We thank Taylor AuBuchon-Elder, Jordan Teisher, and Kristina Zudock for assistance in sampling herbarium specimens, and the Missouri Botanical Garden for access to herbarium specimens for destructive sampling. This work was support by a grant from the National Science Foundation (DEB-1457748).

1. Prior to Start
<ol>
	<li>Make fresh cetyl trimethylammonium bromide (CTAB) buffer17 by adding 20 g of CTAB, 10 g of polyvinylpyrrolidone (PVP) 40, 100.0 mL 1 M Tris pH 8.0, 40 mL of 0.5 M ethylenediaminetetraacetic acid (EDTA) pH 8.0, 280.0 mL of 5 M NaCl, and 400.0 mL of reagent water together, and bring the total volume to 1 L using reagent-grade water. Adjust the pH to 8.0. 
	NOTE: Additional reagents can be added to CTAB depending on secondary compounds in individual taxa. See Allen et al.18 for a thorough list of additive reagents.</li>
	<li>Add 10 &#181;L of &#946;-mercaptoethanol per 5 mL of CTAB buffer. 
	NOTE: this can be prepared in batches of 50 mL and stored at room temperature for 3&#8211;4 weeks.
	<ol>
		<li>Heat the CTAB solution in a 65 &#176;C water bath.</li>
	</ol>
	</li>
	<li>Chill mortars and pestles in -20 &#176;C for at least 20 min.</li>
	<li>Label 4 sets of 2 x n 2-mL tubes (where n = the number of samples). Put 1 set of the labeled tubes on ice.</li>
	<li>Chill isopropanol on ice or in a -20 &#176;C freezer.</li>
	<li>Remove solid phase reversible immobilization (SPRI) beads (see Table of Materials) from the fridge, and allow them to equilibrate to room temperature (at least 30 min).</li>
	<li>Prepare 80% ethanol.</li>
	<li>Select herbarium specimens for extraction and retrieve ~1 cm2, or 10 mg, of tissue per specimen, preferably leaf material.</li>
</ol>
2. DNA Extraction
<ol>
	<li>Grind ~1 cm2 of preselected herbarium tissue using prechilled mortars and pestles. Add liquid nitrogen and 30&#8211;50 mg sterilized sand. Grind until tissue turns into fine powder. 
	NOTE: 10 mg or more tissue is desirable, but less has also worked in some cases. Once the liquid nitrogen evaporates, add more as needed until tissue is fully ground. Another common method for disrupting cells and tissues is the use of a bead beater. However, this method was found to not work well for the specimens used in these experiments.</li>
	<li>Transfer the frozen powder into two 2 mL tubes (add no more than half of the tube&#39;s volume). Add 600 &#181;L of warm CTAB solution to each tube and mix the tubes thoroughly by inversion and vortexing. 
	NOTE: Since the quantity and quality of herbarium material is often low, performing DNA isolation in two repetitions helps to obtain higher yields.</li>
	<li>Incubate the samples in a 65 &#176;C water bath for 1&#8211;1.5 h, vortexing every 15 min.</li>
	<li>Centrifuge samples at 10,000 x g for 5 min. Transfer the supernatant to a fresh set of labeled tubes (~500 &#181;L). Discard the pellet using a standard non-chlorinated disposal procedure.</li>
	<li>Add 4 &#181;L of RNase-A (10 mg/mL) to each tube and mix by inverting or pipetting. Incubate the samples at 37 &#176;C in a heat block or water bath for 15 min.</li>
	<li>Add an equal volume (~500 &#181;L) of a 25:24:1 phenol:chloroform:isoamyl alcohol mixture once the tubes have reached room temperature. Mix thoroughly by pipetting up and down and/or with inversion. Centrifuge the tubes at 12,000 x g for 15 min. Transfer the aqueous layer (upper layer) to a fresh set of labeled tubes (~400 &#181;L). Discard the organic layer into a chlorinated waste container. 
	NOTE: Step&#160;2.6 may be repeated if large quantities of secondary compounds are expected in plant material.</li>
	<li>Add an equal volume (~400 &#181;L) of a 24:1 chloroform:isoamyl alcohol mixture. Mix thoroughly by pipetting up and down and/or with inversion. Centrifuge the tubes at 12,000 x g for 15 min. Transfer the aqueous layer (upper layer) to a fresh set of prechilled, labeled tubes (~300 &#181;L). Discard the organic layer into a chlorinated waste container.</li>
	<li>Add an equal volume (~300 &#181;L) of prechilled isopropanol and 12 &#181;L of 2.5 M sodium acetate to each tube. Incubate samples at -20 &#176;C for 30&#8211;60 min. 
	NOTE: The incubation times can be extended (up to overnight incubation), but DNA quality will decrease the longer the samples incubate.</li>
	<li>Take the samples out of the freezer and centrifuge the tubes at 12,000 x g for 15 min. Remove and discard the supernatant gently without disturbing the pellet. Wash the pellet by suspension with fresh 70% ethanol (approximately 300&#8211;500 &#181;L). For each doubled sample, consolidate the two individual pellets into one with accompanying ethanol. 
	NOTE: Samples should be consolidated into one tube using ethanol first and then proceed. It is not necessary to wash each sample with ethanol separately.</li>
	<li>Centrifuge the tubes at 12,000 x g for 10 min. Remove and discard the supernatant gently without disturbing the pellet. Air dry the pellets. 
	NOTE: Samples can be dried faster using a dry heat block (do not exceed 65 &#176;C). Make sure that the samples do not over-dry, as this can decrease the final yield of DNA.</li>
	<li>Suspend the isolated DNA in 50 &#181;L of 1x TE. Store in the -20 &#176;C freezer for long term storage or 4 &#176;C for use in the following week.</li>
</ol>
3. Quality Control (QC)
<ol>
	<li>Run an agarose gel for quality check.
	<ol>
		<li>Prepare a 1x Tris/Borate/EDTA (TBE) buffer by adding 54 g Tris base, 27.5 g boric acid, and 3.75 g EDTA disodium salt, bringing the total volume to 5 L using reagent grade water.</li>
		<li>Prepare a 1% agarose gel by adding 1 g agarose to 100 mL of 1x TBE. Microwave the solution until no agarose is visible. Add 0.01% nucleic acid gel stain (see Table of Materials). Let the flask cool until it is warm to the touch. Mix well by stirring. Pour agarose in a gel tray and let it sit until it solidifies.</li>
		<li>Mix 3 &#181;L of sample, 2 &#181;L of reagent grade water, and 1 &#181;L of 6x loading dye. Load the samples in the gel matrix, noting their order.</li>
		<li>Run the samples for 60&#8211;70 min at 60&#8211;70 V. Image the gel under UV light with correct exposure and focus. 
		NOTE: Presence of a clear high molecular weight band is a sign of high quality DNA, while smears usually indicate DNA degradation. Most herbarium specimens are degraded.</li>
	</ol>
	</li>
	<li>Run a dsDNA quantification analysis (see Table of Materials) to determine the quantity of double stranded DNA.
	<ol>
		<li>Use 2 &#181;L of sample for analysis. 
		NOTE: Dilutions are not needed for the quantification analysis of herbarium material as they tend to be in minimal amounts. Successful libraries have been made from as little as 1.26 ng total dsDNA from this step.</li>
	</ol>
	</li>
</ol>
4. DNA Shearing
NOTE: This is an optimized version of a commercial double-stranded fragmentase protocol (see Table of Materials).
<ol>
	<li>Place dsDNA fragmentation enzyme on ice after vortexing for 3 s.</li>
	<li>In a sterile 0.2 mL polymerase chain reaction (PCR) tube, mix 1&#8211;16 &#181;L isolated DNA with 2 &#181;L of accompanying fragmentation reaction buffer. Bring the total volume to 18 &#181;L by adding nuclease free water. Add 2 &#181;L of dsDNA fragmentation enzyme and vortex the mixture for 3 s. 
	NOTE: The amount of DNA needed varies depending on DNA concentration (aim for 200 ng total in the tube).</li>
	<li>Incubate the samples at 37 &#176;C for 8.5 min. Then add 5 &#181;L of 0.5 M EDTA to the tubes. 
	NOTE: This step needs to be performed as soon as the incubation period is over to terminate the reaction and prevent DNA samples from over-shearing.</li>
</ol>
5. Bead Clean-up
<ol>
	<li>Homogenize the SPRI beads by vortexing.</li>
	<li>Bring the total volume of the sheared DNA to 50 &#181;L by adding 25 &#181;L of nuclease free water. Add 45 &#181;L of room temperature SPRI beads (90% volume) to 50 &#181;L of sheared DNA and mix thoroughly by pipetting up and down. 
	NOTE: Adding beads at 90% of total sample volume is done to remove the smallest of DNA fragments, often below 200 base pairs.</li>
	<li>Let the samples incubate for 5 min. Put the tubes on a magnetic plate and let them sit for 5 min. Carefully remove and discard the supernatant. 
	NOTE: Be careful not to disturb the beads, as they contain the desired DNA targets.</li>
	<li>Add 200 &#181;L of fresh 80% ethanol to the tubes while on the magnetic stand. Incubate at room temperature for 30 s and then carefully remove and discard the supernatant. Repeat this step once. Air dry the beads for 5 min while the tube is on the magnetic stand with its lid open. 
	NOTE: Avoid over-drying the beads. This can result in lower recovery of DNA.</li>
	<li>Remove the tubes from the magnet. Elute the DNA from the beads into 55 &#181;L of 0.1x TE and mix thoroughly by pipetting up and down. Incubate at room temperature for 5 min. Place tubes on the magnetic stand and wait for the solution to turn clear (~2 min).</li>
	<li>Pull off 52 &#181;L of the supernatant. Run a DNA quantification analysis on the samples to check the recovery and the initial concentration that goes into library prep. 
	NOTE: Libraries have been made with total dsDNA estimated to be less than 1.25 ng, though in each case reamplification was required.</li>
</ol>
6. Library Preparation
NOTE: This is a modified version of a commercially available library kit (see Table of Materials protocol).
<ol>
	<li>End Prep
	<ol>
		<li>Add 3 &#181;L of endonuclease and phosphate tailing enzymes, and 7 &#181;L of accompanying reaction buffer to 50 &#181;L of cleaned, sheared DNA. Mix thoroughly by pipetting up and down. Spin the tubes to remove bubbles. 
		NOTE: The total volume should be 60 &#181;L.</li>
		<li>Place the samples in a thermocycler with the following program: 30 min at 20 &#176;C, 30 min at 65 &#176;C, then hold at 4 &#176;C. 
		NOTE: Heated lid was set to &#8805;75 &#176;C</li>
	</ol>
	</li>
	<li>Adaptor Ligation
	<ol>
		<li>Dilute the adaptor 25&#8211;50 fold (working adaptor concentration of 0.6&#8211;0.3 &#181;M). Add 30 &#181;L of ligation master mix, 1 &#181;L of ligation enhancer, and 2.5 &#181;L of adaptor for high-throughput short read sequencing to the tubes. 
		NOTE: The total volume should be 93.5 &#181;L.</li>
		<li>Mix thoroughly by pipetting up and down. Spin the tubes to remove bubbles. Incubate the tubes at 20 &#176;C for 15 min.</li>
		<li>Add 3 &#181;L of commercial mixture of uracil DNA glycosylase (UDG) and the DNA glycosylase-lyase Endonuclease VIII (see Table of Materials) to the tubes. Ensure that the total volume is 96.5 &#181;L. Mix thoroughly and incubate at 37 &#176;C for 15 min using a thermocycler. 
		NOTE: The lid should be set to &#8805;47 &#176;C. The original version of the commercial protocol has size selection after the adaptor ligation step, followed by a bead cleanup as the final step. This protocol, which achieves higher yields, switches the order of these steps and implements size selection as a final step.</li>
	</ol>
	</li>
	<li>Cleanup to Remove Enzymes and Small Fragments
	<ol>
		<li>Homogenize magnetic beads by vortexing.</li>
		<li>Add 78 &#181;L of SPRI magnetic beads (80% volume) and mix thoroughly by pipetting up and down. 
		NOTE: Adding beads at 80% of total sample volume is done to remove the smallest DNA fragments, which are often shorter than 250 base pairs. The more stringent removal of small DNA fragments is to (i) remove surplus adaptors and (ii) emphasize amplification of larger fragments in the following steps.</li>
		<li>Let the samples incubate for 5 min. Put the tubes on a magnetic plate for 5 min. Carefully remove and discard the supernatant that contains the DNA outside the desired size range. 
		NOTE: Be careful not to disturb the beads that contain the desired DNA targets.</li>
		<li>Add 200 &#181;L of fresh 80% ethanol to the tubes while on the magnetic stand. Incubate at room temperature for 30 s and then carefully remove and discard the supernatant. Repeat this step once. Air dry the beads for 5 min while the tube is on the magnetic stand with lid open. 
		NOTE: Avoid over drying the beads. This can result in lower recovery of DNA.</li>
		<li>Remove the tubes from the magnet. Elute the DNA target from the beads by adding 17 &#181;L of 0.1x TE and mix thoroughly by pipetting up and down.</li>
		<li>Incubate at room temperature for 5 min. Place tubes on the magnetic stand and wait for the solution to turn clear (~2 min).</li>
		<li>Pull off 15 &#181;L of the supernatant.</li>
	</ol>
	</li>
	<li>PCR amplification
	<ol>
		<li>Add 25 &#181;L of high fidelity PCR master mix, 5 &#181;L of high-throughput short read sequencing library prep 5&#39; primer, and 5 &#181;L of high-throughput short read sequencing library prep 3&#39; primer, to 15 &#181;L of the cleaned adaptor-ligated DNA. 
		NOTE: Total volume should be 50 &#181;L.</li>
		<li>Mix well by vortexing. Place the samples into a thermocycler using the settings found in Table 1: Thermocycler amplification setting. 
		NOTE: A large number of cycles is needed due to the low quantity of input DNA.</li>
	</ol>
	</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Cycle Step</td>
			<td>Temp.&#160;</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>98 &#176;C</td>
			<td>30 s</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>98 &#176;C</td>
			<td>10 s</td>
			<td>12</td>
		</tr>
		<tr>
			<td>Annealing/Extension</td>
			<td>65 &#176;C</td>
			<td>75 s</td>
			<td>12</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>65 &#176;C</td>
			<td>5 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4 &#176;C</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: PCR protocol denaturation, annealing, and extension times and temperatures. Temperature and times were optimized for the reagents presented in this protocol. If reagents are altered, temperatures and times should be optimized again.
<ol start="5">
	<li>Size Selection for Desired Library Size 
	NOTE: This bead step will remove fragments both above and below the target range.
	<ol>
		<li>Homogenize SPRI beads by vortexing.</li>
		<li>Add 25 &#181;L (50% volume) of room temperature magnetic beads and mix thoroughly by pipetting up and down. Let the samples incubate for 5 min. Put the tubes on a magnetic plate and let them sit for 5 min. Carefully remove and transfer the supernatant to a new set of labeled tubes. 
		NOTE: This volume can be adjusted based on desired library size. The supernatant contains DNA fragments of the desired size. In the first bead incubation, the beads are binding larger library fragments. These are removed to focus on those in the 400&#8211;600 base pair range. The supernatant contains smaller fragments.</li>
		<li>Add 6 &#181;L of room temperature SPRI beads to the supernatant and mix thoroughly by pipetting up and down. Let the samples incubate for 5 min. Put the tubes on a magnetic plate and let them sit for 5 min. 
		NOTE: This volume can be adjusted based on desired library size in accordance with step 6.5.2.</li>
		<li>Carefully remove and discard the supernatant. 
		NOTE: Be careful not to disturb the beads that contain the desired DNA. In the second bead incubation, the beads are binding to the fragments left after the initial removal of the largest DNA fragments. This set of fragments is usually in the desired size range.</li>
		<li>Add 200 &#181;L of fresh 80% ethanol to the tubes while on the magnetic stand. Incubate at room temperature for 30 s, then carefully remove and discard the supernatant. Repeat. Air dry the beads for 5 min while the tube is on the magnetic stand with lid open. 
		NOTE: Avoid over-drying the beads. This can result in lower recovery of DNA.</li>
		<li>Remove the tubes from the magnet. Elute the DNA target from the beads into 33 &#181;L of 0.1x TE and mix thoroughly by pipetting up and down.</li>
		<li>Incubate at room temperature for 5 min. Place tubes on the magnetic stand and wait for the solution to turn clear (~2 min). Pull off 30 &#181;L of the supernatant and transfer to 2 mL tubes (see Table of Materials) for storage. 
		NOTE: The libraries can be kept at -20 &#730;C for long-term storage.</li>
	</ol>
	</li>
	<li>Quality control
	<ol>
		<li>Run a quality control test on the DNA Libraries. Refer to steps 3.1 and 3.2. 
		NOTE: For DNA libraries, run the gel for ~45 min at 96 V.</li>
	</ol>
	</li>
	<li>Library reamplification: Optional if library quantity is not sufficient. 
	NOTE: Samples with library concentrations below 10 nM can be reamplified using the following steps. Reamplification of low concentration libraries can achieve workable results for sequencing, but reamplification may cause a modest shift in base composition diversity, though gathered data (Table 3) suggest that this is negligible for certain metrics.
	<ol>
		<li>Dilute the universal reamplification primers 10-fold using 0.1x TE.</li>
		<li>Add 25 &#181;L of high fidelity PCR master mix, 5 &#181;L of diluted universal reamplification primer 1 (AATGATACGGCGACCACCGA), and 5 &#181;L of diluted universal reamplification primer 2 (CAAGCAGAAGACGGCATACGA) to 15 &#181;L of low concentration libraries. NOTE: Total volume should be at 50 &#181;L.</li>
		<li>Mix well by vortexing. Place the samples into a thermocycler using the settings found in Table 1: Thermocycler amplification setting 
		NOTE: The large number of cycles is needed due to low quantity of input DNA.</li>
		<li>Bead clean-up</li>
		<li>Homogenize SPRI beads by vortexing. Add 45 &#181;L of room temperature SPRI beads (90% volume) and mix thoroughly by pipetting up and down.</li>
		<li>Let the samples incubate for 5 min. Put the tubes on a magnetic plate for 5 min.</li>
		<li>Carefully remove and discard the supernatant that contains the unwanted DNA. 
		NOTE: Be careful not to disturb the beads that contain the desired DNA targets.</li>
		<li>Add 200 &#181;L of fresh 80% ethanol to the tubes while on the magnetic stand. Incubate at room temperature for 30 s, and then carefully remove and discard the supernatant. Repeat this step once.</li>
		<li>Air dry the beads for 5 min while the tube is on the magnetic stand with its lid open. 
		NOTE: Avoid over-drying the beads. This can result in lower recovery of the DNA target.</li>
		<li>Remove the tubes from the magnet. Elute the DNA target from the beads into 33 &#181;L of 0.1x TE and mix thoroughly by pipetting up and down.</li>
		<li>Incubate at room temperature for 5 min. Place tubes on the magnetic stand and wait for the solution to turn clear (~2 min).</li>
		<li>Pull off 30 &#181;L of the supernatant. The libraries can be stored at -20 &#176;C for long-term storage.</li>
	</ol>
	</li>
	<li>Quality control
	<ol>
		<li>Run a quality control test on the DNA Libraries. Refer to steps 3.1 and 3.2. For DNA libraries, run the gel for ~45 min at 96 V. 
		NOTE: If a double band is seen in the gel, this is likely a consequence of primer exhaustion from the reamplification step. The bands can be removed by repeating 6.9, but using only one cycle in the PCR program depicted in Table 1.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Savolainen, V., Cu&#233;noud, P., Spichiger, R., Martinez, M. D. P., Cr&#232;vecoeur, M., Manen, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+herbarium+specimens+in+DNA+phylogenetics:+Evaluation+and+improvement.">The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement.</a> Plant Syst Evo. 197 (1-4), 87-98 (1995).</li><li>Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Museomics+illuminate+the+history+of+an+extinct,+paleoendemic+plant+lineage+(Hesperelaea,+Oleaceae)+known+from+an+1875+collection+from+Guadalupe+Island,+Mexico.">Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico.</a> Bio J Linn Soc. 117 (1), 44-57 (2016).</li><li>Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyphyly+of+Arundinoideae+(Poaceae)+and+Evolution+of+the+Twisted+Geniculate+Lemma+Awn.">Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn.</a> Ann Bot. , (2017).</li><li>Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+variation+in+time+and+space:+the+use+of+herbarium+specimens+to+reconstruct+patterns+of+genetic+variation+in+the+endangered+orchid+Anacamptis+palustris.">Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris.</a> Conserv Gen. 8 (3), 629-639 (2007).</li><li>Wandeler, P., Hoeck, P. E. A., Keller, L. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Back+to+the+future:+museum+specimens+in+population+genetics.">Back to the future: museum specimens in population genetics.</a> Tre Eco &amp; Evo. 22 (12), 634-642 (2007).</li><li>Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+many+herbarium+specimens+are+needed+to+detect+threatened+species?.">How many herbarium specimens are needed to detect threatened species?.</a> Bio Conserv. 144 (10), 2541-2547 (2011).</li><li>Saltonstall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryptic+invasion+by+a+non-native+genotype+of+the+common+reed,+Phragmites+australis,+into+North+America.">Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America.</a> PNAS USA. 99 (4), 2445-2449 (2002).</li><li>Besnard, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+museums+to+genomics:+old+herbarium+specimens+shed+light+on+a+C3+to+C4+transition.">From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition.</a> J Exp Bot. 65 (22), 6711-6721 (2014).</li><li>S&#228;rkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+to+open+the+treasure+chest?+Optimising+DNA+extraction+from+herbarium+specimens.">How to open the treasure chest? Optimising DNA extraction from herbarium specimens.</a> PLoS ONE. 7 (8), e43808 (2012).</li><li>Harris, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+analysis+of+tropical+plant+species:+An+assessment+of+different+drying+methods.">DNA analysis of tropical plant species: An assessment of different drying methods.</a> Plant Syst Evo. 188 (1-2), 57-64 (1994).</li><li>Staats, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+damage+in+plant+herbarium+tissue.">DNA damage in plant herbarium tissue.</a> PLoS ONE. 6 (12), e28448 (2011).</li><li>Bakker, F. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Herbarium+genomics:+plastome+sequence+assembly+from+a+range+of+herbarium+specimens+using+an+Iterative+Organelle+Genome+Assembly+pipeline.">Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline.</a> Bio J of the Linn Soc. 117 (1), 33-43 (2016).</li><li>Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endophytic+fungal+DNA,+the+source+of+contamination+in+spruce+needle+DNA.">Endophytic fungal DNA, the source of contamination in spruce needle DNA.</a> Mol Eco. 6 (10), 983-987 (1997).</li><li>Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., P&#228;&#228;bo, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequences+from+multiple+amplifications+reveal+artifacts+induced+by+cytosine+deamination+in+ancient+DNA.">DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA.</a> Nucl Acids Res. 29 (23), 4793-4799 (2001).</li><li>Staats, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+treasure+troves:+Complete+genome+sequencing+of+herbarium+and+insect+museum+specimens.">Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens.</a> PLoS ONE. 8 (7), e69189 (2013).</li><li>Bakker, F. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Herbarium+genomics:+skimming+and+plastomics+from+archival+specimens.">Herbarium genomics: skimming and plastomics from archival specimens.</a> Webbia. 72 (1), 35-45 (2017).</li><li>Doyle, J. J., Doyle, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+DNA+isolation+procedure+for+small+quantities+of+fresh+leaf+tissue.">A rapid DNA isolation procedure for small quantities of fresh leaf tissue.</a> Phytochem Bul. 19, 11-15 (1987).</li><li>Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+protocol+for+rapid+DNA+isolation+from+plant+tissue+using+cetryltrimethylammonium+bromide.">A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide.</a> Nat Prot. 1, 2320-2325 (2006).</li><li>Twyford, A. D., Ness, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Strategies+for+complete+plastid+genome+seqeuncing.">Strategies for complete plastid genome seqeuncing.</a> Mol Eco Resour. , (2016).</li><li>Aird, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analyzing+and+minimizing+PCR+amplification+bias+in+Illumina+sequencing+libraries.">Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries.</a> Genome Bio. 12 (2), R18 (2011).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+A+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: A flexible trimmer for Illumina sequence data.</a> Bioinf. 30, 2114-2120 (2014).</li><li>Grigoriev, I. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MycoCosm+portal:+gearing+up+for+1000+fungal+genomes.">MycoCosm portal: gearing up for 1000 fungal genomes.</a> Nucl Acids Res. 42 (1), D699-D704 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nat Meth. 9 (4), 357-359 (2012).</li><li>Herbarium Genomics. Available from: <a target="_blank" href="https://github.com/mrmckain/">https://github.com/mrmckain/</a> (2017)</li><li>. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes Available from: <a target="_blank" href="https://github.com/mrmckain/">https://github.com/mrmckain/</a> (2017)</li><li>McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Timing+of+rapid+diversification+and+convergent+origins+of+active+pollination+within+Agavoideae+(Asparagaceae).">Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae).</a> Am J Bot. 103 (10), 1717-1729 (2016).</li><li>McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Verdant:+automated+annotation,+alignment,+and+phylogenetic+analysis+of+whole+chloroplast+genomes.">Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes.</a> Bioinf. , (2016).</li><li>Staton, S. E., Burke, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposome:+A+toolkit+for+annotation+of+transposable+element+families+from+unassembled+sequence+reads.">Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads.</a> Bioinf. 31 (11), 1827-1829 (2015).</li><li>Bao, W., Kojima, K. K., Kohany, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repbase+Update,+a+database+of+repetitive+elements+in+eukaryotic+genomes.">Repbase Update, a database of repetitive elements in eukaryotic genomes.</a> Mobile DNA. 6 (1), 11 (2015).</li><li>. Transposons Available from: <a target="_blank" href="https://github.com/mrmckain/">https://github.com/mrmckain/</a> (2017)</li><li>Wei&#223;, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+patterns+of+damage+and+decay+kinetics+of+DNA+retrieved+from+plant+herbarium+specimens.">Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.</a> Royal Soc Open Sci. 3 (6), 160239 (2016).</li><li>Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., P&#228;&#228;bo, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+patterns+of+nucleotide+misincorporations+and+DNA+fragmentation+in+ancient+DNA.">Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA.</a> PLoS ONE. 7 (3), e34131 (2012).</li><li>Head, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Library+construction+for+next-generation+sequencing:+overviews+and+challenges.">Library construction for next-generation sequencing: overviews and challenges.</a> BioTechniques. 56 (2), 61-64 (2014).</li><li>Grover, C. E., Salmon, A., Wendel, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+sequence+capture+as+a+powerful+tool+for+evolutionary+analysis.">Targeted sequence capture as a powerful tool for evolutionary analysis.</a> Am J Bot. 99, 312-319 (2012).</li></ol>

The authors declare they have no competing interests.

The protocol presented here is a comprehensive and robust method for DNA isolation and sequencing library preparation from dried plant specimens. The consistency of the method and minimal need to alter it based on specimen quality make it scalable for large herbarium-based sequencing projects. The inclusion of an optional reamplification step for low yield libraries allows the inclusion of low quality, low quantity, rare, or historically important samples that would otherwise not be suitable for sequencing.
Importance of Initial DNA Yield 
Herbarium-derived DNA is often degraded as a consequence of initial specimen preservation11, with DNA of specimens less than 300 years old being as degraded as DNA isolated from animal remains that are several hundred to thousands of years old31,32. Consequently, optimization of initial DNA yield is vital in obtaining enough high-quality dsDNA for successful sequencing library preparation. For grass species, an optimal yield is achieved through the combined use of sterilized sand and liquid nitrogen in the initial grinding step, providing a more thorough destruction of cell walls and release of nucleic acids. This approach increases both desirable larger dsDNA and undesirable smaller fragments (Figure 1, Supplemental Figure 1, Table 2, Supplemental Table 1). Subsequent bead cleaning steps isolate and enrich for fragments of a size appropriate for sequencing (300&#8211;500 base pairs), greatly reducing recovery but also enriching for longer fragments (Table 2, Supplemental Table 1). Alterations to the initial DNA isolation steps may be necessary based on the lineage being sampled in order to reduce the effects of secondary metabolites on downstream processing18.
Optimization of Library Adaptors 
The concentration of adaptors used for ligation has a direct effect on the amount of adaptor dimer in finished libraries. Adaptor dimers result from adaptor self-ligation when insufficient sample is present, and contaminate sequencing runs33. The relatively low total dsDNA available from herbarium specimens necessitates dilution of adaptors prior to ligation. Adaptors can be diluted 50-fold from the stock concentration of 15 &#181;M (see Protocol Section) facilitating high-throughput library preparation without the need to individually measure and dilute adaptor for each sample (Table 2, Supplemental Table 1). Though saturation of adaptors could in principle decrease overall library yield, it is unlikely that herbarium specimens will yield dsDNA in such excess of adaptor.
Variation in Bead Cleaning Steps for Higher Yields 
Size selection in preparation of sequencing libraries is usually done after adaptor ligation, allowing for amplification of fragments primarily within the desired size range; this is done by removing fragments that are both larger and smaller than the target size. The low amount of herbarium-derived dsDNA for library preparation is exacerbated after size selection at this step, resulting in unworkably low total dsDNA and ultimately low yield in the final library. By conducting a standard bead-cleaning step using 90% volume beads after ligation, more total dsDNA remains for enrichment in the amplification step. Extremely small DNA fragments are preferentially removed using 90% volume beads. Size selection is conducted in the final step on the amplified library, which ensures enrichment of desired fragment sizes. Total volumes of beads can be adjusted to select the desired range, though the two-step volumes of 25 &#181;L and 6 &#181;L of beads are optimized to retrieve libraries of 400-500 base pair inserts within this protocol (Figure 1B, Supplementary Figure 2).
Sample Rescue through Reamplification of Libraries 
Despite best practices in DNA isolation and library preparation, final concentrations of sequencing libraries may be inadequate for further sequencing. The destructive nature of sampling and often limited expendable material from herbarium specimens does not always permit repeating DNA isolation. By reamplifying the library up to 12 additional PCR cycles, even exceptionally poor libraries can be saved. A standard primer pair is used for amplification, which is compatible with either dual or single indexed library protocols. A primary concern for reamplification is the introduction of bias, often through reduction in GC-rich portions of the genome20. By using a high-fidelity polymerase (see Table of Materials), these potential biases are potentially avoided. This is demonstrated through the minimal variation of GC content of the sequenced libraries TK686 and TK686-R (Table 3). As a second verification, the transposon content of both TK686 and TK686-R was estimated and showed no discernible differences (Table 3). Finally, the whole chloroplast genome of this accession was assembled from TK686 and TK686-R, which resulted in identical sequences after close inspection of SNP variation between the two assemblies (Figure 2, Table 3). These tests suggest that standard genomic metrics, such as GC content and transposon composition, and the ability to assemble complete chloroplast genomes, may not be affected by reamplification. This opens up the possibility of incorporating herbarium specimens thought to be too degraded or lacking in material into phylogenomic studies without concern for introduced bias through PCR. These reamplified libraries might also be used for sequence capture34, although it would be necessary to test whether SNP calling is biased. It is recommended that small scale tests of bias be conducted with each project to verify that bias is not introduced into sequencing libraries.
Limitations and Possible Modifications 
Even though this protocol has worked on hundreds of herbarium specimens, poorly preserved tissues may still fail at any step. It is, however, exceedingly rare for libraries to fail from tissues with successful DNA extractions, especially after library rescue through reamplification. The size selection steps can be modified to target different sized fragments or to reduce the wide range of fragments seen in some final libraries. As with all plant-based extraction protocols, steps may be needed to remove lineage-specific secondary compounds that can impede the overall protocol. As presented, this protocol provides a standard method for DNA isolation and high-throughput library preparation for grass herbarium specimens, and through verification and experimentation is likely to be amendable to other plant lineages.

Herbarium collections are a potentially valuable source of both species and genomic diversity for studies including phylogenetics1,2,3, population genetics4,5, conservation biology6, invasive species biology7, and trait evolution8. The ability to obtain a rich diversity of species, populations, geographical locations, and time points highlights the &#34;treasure chest&#34;9 that is the herbarium. Historically, the degraded nature of herbarium-derived DNA has hindered PCR-based projects, often relegating researchers to using only markers found in high copy, such as regions of the chloroplast genome or the internal transcribed spacer (ITS) of the ribosomal RNA. Quality of specimens and DNA vary extensively based on methods of preservation9,10, with double-stranded breaks and fragmentation from heat used in the drying process being the most common forms of damage, creating the so-called 90% DNA lock-up that has encumbered PCR-based studies11. Aside from fragmentation, the second most prevalent issue in herbarium genomics is contamination, such as that derived from endophytic fungi13 or fungi acquired postmortem after collection but before mounting in the herbarium12, though this problem can be solved bioinformatically given the right fungal database (see below). A third, and less common, problem is sequence modification through cytosine deamination (C/G&#8594;T/A)14, although it is estimated to be low (~0.03%) in herbarium specimens11. With the advent of high-throughput sequencing (HTS), the issue of fragmentation can be overcome with short reads and sequencing depth12,15, allowing genomic-level data acquisition from numerous specimens with low quality DNA, and even sometimes permitting whole genome sequencing15.
Herbarium samples are becoming more frequently used and are a larger component of phylogenetic projects16. A current challenge of using herbarium specimens for HTS is consistently obtaining sufficient double stranded DNA, a necessary prerequisite for sequencing protocols, from numerous species in a timely manner, without needing to optimize methods for individual specimens. In this paper, a protocol for DNA extraction and library preparation of herbarium specimens is demonstrated that takes advantage of existing methods and modifies them to allow for fast and replicable results. This method allows for complete processing from specimen to a library of 24 samples in 13 h, with 8 h hands-on time, or 16 h, with 9 h hands-on time, when the optional reamplification step is required. Simultaneous processing of more samples is achievable, though the limiting factor is centrifuge capacity and technical skill. The protocol is designed to require only typical laboratory equipment (thermocycler, centrifuge, and magnetic stands) instead of specialized equipment, such as a nebulizer or sonicator, for shearing DNA.
DNA quality, fragment size, and quantity are limiting factors for the use of herbarium specimens in high-throughput sequencing experiments. Other methods for isolating herbarium DNA and creating high-throughput sequencing libraries have demonstrated the utility of using as little as 10 ng of DNA16; however they require experimentally determining the optimum number of PCR cycles required for library preparation. This becomes impractical when dealing with exceedingly small amounts of viable double stranded DNA (dsDNA), as some herbarium specimens produce only enough DNA for a single library preparation. The method presented here uses a single number of cycles regardless of sample quality, so no DNA is lost in library optimization steps. Instead, a reamplification step is invoked when libraries do not meet the minimum amounts needed for sequencing. Many herbarium samples are rare and possess little material making it difficult to justify destructive sampling in many cases. To counter this, the presented protocol allows dsDNA input sizes less than 1.25 ng into the library preparation process, expanding the scope of viable samples for high-throughput sequencing and minimizing the need for destructive sampling of specimens.
The following protocol has been optimized for grasses and tested on hundreds of different species from herbarium samples, although we expect that the protocol can be applied to many other plant groups. It includes an optional recovery step that can be used to save low quality and/or rare specimens. Based on over two hundred herbarium specimens tested, this protocol works on specimens with low tissue input and quality, allowing for the preservation of rare specimens through minimal destructive sampling. Here it is shown that this protocol can provide high quality libraries that can be sequenced for phylogenomics-based projects.

<table border="0" cellpadding="0" cellspacing="0" width="733">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Veriti Thermal Cycler</td>
			<td style="width:180px;">Applied Biosystems</td>
			<td style="width:104px;">4452300</td>
			<td style="width:147px;">96 well&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Gel Imaging System</td>
			<td style="width:180px;">Azure Biosystems</td>
			<td style="width:104px;">c300</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Microfuge 20 Series</td>
			<td style="width:180px;">Beckman Coulter</td>
			<td style="width:104px;">B30137</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Digital Dry Bath</td>
			<td style="width:180px;">Benchmark Scientific</td>
			<td style="width:104px;">BSH1001</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Electrophoresis System</td>
			<td style="width:180px;">EasyCast</td>
			<td style="width:104px;">B2</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">PURELAB flex 2 (Ultra pure water)</td>
			<td style="width:180px;">ELGA&#160;</td>
			<td style="width:104px;">89204-092</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">DNA LoBind Tube&#160;</td>
			<td style="width:180px;">Eppendorf</td>
			<td>30108078</td>
			<td style="width:147px;">2 ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Mini centrifuge</td>
			<td style="width:180px;">Fisher Scientific</td>
			<td style="width:104px;">12-006-901</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Vortex-Genie 2</td>
			<td style="width:180px;">Fisher Scientific</td>
			<td style="width:104px;">12-812</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Mortar</td>
			<td style="width:180px;">Fisher Scientific</td>
			<td style="width:104px;">S02591</td>
			<td style="width:147px;">porcelain</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Pestle</td>
			<td style="width:180px;">fisher Scientific</td>
			<td style="width:104px;">S02595</td>
			<td style="width:147px;">porcelain</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Centrifuge tubes</td>
			<td style="width:180px;">fisher Scientific</td>
			<td style="width:104px;">21-403-161</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Microwave</td>
			<td style="width:180px;">Kenmore</td>
			<td style="width:104px;">405.7309231</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Qubit Assay Tubes</td>
			<td style="width:180px;">Invitrogen</td>
			<td style="width:104px;">Q32856</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">0.2 ml Strip tube and Cap for PCR</td>
			<td style="width:180px;">VWR</td>
			<td style="width:104px;">20170-004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Qubit 2.0 Fluorometer</td>
			<td style="width:180px;">Invitrogen</td>
			<td style="width:104px;">Q32866</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Balance</td>
			<td style="width:180px;">Mettler Toledo</td>
			<td style="width:104px;">PM2000</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Liquid Nitrogen Short-term Storage</td>
			<td style="width:180px;">Nalgene</td>
			<td style="width:104px;">F9401</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Magnetic-Ring Stand&#160;</td>
			<td style="width:180px;">ThermoFisher Scientific&#160;</td>
			<td style="width:104px;">AM10050</td>
			<td style="width:147px;">96 well&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Water Bath</td>
			<td style="width:180px;">VWR</td>
			<td style="width:104px;">89032-210</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Hot Plate Stirrers</td>
			<td style="width:180px;">VWR</td>
			<td style="width:104px;">97042-754</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Liquid Nitrogen</td>
			<td style="width:180px;">Airgas</td>
			<td style="width:104px;">UN1977</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">1 X TE Buffer</td>
			<td style="width:180px;">Ambion</td>
			<td style="width:104px;">AM9849</td>
			<td style="width:147px;">pH 8.0</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">CTAB</td>
			<td style="width:180px;">AMRESCO</td>
			<td style="width:104px;">0833-500G</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">2-MERCAPTOETHANOL</td>
			<td style="width:180px;">AMRESCO</td>
			<td style="width:104px;">0482-200ML</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Ribonuclease A</td>
			<td style="width:180px;">AMRESCO</td>
			<td style="width:104px;">E866-5ML</td>
			<td style="width:147px;">10 mg/ml solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Agencourt AMPure XP</td>
			<td style="width:180px;">Beckman Coulter</td>
			<td style="width:104px;">A63882</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Sodium Chloride</td>
			<td style="width:180px;">bio WORLD</td>
			<td style="width:104px;">705744</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Isopropyl Alcohol</td>
			<td style="width:180px;">bio WORLD</td>
			<td style="width:104px;">40970004-1</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Nuclease Free water</td>
			<td style="width:180px;">bio WORLD</td>
			<td style="width:104px;">42300012-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Isoamyl Alcohol</td>
			<td style="width:180px;">Fisher Scientific</td>
			<td style="width:104px;">A393-500</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Sodium Acetate Trihydrate</td>
			<td style="width:180px;">Fisher Scientific</td>
			<td style="width:104px;">s608-500</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">LE Agarose</td>
			<td style="width:180px;">GeneMate</td>
			<td style="width:104px;">E-3120-500</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">100bp PLUS DNA Ladder</td>
			<td style="width:180px;">Gold Biotechnology</td>
			<td style="width:104px;">D003-500</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">EDTA, Disodium Salt</td>
			<td style="width:180px;">IBI Scientific</td>
			<td style="width:104px;">IB70182</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Qubit dsDNA HS Assay Kit</td>
			<td style="width:180px;">Life Technologies</td>
			<td style="width:104px;">Q32854</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">TRIS</td>
			<td style="width:180px;">MP Biomedicals</td>
			<td style="width:104px;">103133</td>
			<td style="width:147px;">ultra pure</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Gel Loading Dye Purple (6 X)</td>
			<td style="width:180px;">New England BioLabs</td>
			<td style="width:104px;">B7024S</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">NEBNext dsDNA Fragmentase</td>
			<td style="width:180px;">New England BioLabs</td>
			<td style="width:104px;">M0348L</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:303px;">NEBNext Ultra II DNA Library Prep Kit for Illumina&#160;</td>
			<td style="width:180px;">New England BioLabs</td>
			<td style="width:104px;">E7645L</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:303px;">NEBNext Multiplex Oligos for Illumina</td>
			<td style="width:180px;">New England BioLabs</td>
			<td style="width:104px;">E7600S</td>
			<td style="width:147px;">Dual Index Primers Set 1</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">NEBNext Q5 Hot Start HiFi PCR Master Mix</td>
			<td style="width:180px;">New England BioLabs</td>
			<td style="width:104px;">M0543L</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Mag-Bind RXNPure Plus</td>
			<td style="width:180px;">Omega bio-tek</td>
			<td style="width:104px;">M1386-02</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">GelRed 10000 X</td>
			<td style="width:180px;">Pheonix Research</td>
			<td style="width:104px;">41003-1</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Phenol solution</td>
			<td style="width:180px;">SIGMA Life Science</td>
			<td style="width:104px;">P4557-400ml</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">PVP40</td>
			<td style="width:180px;">SIGMA-Aldrich</td>
			<td style="width:104px;">PVP40-50G</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:303px;">Chloroform</td>
			<td style="width:180px;">VWR</td>
			<td style="width:104px;">EM8.22265.2500</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Ethanol</td>
			<td style="width:180px;">Koptec</td>
			<td style="width:104px;">V1016</td>
			<td style="width:147px;">200 Proof</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Silica sand</td>
			<td style="width:180px;">VWR</td>
			<td style="width:104px;">14808-60-7</td>
			<td style="width:147px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reamplification primers</td>
			<td colspan="2">Integrated DNA Technologies</td>
			<td>see text</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:303px;">Sequencher v.5.0.1</td>
			<td style="width:180px;">GeneCodes</td>
			<td style="width:104px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

robust dna isolation and high-throughput sequencing library construction for herbarium specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

DNA Isolation and Final Library Yield 
In this study, the efficacy of the protocol for the isolation of herbarium DNA and the recovery of high quality sequencing libraries was demonstrated using fifty different samples with the oldest from 1920 and the youngest from 2012 (Table 2). For each sample, approximately 10 mg of leaf tissue was used for DNA isolation. Greener leaf tissue was favored if available, and no tissue with obvious fungal contamination was selected. Successful isolations can be made using yellow or brown tissue, though yield should be expected to be lower. Total double stranded DNA (dsDNA) from the initial isolation ranged from 3.56 ng to 2,610 ng. As expected, DNA obtained from herbarium specimens was highly degraded (Figure 1A, Supplemental Figure 1). A portion of these isolations were used for enzymatic shearing (1.26&#8211;464 ng). Though herbarium DNA is already sheared through the preservation process, optimization of the protocol requires additional shearing to improve overall library yield. The total recovery of dsDNA post-shearing ranged from &#60;1% to 51% of input dsDNA, resulting in a minimum of less than 1.25 ng of starting DNA for library preparation and a maximum of 328 ng. The extreme loss of DNA in some samples can be attributed to the already small fragment size of much of the DNA prior to enzymatic shearing (Figure 1A, Supplemental Figure 1). The use of a 90% volume bead cleanup on the sheared DNA purposely removed the smallest fragments of DNA to enrich for larger, more desirable fragment sizes. These small fragments were especially seen in samples TK463, TK657, and TK694, as denoted by an intense signal at the 100 base pair mark (Figure 1A).
The total quantity of the library post size selection ranged from 1.425 ng to 942.5 ng (Table 2, Supplemental Table 1). For 23 of the samples, the initial extraction and library preparation did not yield an adequate amount of library (&#60;10 nM; Table 2, Supplemental Table 1), so these samples were subjected to the reamplification and recovery steps of the protocol, resulting in a 14&#8211;680x increase in total library (Table 2, Supplemental Table 1). Final libraries resulted in a band between 350 and 500 base pairs (Figure 1B, Supplemental Figure 2). At times, a second band that was larger than the expected library size was seen (Figure 1B, Supplemental Figure 2). This occurred when the reamplification PCR exhausted available primers and began annealing library adaptors of non-homologous DNA fragments. This creates a molecule where the ends (the adaptors) were properly annealing, but the DNA insert did not. This &#34;bubbled&#34; molecule appeared larger on a gel, as it moved more slowly through the gel matrix. These annealing errors were fixed by preparing another reamplification reaction from the already reamplified library and running it for a single cycle. This single cycle provided primers for proper annealing and amplification, removing the second band (Supplemental Figure 3).
Reamplification of libraries facilitated final library concentrations of at least 10 nM. These concentrations allowed libraries to be diluted to equal molarity and pooled in equal representation, helping to negate issues that would have arisen with unequal sample quality and sequencing library yield. If the goal of a project is chloroplast genome sequencing, then the total amount of sequencing needed will vary as different lineages and tissues differ in the total percent of reads that originate from chloroplast DNA19. Typically, 50&#8211;100x projected coverage of the chloroplast genome is sufficient for assembly, and sequencing runs can be pooled to include as many as 70 individuals depending on species and sequencing method.
Testing for Contamination, Bias and Variation Caused by Reamplification 
A notable concern for HTS sequencing is introduction of bias into libraries through extensive PCR amplification20. To test the effects of reamplification and identify potential bias in common phylogenetic applications of herbarium material, we compared a successfully sequenced library (TK686) with the same library diluted 1:5 and reamplified (designated TK686-R). Both TK686 and TK686-R were sequenced on an Illumina HiSeq4000 at the University of Illinois Roy J. Carver Biotechnology Center and the Michigan State University Research Technology Support Facility, respectively, using paired end 150 base pair reads (see Table 3 for sequencing details). Raw reads have been deposited in the NCBI SRA (SRP128083). Reads were cleaned using Trimmomatic v.0.3621 including adaptor trimming using NEB adaptor sequence, quality filtering for an average phred score of 20 for a 10 base pair sliding window, and a minimum cut off size of 40 base pairs. As one of the primary issues with herbarium specimens is fungal contamination, contamination was estimated by mapping reads against a portion of the JGI MycoCosm fungal genome database22 (312 nuclear genomes and 79 mitochondrial genomes) using bowtie2 v. 2.2.923 using the &#34;very-sensitive-local&#34; parameter set. TK686 and TK686-R libraries were indistinguishable in nuclear fungal contamination (9.24% and 9.68%, respectively) and mitochondrial fungal contamination (0.94% and 0.8%) (Table 3). Though this is only one example, it does suggest that fungal contamination of herbarium samples is not negligible and should be removed prior to using herbarium-derived sequence data. The database and commands used to identify and remove fungal contamination can be found in M. R. McKain&#39;s GitHub repository Herbarium Genomics24.
Chloroplast genome sequencing is commonly used for phylogenetic analyses, and herbarium specimens are increasingly used as source material12. In order to test the fidelity of reamplification in the chloroplast genome assembly, chloroplast genomes for both TK686 and TK686-R were assembled using Fast-Plast v.1.2.525 under default settings with the bowtie index set to Poales. A full chloroplast genome was obtained for TK686-R, but the TK686 chloroplast genome was assembled into seven contigs due to lower read depth. The TK686 contigs were assembled manually following McKain et al.26 Fully assembled chloroplast genomes were aligned to each other in a GUI-based alignment software (see Table of Materials) and variation between assemblies was assessed. A total of 12 SNPs and one indel were identified between chloroplast assemblies for TK686 and TK686-R. For each variant, coverage was assessed in read sets from both TK686 and TK686-R. In all cases, the most common variant was the same between the two libraries. TK686 demonstrated one T&#8594;C, one G&#8594;A, one G&#8594;T, one G&#8594;-, one C&#8594;A, one T&#8594;A, and four C&#8594;A variants. Five of these variants occurred within a homopolymer string, suggesting their incorporation into the assembly may have been the result of sequencing error and low overall coverage. The others may have been the result of either chloroplast haplotype variation, sequencing error, or cytosine deamination, or some combination of these factors. TK686-R had one C&#8594;T, one G&#8594;T, and one A&#8594;G. The C&#8594;T and G&#8594;T variants were found in a homopolymer as above. Ultimately, identical complete chloroplast genomes were identified from both read sets. A single chloroplast genome from TK686 was annotated using Verdant21 and compared to other members of the tribe Andropogoneae. All standard chloroplast features were annotated: 8 rRNAs, 38 tRNAs, and 84 protein coding genes. The complete chloroplast genome is available from GenBank (MF170217) and Verdant27.
Potential bias from the reamplification of the libraries was also determined through estimation of percent GC and total estimated transposon content. Percent GC was estimated using a custom script24. Differences in GC content of the two samples were negligible, with 49.7% GC in TK686 and 51.2% GC in TK686-R. Transposon composition was estimated using Transposome28. For both libraries, 100,000 reads were randomly subsampled and transposon composition was estimated using a percent identity of 90, a fraction coverage of 0.55, a cluster size of 100, and the RepBase 21.10 grass repeat reference set29. This was repeated 100 times to perform bootstrapping on transposon estimation from these datasets. Total genome percentages for major subfamilies of transposons were extracted from Transposome output, and the mean and standard deviation of these for the 100 replicates were estimated. All scripts used to generate these outputs can be found in M. R. McKain&#39;s Github repository Transposons30, and all results have been deposited in Dryad (doi:10.5061/dryad.r8t2m). Using the two most prevalent transposon subfamilies as indicators (Copia and Gypsy long terminal repeat retrotransposons), the results were nearly identical with Copia at 33.52 &#177; 4.00% and 31.68 &#177; 2.94% and Gypsy at 24.83 &#177; 2.72% and 24.00 &#177; 2.35% in TK686 and TK686-R, respectively (Table 3). These test results suggest that the reamplification step of this protocol did not create meaningful sequencing bias for high-level genome metrics. However, it should be noted that this single example may not be fully representative of all reamplified libraries. This single test demonstrates that the reamplification step was not inherently biasing genome metrics in TK686/TK686-R. Introduced bias would not affect the assembly of a chloroplast genome given sufficient coverage of sequencing, but it is recommended that experiments, as presented in this study with TK686/TK686-R, are conducted on target lineages to verify that bias is not occurring during studies investigating transposable element diversity.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56837/56837fig1.jpg" /> 
Figure 1: Agarose gel images of A) DNA isolation and B) final sequencing libraries from ten herbarium specimens. For each lane, 3 &#181;L of DNA or library was used. (A) DNA was degraded in all herbarium isolations as seen by the general smear. (B) Final sequencing libraries depict a primary band of 300-500 base pairs with a wider distribution of 200-1,000 base pairs; the latter is more prevalent in reamplified libraries. Lanes for both (A) and (B) were identified by sample and can be compared to results in Table 2. Ladder size was depicted in base pairs (bp). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/56837fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56837/56837fig2v2.jpg" /> 
Figure 2: Circular plot of Schizachyrium scoparium (TK686) chloroplast genome with annotation. The fully assembled genome from shotgun sequencing of herbarium-derived DNA exhibited a total length of 139,296 base pairs (bp), a large single copy region (LSC) of 81,401 bp, an inverted repeat region (IR) of 22,669 bp, and a small single copy region (SSC) of 12,557 bp. All standard protein-coding genes, tRNAs, and rRNAs for members of the Andropogoneae tribe were identified in the annotation. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/56837fig2v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 2: DNA extraction and library preparation results for ten herbarium samples and four reamplified libraries. The total double stranded DNA at various steps in the protocol demonstrated how variable quality can be, especially when filtered for size. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/Table 2.xlsx" target="_blank">Please click here to download this table.</a>
Table 3: Sequencing statistics for TK686 and the reamplified TK686R. Reamplification does not affect the overall incidence of fungal genome contamination, GC content estimation, transposon composition estimation, or the ability to assemble whole chloroplast genomes. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/Table3_Sequencing_Statistics_TK686.xlsx" target="_blank">Please click here to download this table.</a>
Supplemental Table 1: DNA extraction and library preparation results for forty additional herbarium samples, including twenty reamplified libraries. Total double stranded DNA at various steps in the protocol demonstrated how variable quality can be, especially when filtered for size. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/Supplemental_Table1_Data.xlsx" target="_blank">Please click here to download this table.</a>
Supplemental Figure 1: Agarose gel images of forty additional DNA isolations from herbarium specimens. Both (A) and (B) depict twenty separate DNA isolations and demonstrate the characteristic degradation of herbarium-derived DNA. For each lane, 3 &#181;L of DNA was used. Lanes for both (A) and (B) were identified by sample and can be compared to results in Supplemental Table 1. Ladder size is depicted in base pairs (bp). White flecks on the image are due to artefacts in the gel imager that could not be removed with cleaning. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/Supplmental_Figure1_DNA_Isolation.pdf" target="_blank">Please click here to download this figure.</a>
Supplemental Figure 2: Agarose gel images of forty additional sequencing libraries from herbarium-derived DNA. For each lane, 3 &#181;L of library was used. Final sequencing libraries are found in both (A) and (B) with an average size of 300-500 base pairs. Secondary bands seen in some amplified samples suggest &#34;bubbling&#34; of libraries. Lanes for both (A) and (B) are identified by sample and can be compared to results in Supplemental Table 1. Ladder size is depicted in base pairs (bp). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/Supplemental_Figure_2_Library_Prep.pdf" target="_blank">Please click here to download this figure.</a>
Supplemental Figure 3: Agarose gel image of secondary band removal with an additional single cycle PCR step.&#160;<a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56837/Supplmental_Figure3_Single_Cycle_Clean.pdf" target="_blank">Please click here to download this figure.</a>

Watch this Scientific Journal Video about Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens at JoVE.com

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

robust-dna-isolation-high-throughput-sequencing-library-construction

Nanyang Technological University

Research

JoVE Journal

Genetics

10.5K Views.  Donald Danforth Plant Science Center. This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Video: Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

A Robotic Platform for High-throughput Protoplast Isolation and Transformation

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal transduction pathways, transcriptional regulatory networks, gene expression, genome-editing, and gene-silencing. Furthermore, significant progress has been made in the regeneration of plants from protoplasts, which has generated even more interest in the use of these systems for plant genomics. In this work, a protocol has been developed for automation of protoplast isolation and transformation from a &#39;Bright Yellow&#39; 2 (BY-2) tobacco suspension culture using a robotic platform. The transformation procedures were validated using an orange fluorescent protein (OFP) reporter gene (pporRFP) under the control of the Cauliflower mosaic virus 35S promoter (35S). OFP expression in protoplasts was confirmed by epifluorescence microscopy. Analyses also included protoplast production efficiency methods using propidium iodide. Finally, low-cost food-grade enzymes were used for the protoplast isolation procedure, circumventing the need for lab-grade enzymes that are cost-prohibitive in high-throughput automated protoplast isolation and analysis. Based on the protocol developed in this work, the complete procedure from protoplast isolation to transformation can be conducted in under 4 hr, without any input from the operator. While the protocol developed in this work was validated with the BY-2 cell culture, the procedures and methods should be translatable to any plant suspension culture/protoplast system, which should enable acceleration of crop genomics research.

A high-throughput, automated, tobacco protoplast production and transformation methodology is described. The robotic system enables massively parallel gene expression and discovery in the model BY-2 system that should be translatable to non-model crops.

Over the last decade there has been a resurgence in the use of plant protoplasts that range from model species to crop species, for analysis of signal ...

Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing

The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 &#181;g DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., &#62; 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

Described here is a method for the extraction, purification, and quality control of genomic DNA from the obligate biotrophic fungal pathogen, powdery mildew, for use in long-read genome sequencing.

The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment. 
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.

Methods for generating large-scale gRNA libraries should be simple, efficient and cost-effective. We describe a protocol for the production of gRNA libraries based on enzymatic digestion of target DNA. This method, CORALINA (comprehensive gRNA library generation through controlled nuclease activity) presents an alternative to costly custom oligonucleotide synthesis.

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have been directed toward elucidation of the location and timing of initiation of genome duplication rather than its completion. However, it is critical that we understand regions of the genome that are last to complete replication, because these regions suffer elevated levels of chromosomal breakage and mutation, and they have been associated with both disease and aging. Here we describe how we have extended a technique that has been used to monitor replication initiation to instead identify those regions of the genome last to complete replication. This approach is based on a combination of flow cytometry and high throughput sequencing. Although this report focuses on the application of this technique to yeast, the approach can be used with any cells that can be sorted in a flow cytometer according to DNA content.

We describe a technique for combining flow cytometry and high throughput sequencing to identify late replicating regions of the genome.

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Retrospective MicroRNA Sequencing: Complementary DNA Library Preparation Protocol Using Formalin-fixed Paraffin-embedded RNA Specimens

&#8211;Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of cancer development. By using non-invasive or pre-malignant lesions from patients who later develop invasive disease, gene expression analyses may help identify early molecular alterations that predispose to cancer risk. It has been well described that nucleic acids recovered from FFPE tissues have undergone severe physical damage and chemical modifications, which make their analysis difficult and generally requires adapted assays. MicroRNAs (miRNAs), however, which represent a small class of RNA molecules spanning only up to ~18&#8211;24 nucleotides, have been shown to withstand long-term storage and have been successfully analyzed in FFPE samples. Here we present a 3&#39; barcoded complementary DNA (cDNA) library preparation protocol specifically optimized for the analysis of small RNAs extracted from archived tissues, which was recently demonstrated to be robust and highly reproducible when using archived clinical specimens stored for up to 35 years. This library preparation is well adapted to the multiplex analysis of compromised/degraded material where RNA samples (up to 18) are ligated with individual 3&#39; barcoded adapters and then pooled together for subsequent enzymatic and biochemical preparations prior to analysis. All purifications are performed by polyacrylamide gel electrophoresis (PAGE), which allows size-specific selections and enrichments of barcoded small RNA species. This cDNA library preparation is well adapted to minute RNA inputs, as a pilot polymerase chain reaction (PCR) allows determination of a specific amplification cycle to produce optimal amounts of material for next-generation sequencing (NGS). This approach was optimized for the use of degraded FFPE RNA from specimens archived for up to 35 years and provides highly reproducible NGS data.

Formalin-fixed paraffin-embedded specimens represent a valuable source of molecular biomarkers of human diseases. Here we present a laboratory-based cDNA library preparation protocol, initially designed with fresh frozen RNA, and optimized for the analysis of archived microRNAs from tissues stored up to 35 years.

&#8211;Archived, clinically classified formalin-fixed paraffin-embedded (FFPE) tissues can provide nucleic acids for retrospective molecular studies of ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Ultralow Input Genome Sequencing Library Preparation from a Single Tardigrade Specimen

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state when water is supplied. The genomic sequencing of microscopic animals such as tardigrades risks bacterial contamination that sometimes leads to erroneous interpretations, for example, regarding the extent of horizontal gene transfer in these animals. Here, we provide an ultralow input method to sequence the genome of the tardigrade, Hypsibius dujardini, from a single specimen. By employing rigorous washing and contaminant exclusion along with an efficient extraction of the 50 ~ 200 pg genomic DNA from a single individual, we constructed a library sequenced with a DNA sequencing instrument. These libraries were highly reproducible and unbiased, and an informatics analysis of the sequenced reads with other H. dujardini genomes showed a minimal amount of contamination. This method can be applied to unculturable tardigrades that could not be sequenced using previous methods.

Contamination during the genomic sequencing of microscopic organisms remains a large problem. Here, we show a method to sequence the genome of a tardigrade from a single specimen with as little as 50 pg of genomic DNA without whole genome amplification to minimize the risk of contamination.

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state ...

High-throughput DNA Extraction and Genotyping of 3dpf Zebrafish Larvae by Fin Clipping

Zebrafish (Danio rerio) possess orthologues for 84% of the genes known to be associated with human diseases. In addition, these animals have a short generation time, are easy to handle, display a high reproductive rate, low cost, and are easily amenable to genetic manipulations by microinjection of DNA in embryos. Recent advances in gene editing tools are enabling precise introduction of mutations and transgenes in zebrafish. Disease modeling in zebrafish often leads to larval phenotypes and early death which can be challenging to interpret if genotypes are unknown. This early identification of genotypes is also needed in experiments requiring sample pooling, such as in gene expression or mass spectrometry studies. However, extensive genotypic screening is limited by traditional methods, which in most labs are performed only on adult zebrafish or in postmortem larvae. We addressed this problem by adapting a method for the isolation of PCR-ready genomic DNA from live zebrafish larvae that can be achieved as early as 72 h post-fertilization (hpf). This time and cost-effective technique, improved from a previously published genotyping protocol, allows the identification of genotypes from microscopic fin biopsies. The fins quickly regenerate as the larvae develop. Researchers are then able to select and raise the desired genotypes to adulthood by utilizing this high-throughput PCR-based genotyping procedure.

Zebrafish have been used as reliable genetic model organisms in biomedical research, especially with the advent of gene-editing technologies. When larval phenotypes are expected, DNA extraction and genotype identification can be challenging. Here, we describe an efficient genotyping procedure for zebrafish larvae, by tail clipping, as early as 72-h post-fertilization.

Zebrafish (Danio rerio) possess orthologues for 84% of the genes known to be associated with human diseases. In addition, these animals have a short ...