This work was supported by grants from the Shanghai Committee of Science and Technology (15411951800, 15410723200). The authors wish to thank Prof. YuMei Wen and Prof. Chao Zhao of the Pathogenic Microorganism Department of Fudan University for their technical assistance.

This method was performed in accordance with the approved guidelines and regulations of the Research Ethics Committee of Huashan Hospital, Fudan University. Corresponding standard safety measures were followed in each step. For a schematic presentation, please refer to Figure 1.
1. Cell Culture and Plasmid Construct
<ol>
	<li>Routinely maintain the human umbilical vein endothelial cell (HUVEC) in Dulbecco&#39;s modified Eagle&#39;s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 unit/mL of penicillin, and 100 &#181;g/mL of streptomycin in a humidified 5% CO2 incubator at 37 &#176;C.</li>
	<li>Digest PLKO.1 plasmid with ApaI and EcoRI for the synthesis of shRNA fragment. Ensure that the oligonucleotide sequence of VHL shRNA vector is CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.</li>
	<li>Then, mix 20 &#181;&#924; system with forward 5 &#181;L of oligo, 5 &#181;L of reverse oligo, 5 &#181;L of 10x NEB buffer and 35 &#181;L of ddH2O together (The total volume is 50 &#181;L). Heat the mixture at 98 &#176;C for 4 min, and slowly cool down to room temperature in a few hours.</li>
	<li>Ligate the annealed oligos and PLKO.1 plasmid together with T4 ligase at 4 &#176;C for overnight. 16 h later, add 5 &#181;L of ligation mix into 25 &#181;L competent DH5&#945; cells. Then, screen the successfully ligated plasmids, and verify the inserted fragment by sequencing.</li>
</ol>
2. Lentivirus Package and Infection
<ol>
	<li>In total, mix 10 &#181;g of the PLKO.1-shVHL or PLKO.1-shScramble vector, 7.5 &#181;g of packing plasmid psPAX2, and 2.5 &#181;g of envelope plasmid pMD2.G in 500 &#181;L of the DMEM media without fetal bovine serum (FBS) for 25 min.</li>
	<li>Add 7 mLDMEM without FBS to the solution prepared above.</li>
	<li>Culture 293FT cells in the DMEM without FBS in a 10-cm diameter tissue culture dishes. Ensure that the number of 293FT cells is 1 x 107 using a cell counter.</li>
	<li>Add 1 mL of the solution prepared above to the medium of 293FT cells for transfection. 
	Note: The 293FT cell line is derived from the 293F cell line and stably express the SV40 large T antigen. Therefore, it is a suitable host for lentiviral production.</li>
	<li>Replace the culture medium with the DMEM containing 10% FBS after 6 h.</li>
	<li>Collect the media using a pipette at 48 h after transfection. 
	Note: The virus exists in the DMEM containing 10% FBS. The dead cells float on the medium. Use 0.45 &#181;m sterile membrane to filter the dead cells and impurities. Generally, there is no need to check multiplicity of infection (MOI). This is to establish a stable cells line. At the last step, all living cells without successful infection will die by puromycin. The shScramble group and HUVEC cells are the control group. Ensure that all the HUVEC cells die with the used puromycin concentration by 72 h. Every well has the same number of cells.</li>
	<li>Culture the HUVEC cells in the lentiviral media for 72 h. Then, add puromycin to the media of the HUVEC cells at a concentration of 2 &#181;g/mL for 24 h. Use HUVEC cells without any treatment as the control group. Ensure that all control cells die by this time. 
	Note: The living cells represent a stable cell line of VHL knockdown cells and shSramble cells. The plating density is 5,000/well in 96-well plates.</li>
</ol>
3. Generation of Endothelial Cell Spheroids
<ol>
	<li>Trypsinize the HUVECs cells and resuspend in the DMEM medium with 10% FBS. With a moderate number of cells in a 10-cm culture dish, add 1 mL of typsin-EDTA.</li>
	<li>Seed the cells in a 3D round-bottom 96-well plate, at a cell density of 1 &#215; 103 cells/well. Use a well that can accommodate a spheroid of 0.50 &#181;L to suspend the spheroid. Count cells using a&#160;cell counter system following the manufacturer&#39;s instructions.</li>
	<li>Incubate the cells at 37 &#176;C and 5% CO2 continuously for 72 h. Under these conditions, ensure that the suspended cells form the cell spheroids automatically. Replace half of the culture medium after 36 h.</li>
</ol>
4. In vitro Angiogenesis Assay
<ol>
	<li>Thaw the gel solution at 4 &#176;C and dilute it with the reduced serum medium at a dilution ratio of 1:5.</li>
	<li>Suck the spheroids from the DMEM culture medium with a micropipette. After washing the spheroids with 5 mL of the reduced serum medium, suspend the spheroids gently and cautiously in the diluted gel. Ensure that there are no air bubbles.</li>
	<li>Embed 300 &#181;L of mixed liquid in a 15-well plate. After incubation at 37 &#176;C and 5% CO2 for 1 h, add 400 &#181;L the reduced serum medium to each well. Fill sterile water around the wells to generate a humidified environment to hinder evaporation.</li>
	<li>Thereafter, culture the plate at 37 &#176;C in 5% CO2 at 100% humidity for 1 h.</li>
	<li>Carefully aspirate the old medium and replace it by 600 &#181;L of reduced serum medium with 1% endothelial cell growth supplements in each well.</li>
	<li>After 12 h or 24 h, take images under an inverted light microscope (40*).</li>
</ol>
5. Data Analysis
<ol>
	<li>Upload the images to an online image analysis platform to obtain sprout length data (Table of Materials).</li>
	<li>On the webpage, create an account by email.</li>
	<li>Then upload the images by clicking the upload button.</li>
	<li>Download the result by clicking the download button. 
	Note: The software will generate the processed image and the data. The data contain five parts: cumulative sprout length, mean sprout length, the standard deviation of sprout length, sprout area and spheroid area. In the processed image, each parameter is outlined in a different color to ease identification in the processed image: Red represents sprouts skeleton, yellow the number of sprouts, blue the sprout structure, white sprout end, and orange spheroid.</li>
</ol>

<ol>
	<li>Lonser, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=von+Hippel-Lindau+disease.">von Hippel-Lindau disease.</a> Lancet. 361 (9374), 2059-2067 (2003).</li><li>Hussein, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+nervous+system+capillary+haemangioblastoma:+the+pathologist's+viewpoint.">Central nervous system capillary haemangioblastoma: the pathologist's viewpoint.</a> Int J Exp Pathol. 88 (5), 311-324 (2007).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas+might+derive+from+neoplastic+transformation+of+neural+stem+cells/progenitors+in+the+specific+niche.">Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche.</a> Carcinogenesis. 32 (1), 102-109 (2011).</li><li>Zhuang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+derived+vasculogenesis+in+von+Hippel-Lindau+disease-associated+tumors.">Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors.</a> Sci Rep. 4, 4102 (2014).</li><li>Glasker, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=VHL-deficient+vasculogenesis+in+hemangioblastoma.">VHL-deficient vasculogenesis in hemangioblastoma.</a> Exp Mol Pathol. 96 (2), 162-167 (2014).</li><li>Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Up-regulation+of+vascular+endothelial+growth+factor+and+its+receptors+in+von+Hippel-Lindau+disease-associated+and+sporadic+hemangioblastomas.">Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas.</a> Cancer Res. 55 (6), 1358-1364 (1995).</li><li>Cancilla, P. A., Zimmerman, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fine+structure+of+a+cerebellar+hemangioblastoma.">The fine structure of a cerebellar hemangioblastoma.</a> J Neuropathol Exp Neurol. 24 (4), 621-628 (1965).</li><li>Kawamura, J., Garcia, J. H., Kamijyo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cerebellar+hemangioblastoma:+histogenesis+of+stroma+cells.">Cerebellar hemangioblastoma: histogenesis of stroma cells.</a> Cancer. 31 (6), 1528-1540 (1973).</li><li>Jurco, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hemangioblastomas:+histogenesis+of+the+stromal+cell+studied+by+immunocytochemistry.">Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry.</a> Hum Pathol. 13 (1), 13-18 (1982).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+tumorigenic+cells+and+implication+of+their+aberrant+differentiation+in+human+hemangioblastomas.">Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas.</a> Cancer Biol Ther. 12 (8), 727-736 (2011).</li><li>Ma, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD41+and+CD45+expression+marks+the+angioformative+initiation+of+neovascularisation+in+human+haemangioblastoma.">CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma.</a> Tumour Biol. 37 (3), 3765-3774 (2016).</li><li>Sharifpanah, F., Sauer, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stem+Cell+Spheroid-Based+Sprout+Assay+in+Three-Dimensional+Fibrin+Scaffold:+A+Novel+In+Vitro+Model+for+the+Study+of+Angiogenesis.">Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis.</a> Methods Mol Biol. 1430, 179-189 (2016).</li><li>Cai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNA+taurine+upregulated+1+enhances+tumor-induced+angiogenesis+through+inhibiting+microRNA-299+in+human+glioblastoma.">Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.</a> Oncogene. 36 (3), 318-331 (2017).</li><li>Xu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Conveniently+Screening+pLKO.1-TRC+Vector+Tagged+with+TurboGFP.">Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP.</a> Appl Biochem Biotechnol. 181 (2), 699-709 (2017).</li><li>Laib, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spheroid-based+human+endothelial+cell+microvessel+formation+in+vivo.">Spheroid-based human endothelial cell microvessel formation in vivo.</a> Nat Protoc. 4 (8), 1202-1215 (2009).</li><li>D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Angiogenesis+and+Vasculogenesis+in+Health+and+Disease.">Angiogenesis and Vasculogenesis in Health and Disease.</a> Biomed Res Int. 2015, 126582 (2015).</li><li>Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impaired+in+vivo+vasculogenic+potential+of+endothelial+progenitor+cells+in+comparison+to+human+umbilical+vein+endothelial+cells+in+a+spheroid-based+implantation+model.">Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model.</a> Cell Prolif. 42 (4), 498-505 (2009).</li><li>Morin, K. T., Tranquillo, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+models+of+angiogenesis+and+vasculogenesis+in+fibrin+gel.">In vitro models of angiogenesis and vasculogenesis in fibrin gel.</a> Exp Cell Res. 319 (16), 2409-2417 (2013).</li><li>Blacher, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+invasion+in+the+spheroid+sprouting+assay:+a+spatial+organisation+analysis+adaptable+to+cell+behaviour.">Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour.</a> PLoS One. 9 (5), 97019 (2014).</li><li>Straume, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+heat+shock+protein+27+induces+long-term+dormancy+in+human+breast+cancer.">Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer.</a> Proc Natl Acad Sci U S A. 109 (22), 8699-8704 (2012).</li><li>Naumov, G. N., Akslen, L. A., Folkman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+angiogenesis+in+human+tumor+dormancy:+animal+models+of+the+angiogenic+switch.">Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch.</a> Cell Cycle. 5 (16), 1779-1787 (2006).</li><li>Naumov, G. N., Folkman, J., Straume, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+dormancy+due+to+failure+of+angiogenesis:+role+of+the+microenvironment.">Tumor dormancy due to failure of angiogenesis: role of the microenvironment.</a> Clin Exp Metastasis. 26 (1), 51-60 (2009).</li><li>Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroprotective+effects+respond+to+cerebral+ischemia+without+susceptibility+to+HB-tumorigenesis+in+VHL+heterozygous+knockout+mice.">Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice.</a> Mol Carcinog. 56 (10), 2342-2351 (2017).</li><li>Stratmann, R., Krieg, M., Haas, R., Plate, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+control+of+angiogenesis+in+hemangioblastomas+by+the+von+Hippel-Lindau+tumor+suppressor+gene.">Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene.</a> J Neuropathol Exp Neurol. 56 (11), 1242-1252 (1997).</li><li>Correa de Sampaio, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+heterogeneous+in+vitro+three+dimensional+model+of+tumour-stroma+interactions+regulating+sprouting+angiogenesis.">A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis.</a> PLoS One. 7 (2), 30753 (2012).</li></ol>

The authors have nothing to disclose.

Recently, multiple fields of vascular biology research were stimulated by the study of the angiogenic endothelium15. In this article, we developed an endothelial spheroid sprouting technique as an experimental model to study the vessel formation that originates from the VHL gene&#39;s loss of function in manipulated endothelial cells to identify novel candidate molecules of the angiogenic cascade. To the best of our knowledge, this is the first report to examine the angiogenic effects of the endogenic modified endothelial cells.
Tissue (including tumor tissue) neovascularization is a complex process that occurs via angiogenic and vasculogenic mechanisms during development, as well as in both physiological and pathological conditions12,15,16. The spheroid sprouting assay is characterized by a complex cascade of events17,18, including the self-aggregation of endothelial cells that are embedded in a 3D cell matrix culture system, which results in sprouting and the reproduction of the 3D network of capillaries19. This 3D gel-embedded spheroid model has become a widely used system in tissue engineering for studying the vascular formation and its mechanisms due to its ability to provide a better mimicking environment in a suitable matrix. However, the most crucial step of this biological process is the activation of quiescent endothelial cells17,20,21,22. In this procedure, the endothelial cells were activated by the endogenic silencing of the VHL gene, a regulator growth gene of neovessels23,24. Different from the classic endothelium initiation via the exogenous induction of the matrix and the corresponding extracellular environment (including exogenous vascular growth factors), this modified method can be extended to numerous applications to unravel endogenic genetic mechanisms. Next, to diminish the effects of the exogenous matrix, the protocol was optimized by diluting the gel, which was a simple step in the experiment. In addition, it took only minutes to upload images to the platform and to obtain analysis results. The platform provides an image analysis service that allows the experimenter to make an objective, comparable, and automated image analysis of sprouting assay images online. Therefore, the protocol overcomes measurement and calculation errors caused by man-made factors.
The mechanistic understanding of the individual steps of the neovascularization cascade provided a rational basis for the development of the anti-vascular treatment that is currently being approved for clinical application in oncology. This paper established a simple and robust spheroid-based assay model to study vessel formation that originates from manipulated endothelial cells with loss of function of the VHL gene to identify novel candidate molecules for the neovascularization cascade, which can be utilized for numerous angiogenesis- and vasculogenesis-related applications. The authors speculate that this in vitro model might provide additional information to help evaluate the role of angiogenesis in some solid tumors (e.g., tumor vasculogenic mimicry) and investigate the potential roles of other possible progenitor cells to generate tumor neovessels in vivo, particularly in patients with tumors that, as a group, are unresponsive to treatment with anti-angiogenic agents only.
The spheroid sprouting assay has become a widely used method to study angiogenesis and related mechanisms. The assay has an important advantage by providing a better mimic environment than the classical 2D cultures. Recently, 3D co-culture models have been developed to study tumor angiogenesis that mimics the heterogeneity and complexity of angiogenesis within the tumor microenvironment25. In this model, endothelial cells are cultured directly with cancer cells, as well as a stromal component in a 3D environment. In addition, 3D in vitro culture systems have been shown to reflect more accurately the in vivo response to therapeutic agents than conventional cell culture systems. In addition, this method is used for the differentiation of embryonic stem cells, tissue growth, wound healing, ischemia, and inflammation. Compared with the classic method, our approach is effective and easy to implement. We believe it is a useful tool for the study of angiogenesis in vitro, and it opens a new way to understand this process better.

Hemangioblastomas (HBs) are benign vascular tumors that are found exclusively within the human central nervous system (CNS). They develop in patients with either von Hippel-Lindau (VHL) disease or sporadic lesions. VHL-HBs are difficult to cure through surgical treatment due to the frequent recurrence and multiple lesions that result from this genetic disorder1. Although the inactivation of the VHL tumor suppressor gene has been considered the root cause of the tumorigenesis of VHL-HBs, the cytological origin (including neovascularization) and evolutionary process of HBs remain largely controversial2. Therefore, a better understanding of HB-neovascular biological mechanisms may provide useful insights into the most promising anti-vascular strategies for VHL-HBs.
Recent research has suggested that HB-neovascularization is similar to the embryologic vasculogenesis3,4,5. Classic vascular endothelial growth factor (VEGF)-mediated angiogenesis that originated from the vascular endothelium and that is driven by VHL loss of function resulted in proliferation and neovascular formation, which has been challenged6. In 1965, Cancilla and Zimmerman found, using electron microscopy, that HBs originated from the endothelium7. Later it was found that stromal cells are derived from vasoformative element8. In 1982, Jurco et al. found that stromal cells are of endothelial origin9. Therefore, we hypothesized that human vascular endothelial cells are the original cells of HB-neovascularization10. Although it is better to use the primary cultures from HB cells derived from VHL patient surgeries, our previous research indicated that primary cultures from HB are not stable, and cell lines could not be established3. Moreover, the primary cultures in the 3D environment could not identify the cytological origin of HB-neovascularization because they include the progenitors of HB-vascular ingredients10,11. Therefore, as a primitive and classic model of endothelial cells, human vascular endothelial cells (HUVEC) could serve as an alternative cellular model for HBs.
The spheroid sprouting assay is a new model in tissue engineering12,13. In this paper, a 3D collagen-based coculture system in vitro using the spheroid sprouting assay was developed, with an overall goal to evaluate whether classic tumor angiogenesis exists in HBs, as well as its role in HBs.

<table><tbody><tr><td>human umbilical vein endothelial cell</td><td>Fudan IBS Cell Center</td><td>FDCC-HXN180</td><td></td></tr><tr><td>dulbecco&amp;rsquo;s modified eagle&amp;rsquo;s medium&amp;nbsp;</td><td>Gibco</td><td>11995040</td><td></td></tr><tr><td>fetal bovine serum</td><td>Gibco</td><td>&amp;nbsp;26400044</td><td></td></tr><tr><td>PLKO.1-puro vector</td><td>Addgene</td><td>#8453</td><td></td></tr><tr><td>packing plasmid psPAX2&amp;nbsp;</td><td>Addgene</td><td>#12260</td><td></td></tr><tr><td>envelope plasmid pMD2.G</td><td>Addgene</td><td>#12259</td><td></td></tr><tr><td>3D round-bottom 96-well plates</td><td>S-Bio</td><td>MS-9096M</td><td></td></tr><tr><td>matrigel</td><td>BD Biosciences</td><td>354234</td><td></td></tr><tr><td>Opti-MEM medium</td><td>Gibco</td><td>31985-070</td><td>reduced serum medium&amp;nbsp;</td></tr><tr><td>15-well plate</td><td>Ibidi</td><td>81501</td><td>Air bubbles in the gel can be reduced by equilibrating the &amp;mu;&amp;ndash;Slide angiogenesis before usage inside the incubator overnight</td></tr><tr><td>endothelial cell growth supplements</td><td>Sciencell</td><td>#1052</td><td></td></tr><tr><td>10-cm culture dish</td><td>Corning</td><td>Scipu000813</td><td></td></tr><tr><td>Puromycin</td><td>Gibco</td><td>A1113802</td><td></td></tr><tr><td>typsin-EDTA</td><td>Gibco</td><td>25200056</td><td></td></tr><tr><td>Automated Cell Counter System &amp;nbsp;</td><td>BioTech</td><td></td><td></td></tr><tr><td>Image Analysis software&amp;nbsp;</td><td>Winmasis</td><td></td><td>http://mywim.wimasis.com&amp;nbsp;</td></tr></tbody></table>

a comprehensive procedure to evaluate the in vitro performance of the putative hemangioblastoma neovascularization using the spheroid sprouting assay

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human central nervous system (CNS). However, both the cytological origin and the evolutionary process of HBs (including neovascularization) remain controversial, and anti-angiogenesis for VHL-HBs, based on classic HB angiogenesis, have produced disappointing results in clinical trials. One major obstacle to the successful clinical translation of anti-vascular treatment is the lack of a thorough understanding of neovascularization in this vascular tumor. In this article, we present a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in HBs, as well as its role in HBs. With this procedure, researchers can accurately understand the complexity of HB neovascularization and identify the function of this common form of angiogenesis in HBs. These protocols can be used to evaluate the most promising anti-vascular therapy for tumors, which has high translational potential either for tumors treatment or for aiding in the optimization of the anti-angiogenic treatment for HBs in future translations. The results highlight the complexity of HB neovascularization and suggest that this common form angiogenesis is only a complementary mechanism in HB neovascularization.

Original images are taken by inverted light microscope. The typical images of the control group and the VHL group are shown in Figure 2-A1 and Figure 2-A2. The sprouting length of the control group is shorter than that of the VHL group.
After uploading the Images, the online platform provides analysis results directly. The output consists of two parts: the processed image and the corresponding analysis results. The processed images of the control group and the VHL gene silence group are marked with different colors (Figure 2-A3 and Figure 2-A4). The mean sprout length is 65 &#181;m and 125 &#181;m in the control group and the VHL silence group, respectively, and the average cumulative sprout length is 680 &#181;m and 1250 &#181;m in the control group and the VHL silence group, respectively, indicating that sprout length increases by approximately two folds in the VHL silence group, compared with the control group (Figure 2B). These results indicate that VHL deficiency promotes the vessel-forming ability of human endothelial cells.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57183/57183fig1.jpg" /> 
Figure 1. The schema for the spheroid sprouting assay. Steps 1 shows HUVEC cells cultured a dish. In Steps 2, HUVEC cells are moved to 3D round-bottom 96-well plates for 72 h. Steps 3 shows the HUVEC cells form endothelial cell spheroids automatically in the 3D plate. In Steps 4, add cell spheroid to diluted gel. In Steps 5, add the mixture prepared above to a 15-well plate. Steps 6 shows spheroid sprouting in the 15-well plate. Steps 7 show the sprouting image taken under an inverted light microscope. Steps 8 shows the uploaded image and step 9 is the output image from the platform (bar = 100 &#181;m). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57183/57183fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57183/57183fig2.jpg" /> 
Figure 2. The effect of VHL gene silencing on the angiogenic ability of HUVEC cells in the spheroid sprouting assay.&#160;(A) Representative images of spout outgrowth after 12 h in control (A1) and VHL-silenced HUVEC spheroids (A2) (bar = 100 &#181;m). Figures A3 and A4 show the images analyzed by the platform for Figures A1 and A2, respectively. Red represents sprouts skeleton, yellow the number of sprouts, blue the sprout structure, white sprout end, and orange spheroid. (B) Length of the sprouts. Statistical analysis was performed using unpaired Student&#39;s t-test. * represent P &#60; 0.05. CON, control; HUVEC, human umbilical vein endothelial cell. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57183/57183fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay at JoVE.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

This paper presents a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in hemangioblastomas (HBs) and its role in HBs. The results highlight the complexity of HB-neovascularization and suggest that this common form of angiogenesis is only a complementary mechanism in the HB-neovascularization.

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

The inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene plays a crucial role in the development of hemangioblastomas (HBs) within the human ...

a-comprehensive-procedure-to-evaluate-vitro-performance-putative

Nanyang Technological University

Research

JoVE Journal

Cancer Research

7.9K Views.  Fudan University. This paper presents a comprehensive procedure to evaluate in vitro whether classic tumor angiogenesis exists in hemangioblastomas (HBs) and its role in HBs. The results highlight the complexity of HB-neovascularization and suggest that this common form of angiogenesis is only a complementary mechanism in the HB-neovascularization.

Video: A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

A 3D Spheroid Model as a More Physiological System for Cancer-Associated Fibroblasts Differentiation and Invasion In Vitro Studies

Defining the ideal model for an in vitro study is essential, mainly if studying physiological processes such as differentiation of cells. In the tumor stroma, host fibroblasts are stimulated by cancer cells to differentiate. Thus, they acquire a phenotype that contributes to the tumor microenvironment and supports tumor progression. By using the spheroid model, we have set up such a 3D in vitro model system, in which we analyzed the role of laminin-332 and its receptor integrin &#945;3&#946;1 in this differentiation process. This spheroid model system not only reproduces the tumor microenvironment conditions in a more accurate way, but also is a very versatile model since it allows different downstream studies, such as immunofluorescent staining of both intra- and extracellular markers, as well as deposited extracellular matrix proteins. Moreover, transcriptional analyses by qPCR, flow cytometry and cellular invasion can be studied with this model. Here, we describe a protocol of a spheroid model to assess the role of CAFs&#39; integrin &#945;3&#946;1 and its ectopically deposited ligand, laminin-332, in differentiation and in supporting the invasion of pancreatic cancer cells.

The goal of this protocol is to establish a 3D in vitro model to study the differentiation of cancer-associated fibroblasts (CAFs) in a tumor bulk-like environment, which can be addressed in different analysis systems, such as immunofluorescence, transcriptional analysis and life cell imaging.

Defining the ideal model for an in vitro study is essential, mainly if studying physiological processes such as differentiation of cells. In the tumor ...

A 3D Spheroid Model for Glioblastoma

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were developed. These models may be particularly important in the field of neuro-oncology. Indeed, brain tumors have the tendency to invade the healthy brain environment. We describe herein an ideal 3D glioblastoma spheroid-based assay that we developed to study tumor invasion. We provide all technical details and analytical tools to successfully perform this assay.

Here, we describe an easy-to-use invasion assay for glioblastoma. This assay is suitable for glioblastoma stem-like cells. A Fiji macro for easy quantification of invasion, migration, and proliferation is also described.

Two-dimensional (2D) cell cultures do not mimic in vivo tumor growth satisfactorily. Therefore, three-dimensional (3D) culture spheroid models were ...

Incorporating Pericytes into an Endothelial Cell Bead Sprouting Assay

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including embryogenesis and development, wound healing, tumor growth and metastasis, and ocular and cardiovascular diseases. Effective in vitro models that recapitulate the biology of angiogenesis are needed to appropriately study this process and identify mechanisms of regulation that can be ultimately targeted for novel therapeutic strategies. The bead angiogenesis assay has been previously demonstrated to recapitulate the multiple stages of endothelial sprouting in vitro. However, a limitation of this assay is a lack of endothelial &#8211; mural cell interactions, which are key to the molecular and phenotypic regulation of endothelial cell function in vivo. The protocol given here presents a methodology for the incorporation of mural cells into the bead angiogenesis assay and demonstrates a tight association of endothelial cells and pericytes during sprouting in vitro. The protocol also details a methodology for effective silencing of target genes using siRNA in endothelial cells for mechanistic studies. Altogether, this protocol provides an in vitro assay that more appropriately models the diverse cell types involved in sprouting angiogenesis, and provides a more physiologically-relevant platform for therapeutic assessment and novel discovery of mechanisms of angiogenesis regulation.

This protocol presents a novel in vitro bead assay that more appropriately models the process of in vivo sprouting angiogenesis by incorporating pericytes. This modification enables the bead assay to more faithfully recapitulate the heterotypic cellular interactions between endothelial cells and mural cells that are critical for angiogenesis.

Angiogenesis is the growth of new vessels from pre-existing vasculature and is an important component of many biological processes, including ...

Developmental Biology

Three-dimensional Angiogenesis Assay System using Co-culture Spheroids Formed by Endothelial Colony Forming Cells and Mesenchymal Stem Cells

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more than 50 different pathological conditions, such as rheumatoid arthritis, oculopathy, cardiovascular diseases, and tumor metastasis. During angiogenesis drug development, it is crucial to use in vitro assay systems with appropriate cell types and proper conditions to reflect the physiologic angiogenesis process. To overcome limitations of current in vitro angiogenesis assay systems using mainly endothelial cells, we developed a 3-dimensional (3D) co-culture spheroid sprouting assay system. Co-culture spheroids were produced by two human vascular cell precursors, endothelial colony forming cells (ECFCs) and mesenchymal stem cells (MSCs) with a ratio of 5 to 1. ECFCs+MSCs spheroids were embedded into type I collagen matrix to mimic the in vivo extracellular environment. A real-time cell recorder was utilized to continuously observe the progression of angiogenic sprouting from spheroids for 24 h. Live cell fluorescent labeling technique was also applied to tract the localization of each cell type during sprout formation. Angiogenic potential was quantified by counting the number of sprouts and measuring the cumulative length of sprouts generated from the individual spheroids. Five randomly-selected spheroids were analyzed per experimental group. Comparison experiments demonstrated that ECFCs+MSCs spheroids showed greater sprout number and cumulative sprout length compared with ECFCs-only spheroids. Bevacizumab, an FDA-approved angiogenesis inhibitor, was tested with the newly-developed co-culture spheroid assay system to verify its potential to screen anti-angiogenic drugs. The IC50 value for ECFCs+MSCs spheroids compared to the ECFCs-only spheroids was closer to the effective plasma concentration of bevacizumab obtained from the xenograft tumor mouse model. The present study suggests that the 3D ECFCs+MSCs spheroid angiogenesis assay system is relevant to physiologic angiogenesis, and can predict an effective plasma concentration in advance of animal experiments.

Three-dimensional co-culture spheroid angiogenesis assay system is designed to mimic the physiologic angiogenesis. Co-culture spheroids are formed by two human vascular cell precursors, ECFCs and MSCs, and embedded in collagen gel. The new system is effective for evaluating angiogenic modulators, and provides more relevant information to the in vivo study.

Studies in the field of angiogenesis have been aggressively growing in the last few decades with the recognition that angiogenesis is a hallmark of more ...

Spheroid Drug Sensitivity Screening in Glioma Stem Cell Lines

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens are performed on cells grown in a monolayer. However, these two-dimensional (2D) models are considered less accurate compared to three-dimensional (3D) spheroid cell models; this is especially true for glioma stem cell lines. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening of spheroid lines; mouse and human glioma stem cell lines are used as an example. This protocol describes a 3D spheroid drug sensitivity and synergy assay that can be used to determine if a drug or drug combination induces cell death and if two drugs synergize. Glioma stem cell lines are&#160;modified to express RFP. Cells are plated in low attachment round well bottom 96 plates, and spheres are allowed to form overnight. Drugs are added, and the growth is monitored by measuring the RFP signal over time using the Incucyte live imaging system,&#160;a fluorescence microscope embedded in the tissue culture incubator. Half maximal inhibitory concentration (IC50), median lethal dose (LD50), and synergy score are subsequently calculated to evaluate sensitivities to drugs alone or in combination. The three-dimensional nature of this assay&#160;provides a more accurate reflection of tumor growth, behavior, and drug sensitivities in vivo, thus forming the basis for further preclinical investigation.

In vitro drug sensitivity screens are important tools for discovering anti-cancer drug combinations. Cells grown in spheres activate different signaling pathways and are considered more representative of in vivo models than monolayer cell lines. This protocol describes a method for in vitro drug screening for spheroid lines.

In vitro drug sensitivity screens are important tools in the discovery of anti-cancer drug combination therapies. Typically, these in vitro drug screens ...

Three-Dimensional (3D) Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in particular (e.g., brain tumors such as glioblastoma multiforme and squamous cell carcinoma of the head and neck &#8211; SCCHN) it is a cause of severe morbidity and can be life-threatening even in the absence of distant metastases. In addition, cancers which have relapsed following treatment unfortunately often present with a more aggressive phenotype. Therefore, there is an opportunity to target the process of invasion to provide novel therapies that could be complementary to standard anti-proliferative agents. Until now, this strategy has been hampered by the lack of robust, reproducible assays suitable for a detailed analysis of invasion and for drug screening. Here we provide a simple micro-plate method (based on uniform, self-assembling 3D tumor spheroids) which has great potential for such studies. We exemplify the assay platform using a human glioblastoma cell line and also an SCCHN model where the development of resistance against targeted epidermal growth factor receptor (EGFR) inhibitors is associated with enhanced matrix-invasive potential. We also provide two alternative methods of semi-automated quantification: one using an imaging cytometer and a second which simply requires standard microscopy and image capture with digital image analysis.

Three-Dimensional 3D Tumor Spheroid Invasion Assay

Invasion of surrounding normal tissues is a defining characteristic of malignant tumors. We provide here a simple, semi-automated micro-plate assay of invasion into a natural 3D biomatrix that has been exemplified with a number of models of advanced human cancers.

Invasion of surrounding normal tissues is generally considered to be a key hallmark of malignant (as opposed to benign) tumors. For some cancers in ...

Medicine

Perfusable Vascular Network with a Tissue Model in a Microfluidic Device

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the spheroid cultures, a perfusable vascular network in the spheroids remains a critical challenge for long-term culture required to maintain and develop their functions, such as protein expressions and morphogenesis. The protocol presents a novel method to integrate a perfusable vascular network within the spheroid in a microfluidic device. To induce a perfusable vascular network in the spheroid, angiogenic sprouts connected to microchannels were guided to the spheroid by utilizing angiogenic factors from human lung fibroblasts cultured in the spheroid. The angiogenic sprouts reached the spheroid, merged with the endothelial cells co-cultured in the spheroid, and formed a continuous vascular network. The vascular network could perfuse the interior of the spheroid without any leakage. The constructed vascular network may be further used as a route for supply of nutrients and removal of waste products, mimicking blood circulation in vivo. The method provides a new platform in spheroid culture toward better recapitulation of living tissues.

The protocol describes how to engineer a perfusable vascular network in a spheroid. The spheroid's surrounding microenvironment is devised to induce angiogenesis and connect the spheroid to the microchannels in a microfluidic device. The method allows the perfusion of the spheroid, which is a long-awaited technique in three-dimensional cultures.

A spheroid (a multicellular aggregate) is regarded as a good model of living tissues in the human body. Despite the significant advancement in the ...

Bioengineering

Standardized and Scalable Assay to Study Perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current in vitro screening models that have sufficient throughput only have limited physiological relevance, which hinders the translation of findings from in vitro to in vivo. On the other hand, microfluidic cell culture platforms have shown unparalleled physiological relevancy in vitro, but often lack the required throughput, scalability and standardization. We demonstrate a robust platform to study angiogenesis of endothelial cells derived from human induced pluripotent stem cells (iPSC-ECs) in a physiological relevant cellular microenvironment, including perfusion and gradients. The iPSC-ECs are cultured as 40 perfused 3D microvessels against a patterned collagen-1 scaffold. Upon the application of a gradient of angiogenic factors, important hallmarks of angiogenesis can be studied, including the differentiation into tip- and stalk cell and the formation of perfusable lumen. Perfusion with fluorescent tracer dyes enables the study of permeability during and after anastomosis of the angiogenic sprouts. In conclusion, this method shows the feasibility of iPSC-derived ECs in a standardized and scalable 3D angiogenic assay that combines physiological relevant culture conditions in a platform that has the required robustness and scalability to be integrated within the drug screening infrastructure.

This method describes the culture of iPSC-derived endothelial cells as 40 perfused 3D microvessels in a standardized microfluidic platform. This platform enables the study of gradient-driven angiogenic sprouting in 3D, including anastomosis and stabilization of the angiogenic sprouts in a scalable and high-throughput manner.

Pre-clinical drug research of vascular diseases requires in vitro models of vasculature that are amendable to high-throughput screening. However, current ...

An Ex Vivo Choroid Sprouting Assay of Ocular Microvascular Angiogenesis

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell (EC) proliferation assays using human retinal microvascular endothelial cells (HRMECs) or isolated primary retinal ECs are widely used in vitro models to study retinal angiogenesis. However, isolating pure murine retinal endothelial cells is technically challenging and retinal ECs may have different proliferation responses than choroidal endothelial cells and different cell/cell interactions. A highly reproducible ex vivo choroidal sprouting assay as a model of choroidal microvascular proliferation was developed. This model includes the interaction between choroid vasculature (EC, macrophages, pericytes) and retinal pigment epithelium (RPE). Mouse RPE/choroid/scleral explants are isolated and incubated in growth-factor-reduced basal membrane extract (BME) (day 0). Medium is changed every other day and choroid sprouting is quantified at day 6. The images of individual choroid explant are taken with an inverted phase microscope and the sprouting area is quantified using a semi-automated macro plug-in to the ImageJ software developed in this lab. This reproducible ex vivo choroidal sprouting assay can be used to assess compounds for potential treatment and for microvascular disease research to assess pathways involved in choroidal micro vessel proliferation using wild type and genetically modified mouse tissue.

This protocol presents choroid sprouting assay, an ex vivo model of microvascular proliferation. This assay can be used to assess pathways involved in proliferating choroidal micro vessels and assess drug treatments using wild type and genetically modified mouse tissue.

Pathological choroidal angiogenesis, a salient feature of age-related macular degeneration, leads to vision impairment and blindness. Endothelial cell ...

Biology

Study of Angiogenesis Using Scratch Wound Migration and Spheroid Sprouting Assays

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A detailed understanding of the underlying molecular mechanisms and reliable screening models are essential for targeting diseases effectively and developing new therapeutic options. Several in vitro assays have been developed to model angiogenesis, capitalizing on the opportunities a controlled environment provides to elucidate angiogenic drivers at a molecular level and screen for therapeutic targets.
This study presents workflows for investigating angiogenesis in vitro using human umbilical vein endothelial cells (HUVECs). We detail a scratch wound migration assay utilizing a live cell imaging system measuring endothelial cell migration in a 2D setting and the spheroid sprouting assay assessing endothelial cell sprouting in a 3D setting provided by a collagen matrix. Additionally, we outline strategies for sample preparation to enable further molecular analyses such as transcriptomics, particularly in the 3D setting, including RNA extraction as well as immunocytochemistry. Altogether, this framework offers scientists a reliable and versatile toolset to pursue their scientific inquiries in in vitro angiogenesis assays.

Author Spotlight: Investigating Angiogenesis Through Challenges and Innovations in Assay Development

This study presents the two-dimensional (2D) scratch wound migration assay and the three-dimensional (3D) spheroid sprouting assay, along with their respective downstream analysis methods, including RNA extraction and immunocytochemistry, as suitable assays to study angiogenesis in vitro.

Angiogenesis plays a crucial role in both physiological and pathological processes within the body including tumor growth or neovascular eye disease. A ...

A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay

Podsumowanie

Przeglądaj więcej filmów

Rozdziały w tym wideo

A 3D Spheroid Model as a More Physiological System for Cancer-Associated Fibroblasts Differentiation and Invasion In Vitro Studies

A 3D Spheroid Model for Glioblastoma

Incorporating Pericytes into an Endothelial Cell Bead Sprouting Assay

Three-dimensional Angiogenesis Assay System using Co-culture Spheroids Formed by Endothelial Colony Forming Cells and Mesenchymal Stem Cells

Spheroid Drug Sensitivity Screening in Glioma Stem Cell Lines

Three-Dimensional (3D) Tumor Spheroid Invasion Assay

Perfusable Vascular Network with a Tissue Model in a Microfluidic Device

Standardized and Scalable Assay to Study Perfused 3D Angiogenic Sprouting of iPSC-derived Endothelial Cells In Vitro

An Ex Vivo Choroid Sprouting Assay of Ocular Microvascular Angiogenesis

Investigating Angiogenesis on a Functional and Molecular Level by Leveraging the Scratch Wound Migration Assay and the Spheroid Sprouting Assay