 따라서, 그것은 lentiviral 생산을 위한 적합 한 호스트입니다.</li>
	<li>10% 포함 된 DMEM 문화 매체를 바꿉니다 6 h 후 FBS.</li>
	<li>Transfection 후 48 h에는 피 펫을 사용 하 여 미디어를 수집 합니다. 참고: 10% 포함 된 DMEM에 존재 하는 바이러스 FBS. 죽은 세포는 매체에 부동. 사용 하 여 0.45 μ m 살 균 막 죽은 세포 및 불순물 필터링. 일반적으로, 감염 (MOI)의 다양성을 확인할 필요가 있다. 이것은 안정 된 세포 선 확립 하입니다. 마지막 단계에서 성공적인 감염 없이 모든 살아있는 세포 puromycin에 의해 죽을 것 이다. ShScramble 그룹 및 HUVEC 세포는 제어 그룹. 모든 HUVEC 셀 72 h 사용된 puromycin 농도로 죽을 확인 합니다. 모든 잘 동일한 셀 수가 있다.</li>
	<li>HUVEC 셀 72 h lentiviral 미디어에 문화. 그런 다음 컨트롤 그룹으로 치료 없이 24 h. 사용 HUVEC 셀 2 µ g/mL의 농도에서 HUVEC 셀의 미디어를 puromycin를 추가 합니다. 모든이 시간 셀 다 제어를 확인 합니다. 참고: 살아있는 세포 VHL 최저의 세포와 shSramble 세포의 안정적인 셀 라인을 나타냅니다. 도금 밀도가입니다 96 잘 접시에 5000/잘.</li>
</ol>3입니다. 세대 내 피 세포 Spheroids의
<ol><li>HUVECs 셀 trypsinize 및 10 %DMEM 매체에 resuspend FBS. 10 cm 문화 접시에 있는 세포의 적당 한 수, typsin-EDTA의 1 mL를 추가 합니다.</li>
	<li>셀 셀 밀도 1 × 103 셀/3D 라운드 아래 96 잘 접시에 씨앗 회전 타원 체를 일시 중단 하려면 0.50 µ L의 회전 타원 체를 수용할 수 있는 우물을 사용 합니다. 제조업체의 지침에 따라 셀 카운터 시스템을 사용 하 여 셀을 계산 합니다.</li>
	<li>37 ℃에서 72 h에 대 한 지속적으로 5% CO2 셀을 품 어. 이러한 조건에서 일시 중단 된 세포 형성 자동으로 셀 spheroids 확인 합니다. 36 h 후 문화 매체의 절반을 교체 합니다.</li>
</ol>4. 체 외에서 신생 분석 결과
<ol><li>4 ° C에서 젤 솔루션을 해 동 하 고 희석 비율 1: 5의에 감소 된 혈 청 매체와 그것을 희석.</li>
	<li>Spheroids는 micropipette와 DMEM 배양에서 빨 아. 세척 후 감소 된 혈 청 매체의 5 mL와 함께 spheroids 일시 중지는 spheroids 부드럽게 그리고 조심 스럽게 희석된 젤에서. 없음 기포 확인 합니다.</li>
	<li>15-잘 접시에 혼합된 액체의 300 µ L를 포함 합니다. 37 ° C, 5% CO2 1 h에서 부 화, 후 각 우물에 400 µ L 감소 된 혈 청 매체를 추가 합니다. 메 마른 물 증발을 방해 하는 습도 환경 생성 우물 주위를 작성 합니다.</li>
	<li>그 후, 5% CO2 1 h 100% 습도에서 37 ° C에서 격판덮개 문화.</li>
	<li>신중 하 게 오래 된 매체를 발음 하 고 감소 된 혈 청 매체에 각 잘 1% 내 피 세포 성장 보충제와의 600 µ L로 합니다.</li>
	<li>12 시간 또는 24 시간 후 거꾸로 가벼운 현미경 이미지를 받아 (40 *).</li>
</ol>5. 데이터 분석
<ol><li>새싹 길이 데이터 (테이블의 재료)를 얻기 위해 온라인 이미지 분석 플랫폼에는 이미지를 업로드.</li>
	<li>웹 페이지에 전자 메일 계정을 만듭니다.</li>
	<li>다음 업로드 버튼을 클릭 하 여 이미지를 업로드 합니다.</li>
	<li>다운로드 버튼을 클릭 하 여 결과 다운로드 합니다. 참고: 소프트웨어 처리 이미지와 데이터를 생성 합니다. 5 부분을 포함 하는 데이터: 누적 새싹 길이, 평균 새싹 길이 길이 새싹, 새싹 영역 및 회전 타원 체 지역의 표준 편차. 처리 된 이미지에서 각 매개 변수 처리 이미지에서 식별을 쉽게 하기 위해 다른 색상으로 설명 하는: 빨간 나타냅니다 해골 콩나물, 콩나물의 수 노란, 파란 새싹 구조, 백색 새싹 끝, 및 오렌지 회전 타원 체.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

저자는 공개 없다.

최근, 혈관 생물학 연구의 여러 분야는 신생 endothelium15의 연구에 의해 자극 되었다. 이 문서에서는, 우리는 내 피 회전 타원 체의 소설 후보 분자 식별 하 조작 내 피 세포에서 기능의 VHL 유전자의 손실에서 유래 혈관 형성을 연구 하는 실험 모델 기법을 돋 아 개발에 신생 캐스케이드입니다. 우리의 지식 최선을이 endogenic 수정 된 내 피 세포의 신생 효과 검사 하는 첫 번째 보고서 이다.
(를 포함 하 여 종양 조직) 조직을 neovascularization 통해 신생 및 vasculogenic 메커니즘 두 생리 및 병 적인 조건12,15 에서 뿐만 아니라 개발 하는 동안 발생 하는 복잡 한 과정은 , 16. 회전 타원 체 분석 결과 돋 아 이벤트17,18, 돋 아에서 결과 3D 셀 매트릭스 문화 시스템에 포함 되어 있는 내 피 세포의 각자 집계를 포함 한 복잡 한 캐스케이드 특징 이다 그리고 모세 혈관19의 3 차원 네트워크의 재생산. 이 3D 젤 포함 회전 타원 체 모델 혈관 형성을 연구 하 고 그 메커니즘에 적합 한 매트릭스 mimicking 더 나은 환경을 제공 하는 기능 때문에 조직 공학에서 널리 사용 되는 시스템 되고있다. 그러나,이 생물 학적 과정의 가장 중요 한 단계는 무부하 내 피 세포17,20,,2122의 활성화 이다. 이 절차에서는 내 피 세포 되었다 VHL 유전자, neovessels23,24의 레 귤 레이 터 성장 유전자의 endogenic 입을 활성화 됩니다. 고전적인 endothelium 개시 를 통해 매트릭스와 해당 extracellular 환경 (포함 세 혈관 성장 인자)의 외 인 유도에서 다른,이 수정된 방법은 확장할 수 있습니다에 수많은 endogenic 유전자 메커니즘을 해명 하는 응용 프로그램. 다음, 외 인 매트릭스의 영향을 점감 하는 프로토콜 실험에 간단한 단계는 젤을 diluting 하 여 최적화 되었다. 또한, 그것은 플랫폼에 이미지를 업로드 하 고 분석 결과를 분만 했다. 플랫폼 목표, 분석 결과 이미지를 온라인을 돋 아의 비교, 그리고 자동화 된 이미지 분석 하도록 실험을 허용 하는 이미지 분석 서비스를 제공 합니다. 따라서, 프로토콜 인공 요인에 의해 발생 하는 측정 및 계산 오류를 극복 한다.
Neovascularization 캐스케이드의 개별 단계의 기계적 이해 현재 종양학에서 임상 응용 프로그램에 대 한 승인 되 고 반대로 혈관 치료의 개발에 대 한 합리적인 기초를 제공 합니다. 이 문서는 neovascularization에 대 한 소설 후보 분자 식별 VHL 유전자의 기능의 손실 가진 조작된 내 피 세포에서 유래 혈관 형성을 공부 하는 간단 하 고 강력한 회전 타원 체 기반 분석 결과 모델 설립 폭포가 있는 수많은 신생 및 vasculogenesis 관련 응용 프로그램에 대 한 이용 될 수 있다. 저자는이 체 외에 모델 일부 고체 종양 (예를 들어, 종양 vasculogenic 흉내)에서 신생의 역할을 평가 하 고 다른 가능한 조상 세포의 잠재적인 역할을 조사할 수 있도록 추가 정보를 제공할 수 있습니다 추측 생성 종양 neovessels에서 vivo에서, 특히 환자 종양, 그룹으로, 안티-신생 작용만 치료에 반응 하지 않습니다.
회전 타원 체 돋 아 분석 결과 신생 및 관련된 메커니즘 연구에 널리 사용 되는 방법 되고있다. 분석 결과 클래식 2D 문화 보다 더 나은 모방 환경을 제공 하 여 중요 한 장점이 있다. 최근, 3D 공동 문화 모델이 고 종양 microenvironment25내 신생의 복잡성을 종양 혈관 신생 연구 개발 되었습니다. 이 모델에서는 내 피 세포는 암 세포 뿐만 아니라 3D 환경에서 stromal 구성 요소와 직접 교양. 또한, 문화 시스템 3 차원 생체 외에서 기존의 세포 배양 시스템 보다 치료제 vivo에서 응답 더 정확 하 게 반영 하기 위해 표시 되었습니다. 또한,이 메서드는 배아 줄기 세포, 조직 성장, 상처 치유, 허 혈, 및 염증의 감 별 법을 위해 사용 됩니다. 전통적인 방법에 비해, 우리의 접근은 효과적이 고 쉽게 구현할 수 있습니다. 우리는 신생에서 생체 외에서연구를 위한 유용한 도구입니다 그것은 더 나은이 과정을 이해 하는 새로운 방법을 엽니다 것을 믿습니다.

Hemangioblastomas (HBs)는 독점적으로 인간 중앙 신경 시스템 (CNS) 내에서 발견 되는 양성 혈관 종양. 그들은 폰 Hippel Lindau (VHL) 질병 또는 산발적 병 변 환자에서 개발. VHL HBs 빈번한 재발으로 인해 수술 치료를 통해 치료 하기 어려운 고 발생이 유전자 여러 병 변 장애1. VHL 종양 억제기 유전자의 비활성화 VHL HBs tumorigenesis의 근본 원인을 고려 하고있다, 비록 HBs의 진화 과정과 cytological 근원 (를 포함 하 여 neovascularization) 크게 논란이2남아 있다. 따라서, HB-신생 생물 학적 메커니즘의 더 나은 이해 VHL HBs에 대 한 가장 유망한 항 혈관 전략에 유용한 통찰력을 제공할 수 있습니다.
최근 연구는 건의 HB neovascularization가 vasculogenesis3,,45와 비슷합니다. 고전적인 혈관 내 피 성장 인자 (VEGF)-중재 신생 혈관 내 피에서 유래 하 고 그 기능의 VHL 손실에 의해 구동 됩니다 확산 귀착되 고 신생 형성 되었습니다 도전6. 1965 년, Cancilla와 짐머만, 전자 현미경 검사 법, HBs endothelium7에서 유래를 사용 하 여. 나중 stromal 세포 vasoformative 요소8에서 파생 됩니다 발견 했다. 1982 년에, Jurco 그 외 여러분 발견 stromal 세포 내 피 기원9. 따라서, 우리는 인간의 혈관 내 피 세포는 HB neovascularization10의 원래 세포 가설. HB 셀 VHL 환자 수술에서 파생 된에서 기본 문화권을 사용 하는 것이 낫다, 비록 우리의 이전 연구 표시는 HB에서 주 문화는, 셀 라인 설립된3수 없습니다. 또한, 3D 환경에서 주 문화는 HB 혈관 재료10,11의 창시자를 포함 하기 때문 HB neovascularization cytological 원산지를 식별 하지 수 없습니다. 따라서, 내 피 세포의 원시적이 고 고전적인 모델 인간의 혈관 내 피 세포 (HUVEC) 대체 세포 모델 HBs에 대 한 될 수 있습니다.
회전 타원 체 돋 아 분석 결과 조직 공학12,13에 새로운 모델입니다. 이 문서에는 3D 콜라겐 기반의 coculture 시스템에서 생체 외에서 분석 결과 돋 아 회전 타원 체를 사용 하 여 개발 되었다, 고전적인 종양 신생 HBs, HBs의 역할에 있는지 여부를 평가 하는 전반적인 목표.

<table border="0" cellpadding="0" cellspacing="0" style="width:1516px;" width="1516">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:265px;">human umbilical vein endothelial cell</td>
			<td style="width:147px;">Fudan IBS Cell Center</td>
			<td style="width:343px;">FDCC-HXN180</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">dulbecco&#8217;s modified eagle&#8217;s medium&#160;</td>
			<td>Gibco</td>
			<td>11995040</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">fetal bovine serum</td>
			<td>Gibco</td>
			<td>&#160;26400044</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">PLKO.1-puro vector</td>
			<td>Addgene</td>
			<td>#8453</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">packing plasmid psPAX2&#160;</td>
			<td>Addgene</td>
			<td>#12260</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">envelope plasmid pMD2.G</td>
			<td>Addgene</td>
			<td>#12259</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">3D round-bottom 96-well plates</td>
			<td>S-Bio</td>
			<td>MS-9096M</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">matrigel</td>
			<td>BD Biosciences</td>
			<td>354234</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Opti-MEM medium</td>
			<td>Gibco</td>
			<td>31985-070</td>
			<td style="width:761px;">reduced serum medium&#160;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">15-well plate</td>
			<td>Ibidi</td>
			<td>81501</td>
			<td>Air bubbles in the gel can be reduced by equilibrating the &#956;&#8211;Slide angiogenesis before usage inside the incubator overnight</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">endothelial cell growth supplements</td>
			<td>Sciencell</td>
			<td>#1052</td>
			<td style="width:761px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">10-cm culture dish</td>
			<td>Corning</td>
			<td>Scipu000813</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Puromycin</td>
			<td>Gibco</td>
			<td>A1113802</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">typsin-EDTA</td>
			<td>Gibco</td>
			<td>25200056</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Automated Cell Counter System &#160;</td>
			<td>BioTech</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Image Analysis software&#160;</td>
			<td>Winmasis</td>
			<td style="width:343px;"></td>
			<td>http://mywim.wimasis.com&#160;</td>
		</tr>
	</tbody>
</table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

폰 Hippel Lindau (VHL) 종양 억제기 유전자의 비활성화 인간 중앙 신경 시스템 (CNS) 내에서 hemangioblastomas (HBs)의 개발에 중요 한 역할을 하고있다. 그러나, cytological 근원 그리고 HBs (neovascularization 포함)의 진화 과정 남아 논란, 그리고 안티-신생 VHL-HBs, 고전적인 HB 신생에 기반에 대 한 임상 시험에서 실망 스러운 결과 생산 했습니다. 반대로 혈관 치료의 성공적인 임상 번역 한 주요 장애물이 neovascularization 혈관이 종양에의 한 철저 한 이해의 부족 이다. 이 문서에서는, 우리가 여부를 평가 체 외에 고전적인 종양 신생 HBs, HBs의 역할에 있는 포괄적인 절차 제시. 이 절차와 연구원 수 정확 하 게 HB neovascularization의 복잡성을 이해 하 고이 일반적인 형태의 HBs에 신생의 함수를 식별. 이러한 프로토콜 있는 잠재력이 높은 변환 종양 치료 또는 HBs에 대 한 안티-신생 치료의 최적화에 돕고 미래에 번역에 대 한 종양을 위한 가장 유망한 항 혈관 치료를 평가 하기 위해 사용할 수 있습니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 양식 신생 HB neovascularization만 보완 메커니즘.

거꾸로 가벼운 현미경에 의해 원래 이미지를 가져옵니다. VHL 그룹과 컨트롤 그룹의 전형적인 이미지는 그림 2에 표시 됩니다-A1 및 그림 2-A2. 컨트롤 그룹의 돋 아 길이 VHL 그룹 보다 짧습니다.
이미지를 업로드 후 온라인 플랫폼 직접 분석 결과 제공 합니다. 출력 두 부분으로 구성: 처리 된 이미지와 해당 분석 결과. 처리 된 이미지는 컨트롤 그룹과 VHL 유전자 침묵 그룹의 서로 다른 색상으로 표시 됩니다 (그림 2-A3 및 그림 2-A4). 평균 새싹 길이 65 µ m 및 제어 그룹 및 VHL 침묵 그룹에서 125 µ m 각각, 고 평균 누적 새싹 길이 680 µ m 및 제어 그룹 및 VHL 침묵 그룹에 1250 µ m 각각, 그 새싹 길이 증가 나타내는 제어 그룹 (그림 2B)에 비해 VHL 침묵 그룹에서 약 2 폴드. 이 결과 VHL 결핍 인간 내 피 세포의 혈관 형성 능력 증진을 나타냅니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57183/57183fig1.jpg"> 그림 1 . 분석 결과 돋 아 회전 타원 체에 대 한 스키마. 단계 1는 HUVEC 세포 배양 접시를 보여 줍니다. 단계 2에서 HUVEC 셀 3 단계에서는 HUVEC 셀 폼 내 피 세포 spheroids 자동으로 3D 판 72 헤에 대 한 3D 라운드 하단 96 잘 접시로 이동 됩니다. 4 단계에서에서 셀 회전 타원 체 희석된 젤을 추가 합니다. 단계 5에서 15-잘 접시 위에 준비 하는 혼합물을 추가 합니다. 6 단계 회전 타원 체 15-잘 접시에 돋 아을 보여줍니다. 단계 7 거꾸로 가벼운 현미경 촬영 돋 아 이미지를 보여 줍니다. 업로드 된 이미지를 표시 하는 8 단계와 9 단계는 플랫폼에서 출력 이미지 (바 = 100 µ m). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57183/57183fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57183/57183fig2.jpg"> 그림 2 . VHL 유전자 분석 결과 돋 아 회전 타원 체에 HUVEC 세포의 신생 능력에 침묵의 효과. (A) (A1) 컨트롤과 VHL 침묵 HUVEC spheroids (A2)에 12 h 후 오 르네 파생물의 대표 이미지 (바 = 100 µ m). 그림 a 3와 A4 분석 플랫폼에서 그림 a 1과 A2, 각각 이미지를 보여줍니다. 빨간 나타내는 콩나물 해골, 싹 수 노란, 파란 새싹 구조, 백색 새싹 끝, 및 오렌지 회전 타원 체. (B) 는 콩나물의 길이. 통계 분석은 짝이 없는 학생의 t-검정을 사용 하 여 수행 되었다. * 대표 P < 0.05. 콘, 제어; HUVEC, 인간 탯 줄 정 맥 내 피 세포 <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57183/57183fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

분석 결과 돋 아 회전 타원 체를 사용 하 여 상 상속 Hemangioblastoma Neovascularization의 생체 외에서 성능을 평가 하는 포괄적인 절차

이 종이 여부를 평가 체 외에 고전적인 종양 신생 hemangioblastomas (HBs)와 HBs에서의 역할에 있는 포괄적인 절차를 제공 합니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 형태의 신생 HB neovascularization만 보완 메커니즘.

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Nanyang Technological University

Research

JoVE Journal

Cancer Research

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

7.9K 조회수.  Fudan University. 이 종이 여부를 평가 체 외에 고전적인 종양 신생 hemangioblastomas (HBs)와 HBs에서의 역할에 있는 포괄적인 절차를 제공 합니다. 결과 HB neovascularization의 복잡성을 강조 하 고는 것이 좋습니다이 일반적인 형태의 신생 HB neovascularization만 보완 메커니즘.

비디오: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Utilizing Functional Genomics Screening to Identify Potentially Novel Drug Targets in Cancer Cell Spheroid Cultures

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery of the next generation of novel drug targets. It is becoming apparent that more complex models of cancer are required to fully appreciate the contributing factors that drive tumorigenesis in vivo and increase the efficacy of novel therapies that make the transition from pre-clinical models to clinical trials.
Here we present a methodology for generating uniform and reproducible tumor spheroids that can be subjected to siRNA functional screening. These spheroids display many characteristics that are found in solid tumors that are not present in traditional two-dimension culture. We show that several commonly used breast cancer cell lines are amenable to this protocol. Furthermore, we provide proof-of-principle data utilizing the breast cancer cell line BT474, confirming their dependency on amplification of the epidermal growth factor receptor HER2 and mutation of phosphatidylinositol-4,5-biphosphate 3-kinase (PIK3CA) when grown as tumor spheroids. Finally, we are able to further investigate and confirm the spatial impact of these dependencies using immunohistochemistry.

Identifying novel drug targets that transition from pre-clinical testing to human trials is a scientific priority. To that end, here we describe a functional genomics approach for examining the impact of gene depletion on cancer cell line spheroids, which more appropriately model human cancers in vivo.

기능 유전체학에게 검사를 활용하여 암 세포 회전 타원체 문화에 잠재적으로 소설 약 표적을 식별하는

The identification of functional driver events in cancer is central to furthering our understanding of cancer biology and indispensable for the discovery ...

연구

암 연구학

A Comprehensive Procedure to Evaluate the In Vivo Performance of Cancer Nanomedicines

Inspired by the success of previous cancer nanomedicines in the clinic, researchers have generated a large number of novel formulations in the past decade. However, only a small number of nanomedicines have been approved for clinical use, whereas the majority of nanomedicines under clinical development have produced disappointing results. One major obstacle to the successful clinical translation of new cancer nanomedicines is the lack of an accurate understanding of their in vivo performance. This article features a rigorous procedure to characterize the in vivo behavior of nanomedicines in tumor-bearing mice at systemic, tissue, single-cell, and subcellular levels via the integration of positron emission tomography-computed tomography (PET-CT), radioactivity quantification methods, flow cytometry, and fluorescence microscopy. Using this approach, researchers can accurately evaluate novel nanoscale formulations in relevant mouse models of cancer. These protocols may have the ability to identify the most promising cancer nanomedicines with high translational potential or to aid in the optimization of cancer nanomedicines for future translation.

A Comprehensive Procedure to Evaluate the In Vivo Performance of Cancer Nanomedicines

The poor understanding of the in vivo performance of nanomedicines stymies their clinical translation. Procedures to evaluate the in vivo behavior of cancer nanomedicines at systemic, tissue, single-cell, and subcellular levels in tumor-bearing immunocompetent mice are described here. This approach may help researchers to identify promising cancer nanomedicines for clinical translation.

포괄적 인 절차를 평가하는<em&gt; 생체</em&gt; 암 나노 의학의 성능

Inspired by the success of previous cancer nanomedicines in the clinic, researchers have generated a large number of novel formulations in the past ...

Evaporation-reducing Culture Condition Increases the Reproducibility of Multicellular Spheroid Formation in Microtiter Plates

Tumor models that closely imitate in vivo conditions are becoming increasingly popular in drug discovery and development for the screening of potential anti-cancer drugs. Multicellular tumor spheroids (MCTSes) effectively mimic the physiological conditions of solid tumors, making them excellent in vitro models for lead optimization and target validation. Out of the various techniques available for MCTS culture, the liquid-overlay method on agarose is one of the most inexpensive methods for MCTS generation. However, the reliable transfer of MCTS cultures using liquid-overlay for high-throughput screening may be compromised by a number of limitations, including the coating of microtiter plates (MPs) with agarose and the irreproducibility of uniform MCTS formation across wells. MPs are significantly prone to edge effects that result from excessive evaporation of medium from the exterior of the plate, preventing the use of the entire plate for drug tests. This manuscript provides detailed technical improvements to the liquid-overlay technique to increase the scalability and reproducibility of uniform MCTS formation. Additionally, details on a simple, semi-automatic, and universally applicable software tool for the evaluation of MCTS features after drug treatment is presented.

The uneven loss of medium from microtiter plates affects the reproducibility of uniform multicellular tumor spheroid formation. Improving culture conditions to reduce significant medium loss will improve the reproducibility of spheroid formation and the results of spheroid-based assays using the liquid-overlay technique.

증발 감소 문화 조건은 미세 적정 플레이트에서 다세포 회전 타원체 형성의 재현성을 증가

Tumor models that closely imitate in vivo conditions are becoming increasingly popular in drug discovery and development for the screening of potential ...

Using the Dot Assay to Analyze Migration of Cell Sheets

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move within tissues in a tightly orchestrated manner. During tumor development, this equilibrium is disturbed, and tumor cells leave the epithelium of origin to invade the local microenvironment, to travel to distant sites, and to ultimately form metastatic tumors at distant sites. The dot assay is a simple, two-dimensional unconstrained migration assay, to assess the net movement of cell sheets into a cell-free area, and to analyze parameters of cell migration using time-lapse imaging. Here, the dot assay is demonstrated using a human invasive, lung colony forming breast cancer cell line, MCF10CA1a, to analyze the cells' migratory response to epidermal growth factor (EGF), which is known to increase malignant potential of breast cancer cells and to alter the migratory phenotype of cells.

Cell migration is essential for development, tissue maintenance and repair, and tumorigenesis, and is regulated by growth factors, chemokines, and cytokines. This protocol describes the dot assay, a two-dimensional, unconstrained migration assay to assess the migratory phenotype of attached, cohesive cell sheets in response to microenvironmental cues.

셀 시트의 마이그레이션 분석 하 점 분석 결과 사용 하 여

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move ...

Modeling Osteosarcoma Using Li-Fraumeni Syndrome Patient-derived Induced Pluripotent Stem Cells

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including osteosarcoma--one of the most frequent primary non-hematologic malignancies in the childhood and adolescence. Therefore, LFS provides an ideal model to study this malignancy. Taking advantage of iPSC methodologies, LFS-associated osteosarcoma can be successfully modeled by differentiating LFS patient iPSCs to mesenchymal stem cells (MSCs), and then to osteoblasts--the cells of origin for osteosarcomas. These LFS osteoblasts recapitulate oncogenic properties of osteosarcoma, providing an attractive model system for delineating the pathogenesis of osteosarcoma. This manuscript demonstrates a protocol for the generation of iPSCs from LFS patient fibroblasts, differentiation of iPSCs to MSCs, differentiation of MSCs to osteoblasts, and in vivo tumorigenesis using LFS osteoblasts. This iPSC disease model can be extended to identify potential biomarkers or therapeutic targets for LFS-associated osteosarcoma.

Here, we present a protocol for the generation of induced pluripotent Stem Cells (iPSCs) from Li-Fraumeni Syndrome (LFS) patient derived fibroblasts, differentiation of iPSCs via mesenchymal stem cells (MSCs) to osteoblasts, and modeling in vivo tumorigenesis using LFS patient-derived osteoblasts.

Li Fraumeni 증후군 환자에서 파생 된 유도 만능 줄기 세포를 사용 하 여 다리를 모델링

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

종양 대식 세포 상호 작용을 연구 하는 시험관 내 분석

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

In Vitro Establishment of a Genetically Engineered Murine Head and Neck Cancer Cell Line using an Adeno-Associated Virus-Cas9 System

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by introducing specific mutations in oncogenes and tumor suppressor genes, using clustered regulatory interspaced short palindromic repeat (CRISPR)-based genome editing technology in mice. This technology allows us to accurately mimic the genetic changes that occur in human cancers using mice. By genetically transforming murine primary cells, we can better study cancer development, progression, treatment, and diagnosis. In this study, we used Cre-inducible Cas9 mouse tongue epithelial cells to enable genome editing using adeno-associated virus (AAV) in vitro. Specifically, by altering KRAS, p53, and APC in normal tongue epithelial cells, we generated a murine head and neck cancer (HNC) cell line in vitro,which is tumorigenic in syngeneic mice. The method presented here describes in detail how to generate HNC cell lines with specific genomic alterations and explains their suitability for predicting tumor progression in syngeneic mice. We envision that this promising method will be informative and useful to study tumor biology and therapy of HNC.

Development of murine models with specific genes mutated in head and neck cancer patients is required for understanding of neoplasia. Here, we present a protocol for in vitro transformation of primary murine tongue cells using an adeno-associated virus-Cas9 system to generate murine HNC cell lines with specific genomic alterations.

아데노 관련 바이러스-Cas9 시스템을 사용하여 유전자 조작 된 뮤린 머리와 목 암 세포라인의 시험관 내 설립

The use of primary normal epithelial cells makes it possible to reproducibly induce genomic alterations required for cellular transformation by ...

Pathological Analysis of Lung Metastasis Following Lateral Tail-Vein Injection of Tumor Cells

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous metastasis models are available. Thus, the experimental metastasis model involving tail-vein injection of suitable cell lines is a mainstay of metastasis research. When cancer cells are injected into the lateral tail-vein, the lung is their preferred site of colonization. A potential limitation of this technique is the accurate quantification of the metastatic lung tumor burden. While some investigators count macrometastases of a pre-defined size and/or include micrometastases following sectioning of tissue, others determine the area of metastatic lesions relative to normal tissue area. Both of these quantification methods can be exceedingly difficult when the metastatic burden is high. Herein, we demonstrate an intravenous injection model of lung metastasis followed by an advanced method for quantifying metastatic tumor burden using image analysis software. This process allows for investigation of multiple end-point parameters, including average metastasis size, total number of metastases, and total metastasis area, to provide a comprehensive analysis. Furthermore, this method has been reviewed by a veterinary pathologist board-certified by the American College of Veterinary Pathologists (SEK) to ensure accuracy.

Intravenous injection of cancer cells is often used in metastasis research, but the metastatic tumor burden can be difficult to analyze. Herein, we demonstrate a tail-vein injection model of metastasis and include a novel approach to analyze the resulting metastatic lung tumor burden.

종양 세포의 측면 꼬리 정맥 주입 다음 폐 전이의 병리학 적 분석

Metastasis, the primary cause of morbidity and mortality for most cancer patients, can be challenging to model preclinically in mice. Few spontaneous ...

Modeling Brain Metastases Through Intracranial Injection and Magnetic Resonance Imaging

Metastatic spread of cancer is an unfortunate consequence of disease progression, aggressive cancer subtypes, and/or late diagnosis. Brain metastases are particularly devastating, difficult to treat, and confer a poor prognosis. While the precise incidence of brain metastases in the United States remains hard to estimate, it is likely to increase as extracranial therapies continue to become more efficacious in treating cancer. Thus, it is necessary to identify and develop novel therapeutic approaches to treat metastasis at this site. To this end, intracranial injection of cancer cells has become a well-established method in which to model brain metastasis. Previously, the inability to directly measure tumor growth has been a technical hindrance to this model; however, increasing availability and quality of small animal imaging modalities, such as magnetic resonance imaging (MRI), are vastly improving the ability to monitor tumor growth over time and infer changes within the brain during the experimental period. Herein, intracranial injection of murine mammary tumor cells into immunocompetent mice followed by MRI is demonstrated. The presented injection approach utilizes isoflurane anesthesia and a stereotactic setup with a digitally controlled, automated drill and needle injection to enhance precision, and reduce technical error. MRI is measured over time using a 9.4 Tesla instrument in The Ohio State University James Comprehensive Cancer Center Small Animal Imaging Shared Resource. Tumor volume measurements are demonstrated at each time point through use of ImageJ. Overall, this intracranial injection approach allows for precise injection, day-to-day monitoring, and accurate tumor volume measurements, which combined greatly enhance the utility of this model system to test novel hypotheses on the drivers of brain metastases.

Intracranial brain metastasis modeling is complicated by an inability to monitor tumor size and response to treatment with precise and timely methods. The presented methodology couples intracranial tumor injection with magnetic resonance imaging analysis, which when combined, cultivates precise and consistent injections, enhanced animal monitoring, and accurate tumor volume measurements.

두개 내 주입 및 자기 공명 이미징을 통해 뇌 전이를 모델링

Metastatic spread of cancer is an unfortunate consequence of disease progression, aggressive cancer subtypes, and/or late diagnosis. Brain metastases are ...

A Three-Dimensional Spheroid Model to Investigate the Tumor-Stromal Interaction in Hepatocellular Carcinoma

The aggressiveness and lack of well-tolerated and widely effective treatments for advanced hepatocellular carcinoma (HCC), the predominant form of liver cancer, rationalize its rank as the second most common cause of cancer-related death. Preclinical models need to be adapted to recapitulate the human conditions to select the best therapeutic candidates for clinical development and aid the delivery of personalized medicine. Three-dimensional (3D) cellular spheroid models show promise as an emerging in vitro alternative to two-dimensional (2D) monolayer cultures. Here, we describe a 3D tumor spheroid&#160;model which exploits the ability of individual cells to aggregate when maintained in hanging droplets, and is more representative of an in vivo environment than standard monolayers. Furthermore, 3D spheroids can be produced by combining homotypic or heterotypic cells, more reflective of the cellular heterogeneity in vivo, potentially enabling the study of environmental interactions that can influence progression and treatment responses. The current research optimized the cell density to form 3D homotypic and heterotypic tumor spheroids by immobilizing cell suspensions on the lids of standard 10 cm3 Petri dishes. Longitudinal analysis was performed to generate growth curves for homotypic versus heterotypic tumor/fibroblasts spheroids. Finally, the proliferative impact of fibroblasts (COS7 cells) and liver myofibroblasts (LX2) on homotypic tumor (Hep3B) spheroids was investigated. A seeding density of 3,000 cells (in 20 &#181;L media) successfully yielded Huh7/COS7 heterotypic spheroids, which displayed a steady increase in size up to culture day 8, followed by growth retardation. This finding was corroborated using Hep3B homotypic spheroids cultured in LX2 (human hepatic stellate cell line) conditioned medium (CM). LX2 CM triggered the proliferation of Hep3B spheroids compared to control tumor spheroids. In conclusion, this protocol has shown that 3D tumor spheroids can be used as a simple, economical, and prescreen in vitro tool to study tumor-stromal interactions more comprehensively.

Comprehensive in vitro models that faithfully recapitulate the relevant human disease are lacking. The current study presents three-dimensional (3D) tumor spheroid creation and culture, a reliable in vitro tool to study the tumor-stromal interaction in human hepatocellular carcinoma.

간세포 암에서 종양-기질 상호 작용을 조사하는 3차원 스페로이드 모델

The aggressiveness and lack of well-tolerated and widely effective treatments for advanced hepatocellular carcinoma (HCC), the predominant form of liver ...