Financial support for this study was provided by the National Key Research and Development Program (2016YFC1200601) and the National Natural Science Foundation of China (31390421).

1. Whitefly Rearing and Cryptic Species Identification
<ol>
	<li>Maintain the whitefly species on cotton Gossypium hirsutum (Malvaceae) (cv. Zhe-Mian 1973) in cages under standard conditions of 27 &#177; 1 &#176;C, 70 &#177; 10% humidity and 14 h light: 10 h dark regime.</li>
	<li>Collect an individual adult whitefly and homogenize in 30 &#181;L of lysis buffer (10 mM Tris, pH 8.4, 50 mM KCl, 0.45% [wt/vol] Tween-20, 0.2% [wt/vol] gelatin, 0.45% [vol/vol] Nonidet P 40, 60 g/mL Proteinase K).</li>
	<li>Incubate the homogenate at 65 &#176;C for 1 h and then 100 &#176;C for 10 min. 
	NOTE: The incubation time at 65 &#176;C can be increased if necessary. The incubation time at 100 &#176;C should be critically controlled to sufficiently inactivate Proteinase K and avoid DNA damage.</li>
	<li>Perform polymerase chain reaction (PCR) using whitefly DNA (acquired in section 1.3) based on mitochondrial cytochrome oxidase I primers. 
	COI-F: 5&#39;-TTGATTTTTTGGTCATCCAGAAGT-3&#39; 
	COI-R: 5&#39;-TAATATGGCAGATTAGTGCATTGGA-3&#39;
	<ol>
		<li>Perform the PCR reactions in a final volume of 25 &#181;L containing 1 U of Taq DNA polymerase, 2.5 &#181;L 10x Buffer, 0.2 mM dNTP, 0.2 mM of each primer and 2 &#181;L of whitefly DNA.</li>
		<li>Use the following PCR procedure conditions: initial denaturation 95 &#176;C for 3 min followed by 35 cycles of 95 &#176;C for 45 s (denaturation), 50 &#176;C for 45 s (annealing) and 72 &#176;C for 1 min (extension) and another 10 min at 72 &#176;C for further extension.</li>
	</ol>
	</li>
	<li>Clean the PCR amplified product using a DNA gel extraction kit with the recommended protocol.</li>
	<li>Sequence the purified DNA samples with a DNA sample sequencing system following the manufacturer&#39;s instruction.</li>
	<li>Analyze the sequences using the Basic Local Alignment Search Tool (BLAST) to identify the cryptic species of whitefly and avoid contamination of other species.</li>
</ol>
2. Endosymbiont Identification and Localization
<ol>
	<li>Perform PCR on the whitefly DNA (acquired in Step 1.3) to amplify the specific genes of each endosymbiont within the whitefly (the PCR recipe is described in section 1.4, and PCR procedures and primers are listed in Table 1).</li>
	<li>Subject the amplified sample to agarose gel electrophoresis according to previously published protocol20 (1% agarose gel, Tris-acetate-EDTA as running buffer, voltage 5 V/cm) to identify the specific gene of each bacterium.</li>
	<li>Recover and sequence each band to determine the bacterial species within whitefly (see sections 1.5-1.7).</li>
	<li>Perform fluorescence in situ hybridizations (FISH) on whiteflies to identify the location of endosymbionts according to previously published protocol19. 
	NOTE: Increase the concentration of the fluorescent probes if necessary.</li>
</ol>
3. Transmission Electron Microscopy (TEM)
<ol>
	<li>Immerse and fix whiteflies in phosphate buffer (0.1 M, pH 7.0) containing 2.5% [vol/vol] glutaraldehyde for 4 h.</li>
	<li>Wash the samples in phosphate buffer (0.1 M, pH 7.0) three times, 15 min each time.</li>
	<li>Immerse and fix the samples again in phosphate buffer (0.1 M, pH 7.0) containing 1% [wt/vol] OsO4 for 2 h.</li>
	<li>Dehydrate the samples by a graded series of ethanol (30%, 50%, 70%, 80%, 90%, 95% and 100%), 15 min each time.</li>
	<li>Transfer and immerse the samples into 100% acetone for 20 min.</li>
	<li>Place the samples in mixture of 100% acetone and 100% Spurr resin (1:1) for 1 h at room temperature.</li>
	<li>Transfer the samples to mixture of 100% acetone and 100% Spurr resin (1:3) for 3 h at room temperature.</li>
	<li>Transfer and immerse the samples into 100% Spurr resin (incubated at 70 &#176;C) for more than 9 h.</li>
	<li>Section the whitefly samples by using a microtome.</li>
	<li>Stain the ultra-thin films (acquired in section 3.9) by immersion in absolute uranyl acetate for 5-10 min, followed by immersion in 50% alkaline lead citrate for another 5-10 min. 
	NOTE: The volumes of reagents utilized in section 3.1-3.10 depend on the samples. Make sure the samples are immersed in the reagents.</li>
	<li>Observe samples under transmission electron microscopy (15,000X) to determine the localization, shape and size of bacteria for further use (see section 4.6).</li>
</ol>
4. Whitefly Bacteriome Dissection and Purification
<ol>
	<li>Add 100 &#181;L of 1x PBS solution onto a microscope slide. Pick some 3rd or 4th instar nymphs from cotton leaves and immerse them into the PBS solution.</li>
	<li>Use fine entomological needles under a stereomicroscope and pull the bacteriomes out from the whitefly body.
	<ol>
		<li>Gently cut a hole on one side of the nymph, and slightly press the other side to let the bacteriomes out.</li>
	</ol>
	</li>
	<li>Mount a 20 &#181;L microloader (with the leading end cut to meet the size of bacteriome) on a 0.5-10 &#181;L pipette. Extract the individual bacteriome out of the PBS solution into the microloader.</li>
	<li>Wash the bacteriome to eliminate the contamination of other whitefly tissues by pipetting the bacteriome into the PBS solution and extracting the bacteriome. Repeat three times.</li>
	<li>Immediately pipette the washed bacteriome into a centrifuge tube containing 60 &#181;L of 1x PBS solution.</li>
	<li>Syringe-filter the assembled bacteriome through a 5 &#181;m filter membrane (determined by sizes of bacteria and nucleus of bacteriocyte in whitefly). Repeat multiple times to move the mixed liquid through the filter membrane thoroughly. 
	NOTE: To achieve a better result of amplification and sequencing, assemble over 100 bacteriomes. Wet the filter membrane first by using 1x PBS solution to decrease the loss of bacteria binding to the membrane.</li>
</ol>
5. Amplification of Endosymbiont Genomes
<ol>
	<li>Amplify the filtrate (mainly containing endosymbionts of the whitefly) using a DNA amplification kit by the recommended protocol with some modification.
	<ol>
		<li>Choose the recommended protocol of amplification of genomic DNA from blood or cells and prepare buffer D2 for subsequent experiment.</li>
		<li>Directly add 1.5 &#181;L of filtrate (see section 4.6) to the centrifuge tube, followed by 1.5 &#181;L of the Buffer D2 and mix well.</li>
		<li>Incubate on ice for 10 min and add 1.5 &#181;L of the stop solution.</li>
		<li>Add 15 &#181;L of the reaction buffer and 1 &#181;L of the DNA polymerase and mix gently.</li>
		<li>Incubate the mixture at 30 &#176;C for 16 h, followed by 3 min at 65 &#176;C.</li>
	</ol>
	</li>
	<li>Perform PCR directly on the amplified filtrate (dilute the amplified samples if necessary) by using specific primers designed for bacteria to confirm the bacteria species (see section 2.1).</li>
	<li>Conduct PCR to confirm whether there is contamination of host genome by using whitefly gene beta-Actin and EF1 primers according to previously published method21 (the PCR recipe is described in section 1.4).</li>
</ol>
6. Endosymbiont Metagenome Sequencing
<ol>
	<li>Subject the amplified filtrate to a spectrophotometer and a fluorometer (according to the manufacturer&#39;s instructions) before sequencing to test the quality of samples and whether the samples meet the criteria for sequencing.</li>
	<li>Subject the amplified to a genome sequencer according to the manufacturer&#39;s instructions.</li>
</ol>

<ol><li>Buchner, P. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1002/jobm.19670070219/abstract">Endosymbiosis of animals with plant microorganisms.</a> J. Basic Microbiol. 7 (2), Interscience. New York. (1967).</li>
<li>Sloan, D. B., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Endosymbiotic+bacteria+as+a+source+of+carotenoids+in+whiteflies%5BTitle%5D)+AND+%22Biol.+Letters%22%5BJournal%5D)">Endosymbiotic bacteria as a source of carotenoids in whiteflies.</a> Biol. Letters. 8 (6), 986-989 (2012).</li>
<li>Stouthamer, R., Breeuwer, J. A., Hurst, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wolbachia+pipientis%3A+microbial+manipulator+of+arthropod+reproduction%5BTitle%5D)+AND+%22Annu.+Rev.+Microbiol%22%5BJournal%5D)">Wolbachia pipientis: microbial manipulator of arthropod reproduction.</a> Annu. Rev. Microbiol. 53, 71-102 (1999).</li>
<li>Brumin, M., Kontsedalov, S., Ghanim, M. <a target="_blank" href="http://onlinelibrary.wiley.com/doi/10.1111/j.1744-7917.2010.01396.x/abstract">Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype.</a> Insect Sci. 18 (1), 57-66 (2011).</li>
<li>Hansen, A. K., Degnan, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Widespread+expression+of+conserved+small+RNAs+in+small+symbiont+genomes%5BTitle%5D)+AND+%22ISME+J%22%5BJournal%5D)">Widespread expression of conserved small RNAs in small symbiont genomes.</a> ISME J. 8, 2490-2502 (2014).</li>
<li>Moran, N. A., McCutcheon, J. P., Nakabachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomics+and+evolution+of+heritable+bacterial+symbionts%5BTitle%5D)+AND+%22Annu.+Rev.+Genet%22%5BJournal%5D)">Genomics and evolution of heritable bacterial symbionts.</a> Annu. Rev. Genet. 42, 165-190 (2008).</li>
<li>Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., Ishikawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+sequence+of+the+endocellular+bacterial+symbiont+of+aphids+Buchnera+sp.+APS%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS.</a> Nature. 407, 81-86 (2000).</li>
<li>Nikoh, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+origin+of+insect-Wolbachia+nutritional+mutualism%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.+S.+A%22%5BJournal%5D)">Evolutionary origin of insect-Wolbachia nutritional mutualism.</a> Proc. Natl. Acad. Sci. U. S. A. 111 (28), 10257-10262 (2014).</li>
<li>Sloan, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Parallel+histories+of+horizontal+gene+transfer+facilitated+extreme+reduction+of+endosymbiont+genomes+in+sap-feeding+insects%5BTitle%5D)+AND+%22Mol.+Biol.+Evol%22%5BJournal%5D)">Parallel histories of horizontal gene transfer facilitated extreme reduction of endosymbiont genomes in sap-feeding insects.</a> Mol. Biol. Evol. 31 (4), 857-871 (2014).</li>
<li>Xue, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomes+of+the+rice+pest+brown+planthopper+and+its+endosymbionts+reveal+complex+complementary+contributions+for+host+adaptation%5BTitle%5D)+AND+%22Genome+Biol%22%5BJournal%5D)">Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation.</a> Genome Biol. 15 (12), 521(2014).</li>
<li>Campbell, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+expansion+via+lineage+splitting+and+genomereduction+in+the+cicada+endosymbiont+Hodgkinia%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.+S.+A%22%5BJournal%5D)">Genome expansion via lineage splitting and genomereduction in the cicada endosymbiont Hodgkinia.</a> Proc. Natl. Acad. Sci. U. S. A. 112 (33), 10192-10199 (2015).</li>
<li>Wilson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genomic+insight+into+the+amino+acid+relations+of+the+pea+aphid%2C+Acyrthosiphon+pisum%2C+with+its+symbiotic+bacterium+Buchnera+aphidicola%5BTitle%5D)+AND+%22Insect+Mol.+Biol%22%5BJournal%5D)">Genomic insight into the amino acid relations of the pea aphid, Acyrthosiphon pisum, with its symbiotic bacterium Buchnera aphidicola.</a> Insect Mol. Biol. 19, 249-258 (2010).</li>
<li>Degnan, P. H., Ochman, H., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sequence+conservation+and+functional+constraint+on+intergenic+spacers+in+reduced+genomes+of+the+obligate+symbiont+Buchnera%5BTitle%5D)+AND+%22PLoS+Genet%22%5BJournal%5D)">Sequence conservation and functional constraint on intergenic spacers in reduced genomes of the obligate symbiont Buchnera.</a> PLoS Genet. 7 (9), e1002252(2011).</li>
<li>Nakabachi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+160-kilobase+genome+of+the+bacterial+endosymbiont+Carsonella%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The 160-kilobase genome of the bacterial endosymbiont Carsonella.</a> Science. 314 (5797), 267(2006).</li>
<li>De Barro, P. J., Liu, S. S., Boykin, L. M., Dinsdale, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bemisia+tabaci%3A+a+statement+of+species+status%5BTitle%5D)+AND+%22Annu.+Rev.+Entomol%22%5BJournal%5D)">Bemisia tabaci: a statement of species status.</a> Annu. Rev. Entomol. 56, 1-19 (2011).</li>
<li>Himler, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+spread+of+a+bacterial+symbiont+in+an+invasive+whitefly+is+driven+by+fitness+benefits+and+female+bias%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias.</a> Science. 332 (6026), 254-256 (2011).</li>
<li>Bing, X. L., Ruan, Y. M., Rao, Q., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Diversity+of+secondary+endosymbionts+among+different+putative+species+of+the+whitefly+Bemisia+tabaci%5BTitle%5D)+AND+%22Insect+Sci%22%5BJournal%5D)">Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci.</a> Insect Sci. 20 (2), 194-206 (2013).</li>
<li>Bing, X. L., Yang, J., Zchori-Fein, E., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+a+newly+discovered+symbiont+of+the+whitefly+Bemisia+tabaci+%28Hemiptera%3A+Aleyrodidae%29%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae).</a> Appl. Environ. Microbiol. 79 (2), 569-575 (2013).</li>
<li>Kliot, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fluorescence+in+situ+hybridizations+%28FISH%29+for+the+localization+of+viruses+and+endosymbiotic+bacteria+in+plant+and+insect+tissues%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues.</a> J. Vis. Exp. (84), e51030(2014).</li>
<li>Lee, P. Y., Costumbrado, J., Hsu, C., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923(2012).</li>
<li>Rao, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome+reduction+and+potential+metabolic+complementation+of+the+dual+endosymbionts+in+the+whitefly+Bemisia+tabaci%5BTitle%5D)+AND+%22BMC+Genomics%22%5BJournal%5D)">Genome reduction and potential metabolic complementation of the dual endosymbionts in the whitefly Bemisia tabaci.</a> BMC Genomics. 16 (1), 226(2015).</li>
<li>Thao, L. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li>
<li>Zhu, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sequencing+and+comparison+of+the+Rickettsia+genomes+from+the+whitefly+Bemisia+tabaci+Middle+East+Asia+Minor+I%5BTitle%5D)+AND+%22Insect+Sci%22%5BJournal%5D)">Sequencing and comparison of the Rickettsia genomes from the whitefly Bemisia tabaci Middle East Asia Minor I.</a> Insect Sci. 23 (4), 531-542 (2016).</li>
<li>Gottlieb, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Identification+and+localization+of+a+Rickettsia+sp.+in+Bemisia+tabaci+%28HomopteraAleyrodidae%29%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Identification and localization of a Rickettsia sp. in Bemisia tabaci (HomopteraAleyrodidae).</a> Appl. Environ. Microbiol. 72 (5), 3646-3652 (2006).</li>
<li>Zhang, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Differential+temporal+changes+of+primary+and+secondary+bacterial+symbionts+and+whitefly+host+fitness+following+antibiotic+treatments%5BTitle%5D)+AND+%22Sci.+Rep%22%5BJournal%5D)">Differential temporal changes of primary and secondary bacterial symbionts and whitefly host fitness following antibiotic treatments.</a> Sci. Rep. 5, 15898(2015).</li>
<li>Shan, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Temporal+changes+of+symbiont+density+and+host+fitness+after+rifampicin+treatment+in+a+whitefly+of+the+Bemisia+tabaci+species+complex%5BTitle%5D)+AND+%22Insect+Sci%22%5BJournal%5D)">Temporal changes of symbiont density and host fitness after rifampicin treatment in a whitefly of the Bemisia tabaci species complex.</a> Insect Sci. 23 (2), 200-214 (2016).</li>
<li>Zchori-Fein, E., Brown, J. K. <a target="_blank" href="http://www.bioone.org/doi/abs/10.1603/0013-8746(2002)095%5B0711:DOPAWB%5D2.0.CO%3B2">Diversity of prokaryotes asscociated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae).</a> Ann. Entomol. Soc. Am. 95 (6), 711-718 (2002).</li>
<li>Thao, M. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts%5BTitle%5D)+AND+%22Appl.+Environ.+Microbiol%22%5BJournal%5D)">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li>
<li>Zchori-Fein, E., Perlman, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Distribution+of+the+bacterial+symbiont+Cardinium+in+arthropods%5BTitle%5D)+AND+%22Mol.+Ecol%22%5BJournal%5D)">Distribution of the bacterial symbiont Cardinium in arthropods.</a> Mol. Ecol. 13 (7), 2009-2016 (2004).</li>
<li>O'Neill, S. L., Giordano, R., Colbert, A. M., Karr, T. L., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((116S+rRNA+phylogenetic+analysis+of+the+bacterial+endosymbionts+associated+with+cytoplasmic+incompatibility+in+insects%5BTitle%5D)+AND+%22Proc.+Natl.+Acad.+Sci.+U.+S.+A%22%5BJournal%5D)">116S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.</a> Proc. Natl. Acad. Sci. U. S. A. 89 (7), 2699-2702 (1992).</li>
<li>Nirgianaki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Wolbachia+infections+of+the+whitefly+Bemisia+tabaci%5BTitle%5D)+AND+%22Curr.+Microbiol%22%5BJournal%5D)">Wolbachia infections of the whitefly Bemisia tabaci.</a> Curr. Microbiol. 47 (2), 93-101 (2003).</li>
<li>Everett, K. D., Thao, M. L., Horn, M., Dyszynski, G. E., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+chlamydiae+in+whiteflies+and+scale+insects%3A+endosymbionts+%27Candidatus+Fritschea+bemisiae%27+strain+Falk+and+%27Candidatus+Fritschea+eriococci%27+strain+Elm%5BTitle%5D)+AND+%22Int.+J.+Syst.+Evol.+Micr%22%5BJournal%5D)">Novel chlamydiae in whiteflies and scale insects: endosymbionts 'Candidatus Fritschea bemisiae' strain Falk and 'Candidatus Fritschea eriococci' strain Elm.</a> Int. J. Syst. Evol. Micr. 55, 1581-1587 (2005).</li>
</ol>

The authors have nothing to disclose.

Since the endosymbionts within whiteflies cannot be cultured in vitro, dissection and assembling bacteriocytes is an effective way to obtain enough genetic material of endosymbionts. Before dissection, the species of whitefly and endosymbionts involved should be explicitly confirmed. The whitefly B. tabaci is a species complex with more than 35 morphologically indistinguishable species and different cryptic species may contain different endosymbionts. Portiera is uniformly harbored as an obligate symbiont22, and secondary symbionts vary among species, even the individual whitefly17,21,23. Moreover, although many endosymbionts have been proven to be restrained within bacteriocytes, some may be distributed in the entire body of the whitefly24. Thus, analyzing the localization of different endosymbionts by FISH and TEM is necessary before bacteriome dissection. 
For bacteriome dissection and any subsequent operations, the utilized materials must be strictly sterile to eliminate possible contamination of other bacteria, particularly the PBS solution, the filtration equipment, and the centrifuge tubes. Special care should be taken when filtering the PBS solution containing the bacteriomes to avoid environmental contamination. It is best to use a relatively aseptic environment. In addition, whitefly nymphs can be stored in absolute ethanol at room temperature before dissection, which may be useful to send samples to other places. Nevertheless, dead or environmental stress treated insects should not be used because there would be declination of bacteria25,26. 
In this protocol, the 3rd or 4th instar nymphs were utilized to isolate bacteriome. Compared to other stages of the whitefly, there are several advantages of using the 3rd or 4th instar nymphs for dissection. Firstly, compared to the 1st and 2nd instar nymphs, whiteflies in this stage are obviously larger and not so fragile. Secondly, in the 3rd or 4th instar nymphs of whitefly, bacteriome can be easily distinguished from other tissues of the whitefly body with an obviously yellow color, and bacteriocytes always cluster firmly and can be conveniently separated from other tissues. For the bacteriome in adult whiteflies, once pulled out from the body, bacteriocytes would separate quite easily thus increasing the difficulty in assembly. Hence, the best choice for dissecting bacteriomes is the 3rd or 4th instar nymphs. Nevertheless, this protocol can be used with adult whiteflies for certain experiment needs, with more practice. 
Compared to a previously published method using a single bacteriocyte21, this protocol assembled more bacteriocytes used in the amplification, which contributed to the richness and diversity of bacteriocytes. Furthermore, we utilized filtration to separate symbiont cells from whitefly bacteriocytes, which is more convenient than another method using a micromanipulator and a microinjector. Nevertheless, there were some limitations of this protocol. Firstly, symbionts not confined to bacteriocytes cannot be separated by this method, since we only dissect the bacteriome of the whitefly. Secondly, this protocol cannot absolutely eliminate the contamination of the whitefly genome, since some fragments of whitefly tissues would pass through the filter membrane. Thirdly, clustered symbionts cannot be further separated into individual symbiont species. Hence, obtaining a single species of bacterium accurately and purely requires further study.
In summary, we reported a convenient method for the extraction and purification of endosymbionts from the whitefly B. tabaci that is suitable for subsequent sequencing and analysis. The protocol described here can be easily adapted for the isolation of endosymbionts from other insects for genome sequencing.

Bacteria forming an intimate symbiotic relationship with relative hosts are widespread in arthropods1. The endosymbionts have been demonstrated to affect aspects of hosts, such as nutrition metabolism, reproduction, responses to environmental stresses2,3,4 etc., in almost every developmental stage5. However, the mechanism underpinning the associations still remains largely unknown. Genomics is of priority and importance when studying the potential functions and roles of bacteria. Some fundamental information, i.e. the taxonomic status, functional genes, metabolism pathways, secretion systems, can be inferred from genome sequences, which sheds lights on the potential roles of symbionts in symbiosis. With the development of high-throughput sequencing, a vast number of bacterial genomes have been sequenced with diverse functions revealed6.
Endosymbionts are of vital importance in hemipterans, such as aphids7, bedbugs8, psyllids9, brown planthoppers10 and cicadas11. For instance, Buchnera in aphids, as the obligate symbiont, has been demonstrated to be involved in essential amino acids biosynthesis, along with the genes from aphid genome12. Furthermore, transcriptional regulation of Buchnera is also revealed13. In psyllids, Carsonella is sequenced and ranked the smallest bacterial genome ever found14. All these hallmarks of endosymbionts are based and inferred from the genome sequences. Because these endosymbionts cannot be cultured in vitro, several approaches have been applied to isolate adequate bacteria for sequencing. In aphids, endosymbionts are extracted through centrifugation and filtration, and subjected to further genomic and transcriptomic analysis5. In brown planthoppers, endosymbionts are sequenced along with the whole insect genome10.
Whitefly B. tabaci is a species complex containing more than 35 morphologically indistinguishable species (cryptic species), among which, two invasive species have invaded all over the world and caused tremendous harm to agricultural production15. Of note, endosymbionts within the B. tabaci species have shown importance in the development of the pests16. To date, eight endosymbionts have been identified in the whitefly, including the obligate symbiont, Candidatus Portiera aleyrodidarum, and seven secondary symbionts Hamiltonella, Rickettsia, Arsenophonus, Cardinium, Wolbachia, Fritschea and Hemipteriphilus defined17,18.
Unlike the hemipterans described previously, the whitefly B. tabaci is an extremely tiny insect only 1 mm in length. Most endosymbionts are confined to bacteriocytes19 (specialized cells containing symbionts, which further form bacteriome in B. tabaci). In addition, these endosymbionts cannot be cultured in vitro. The only way to obtain endosymbionts from B. tabaci is to dissect the bacteriome out. However, there is difficulty in the dissection. First, the fragile bacteriome always links with other tissues of the whitefly, which is hard to separate. Secondly, the tiny size of the whitefly limits the isolation of enough bacteriome. Thirdly, endosymbionts cluster in the bacteriome, making it extremely complicated to acquire a single species of bacterium.
Here, we report a simple and inexpensive protocol to isolate whitefly endosymbionts for subsequent metagenome sequencing. Through dissection, purification and amplification, adequate endosymbiont DNA could be obtained and the species of bacteria could be confirmed. The described protocol can be used similarly in other arthropods.

<table><tbody><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA polymerase</td><td>Takara</td><td>R001A</td><td>including rTaq, 10&amp;times;Buffer and dNTP</td></tr><tr><td>Gel DNA extraction kit</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>DNA sample sequencing system</td><td>ABI</td><td>ABI-3730XL</td><td></td></tr><tr><td>Microtome</td><td>Leica</td><td>EM UC7</td><td></td></tr><tr><td>Transmission electron microscopy</td><td>Hitachi</td><td>H-7650 TEM</td><td></td></tr><tr><td>Stereo microscope</td><td>Zeiss</td><td>Stemi 2000-C</td><td></td></tr><tr><td>20 &amp;mu;L microloader</td><td>Eppendorf</td><td>F2771951</td><td></td></tr><tr><td>Filter holder</td><td>Millipore</td><td>SX0001300</td><td></td></tr><tr><td>Filter membrane filter</td><td>Millipore</td><td>SMWP001300</td><td>5.0 &amp;mu;m SMWP</td></tr><tr><td>REPLI-g UltraFast Mini Kit</td><td>Qiagen</td><td>150033</td><td>DNA amlification kit</td></tr><tr><td>NanoDrop</td><td>Thermo Scientific</td><td>NanoDrop 2000</td><td></td></tr><tr><td>Qubit Fluorometer</td><td>Thermo Fisher Scientific</td><td>Q33216</td><td></td></tr><tr><td>Genome Sequencer</td><td>Illumina</td><td>Hiseq 2000</td><td></td></tr></tbody></table>

methods for the extraction of endosymbionts from the whitefly bemisia tabaci

Bacterial symbionts form an intimate relationship with their hosts and confer advantages to the hosts in most cases. Genomic information is critical to study the functions and evolution of bacterial symbionts in their host. As most symbionts cannot be cultured in vitro, methods to isolate an adequate quantity of bacteria for genome sequencing are very important. In the whitefly Bemisia tabaci, a number of endosymbionts have been identified and are predicted to be of importance in the development and reproduction of the pests through multiple approaches. However, the mechanism underpinning the associations remains largely unknown. The obstacle partially comes from the fact that the endosymbionts in whitefly, mostly restrained in bacteriocytes, are hard to separate from the host cells. Here we report a step-by-step protocol for the identification, extraction and purification of endosymbionts from the whitefly B. tabaci mainly by dissection and filtration. Endosymbiont samples prepared by this method, although still a mixture of different endosymbiont species, are suitable for subsequent genome sequencing and analysis of the possible roles of endosymbionts in B. tabaci. This method may also be used to isolate endosymbionts from other insects.

The Middle East Asia Minor 1 (MEAM1) species of the B. tabaci complex was taken as an example here for description. Cotton for rearing whiteflies and several developmental stages of whiteflies are shown in Figure 1 including a cotton plant, adult whitefly and the 1st, 2nd and 4th instar nymphs of whitefly (the 3rd instar nymph looks similarly as the 4th instar nymph). It was obvious that the 4th instar nymph is larger than the 1st and 2nd instar nymphs (Figure 1). FISH analysis of Portiera and Hamiltonella within MEAM1 is shown in Figure 2. These two endosymbionts are confined to the bacteriocytes of the whitefly, and overlapping of the two bacteria is also observed. Figure 3 shows transmission electron microscopy images of the Portiera endosymbiont of the whitefly, which indicates that Portiera may lose the its cell wall.
For sequencing, two libraries were built, with insert sizes of 200 bp and 2,000 bp, respectively. After sequencing, the two libraries generated 1,626 Mb and 1,302 Mb of raw data, respectively. After cleaning up the contamination data for adaptors and duplications, 1,484 Mb and 1,219 Mb of clean data were acquired. The assembly successfully resulted in a complete genome sequence for the obligate symbiont, Portiera. In addition, a draft genome of Hamiltonella was also obtained. The assembly based on both 200 bp and 2,000 bp libraries resulted in 138 contigs. According to paired-end relationships, the 138 contigs were further assembled into 89 scaffolds (Table 2).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55809/55809fig1.jpg" /> 
Figure 1: Overview of the Plant-insect System Utilized in this Paper. (A) Whiteflies are reared on cotton plants (Gossypium hirsutum cv. Zhe-Mian 1793). (B) View of an adult whitefly. (C) Several developmental stages of instar nymph in the whitefly life cycle. Red arrow refers to the egg of whitefly; Black arrow refers to the 1st instar nymph of whitefly; White arrow refers to the 2nd nymph of whitefly; Blue arrow refers to the 4th instar nymph of whitefly. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55809/55809fig2.jpg" /> 
Figure 2: FISH Analysis of Portiera, Hamiltonella in the 4th Instar Nymph of MEAM1. Portiera-specific probe (red) conjugated to Cy3, Hamiltonella-specific probe (green) marked with Cy5 were used. Scale bars = 100 &#181;m. (A) The red hybridization signals represent the Portiera under dark field. (B) The green hybridization signals represent the Hamiltonella under dark field. (C) Portiera and Hamiltonella merged signals under dark field. (D) Portiera and Hamiltonella merged signals under bright field. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/55809/55809fig3.jpg" /> 
Figure 3: Transmission Electron Microscopy Image of Portiera in Whitefly. Arrow indicates the location of Portiera. Scale bar = 1 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target symbiont</td>
			<td>Target gene</td>
			<td colspan="3">Primer sequences (5&#39;-3&#39;)</td>
			<td>PCR procedures</td>
			<td>References</td>
		</tr>
		<tr>
			<td>Portiera</td>
			<td>16S rRNA</td>
			<td colspan="3">Por-F: TGCAAGTCGAGCGGCATCAT</td>
			<td>95 &#176;C 1 min, 60 &#176;C 1 min, 72 &#176;C 1 min, 5 cycles;&#160;</td>
			<td>27</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Por-R: AAAGTTCCCGCCTTATGCGT</td>
			<td colspan="2">95 &#176;C 1 min, 58 &#176;C 1 min, 72 &#176;C 1 min, 30 cycles;</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 20 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Hamiltonella</td>
			<td>16S rRNA</td>
			<td colspan="3">Ham-F: TGAGTAAAGTCTGGGAATCTGG</td>
			<td>95 &#176;C 1 min, 60 &#176;C 1 min, 72 &#176;C 1 min, 5 cycles;&#160;</td>
			<td>27</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Ham-R: CCCGGGAACGTATTCACCGTAG</td>
			<td colspan="2">95 &#176;C 1 min, 58 &#176;C 1 min, 72 &#176;C 1 min, 30 cycles;</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 20 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Rickettsia</td>
			<td>16S rRNA</td>
			<td colspan="3">Ric-F: GCTCAGAACGAACGCTATC</td>
			<td>95 &#176;C 2 min;&#160;</td>
			<td>24</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Ric-R: GAAGGAAAGCATCTCTGC</td>
			<td>92 &#176;C 1 min, 58 &#176;C 1 min, 72 &#176;C 90 s, 30 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Arsenophonus</td>
			<td>23S rRNA</td>
			<td colspan="3">Ars-F: CGTTTGATGAATTCATAGTCAAA</td>
			<td>95 &#176;C 5 min;&#160;</td>
			<td>28</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Ars-R: GGTCCTCCAGTTAGTGTTACCCAAC</td>
			<td>95 &#176;C 30 s, 60.5 &#176;C 30 s, 72 &#176;C 45 s, 30 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 10 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Cardinium</td>
			<td>16S rRNA</td>
			<td colspan="3">Car-F: TACTGTAAGAATAAGCACCGGC</td>
			<td>95 &#176;C 2 min</td>
			<td>29</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Car-R: GTGGATCACTTAACGCTTTCG</td>
			<td>92 &#176;C 1 min, 57 &#176;C 1 min, 72 &#176;C 90 s, 30 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Wolbachia</td>
			<td>16S rRNA</td>
			<td colspan="3">Wol-F: TTGTAGCCTGCTATGGTATAACT</td>
			<td>94 &#176;C 5 min;&#160;</td>
			<td>30, 31</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Wol-R: GAATAGGTATGATTTTCATGT</td>
			<td colspan="2">94 &#176;C 1 min, 55 &#176;C 1 min, 72 &#176;C 1 min, 35 cycles</td>
		</tr>
		<tr>
			<td>Fritschea</td>
			<td>23S rRNA</td>
			<td colspan="3">Fri-F: GATGCCTTGGCATTGATAGGCGATGAAGGA</td>
			<td>95 &#176;C 5 min;&#160;</td>
			<td>32</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">Fri-R: TGGCTCATCATGCAAAAGGCA</td>
			<td>94 &#176;C 1 min, 64 &#176;C 1 min, 72 &#176;C 90 s, 35 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Hemipteriphilus</td>
			<td>groEL</td>
			<td colspan="3">OR-groEL-F: CACCWAAAATTACTAAAGATGG</td>
			<td>94 &#176;C 3 min;&#160;</td>
			<td>18</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3">OR-groEL-R: TAGAARTCCATWCCKCCCATWC</td>
			<td>94 &#176;C 30 s, 52 &#176;C 30 s, 72 &#176;C 2 min, 34 cycles;</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td colspan="3"></td>
			<td>72 &#176;C 10 min</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: PCR Primers and Procedures of Endosymbionts in Whitefly.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Portiera</td>
			<td>Hamiltonella</td>
		</tr>
		<tr>
			<td>Contig Number</td>
			<td>1</td>
			<td>138</td>
		</tr>
		<tr>
			<td>Scaffold numbera</td>
			<td>1</td>
			<td>89</td>
		</tr>
		<tr>
			<td>Total length, bp</td>
			<td>358,232</td>
			<td>1,711,449</td>
		</tr>
		<tr>
			<td>N50, bp</td>
			<td>/</td>
			<td>118,802</td>
		</tr>
		<tr>
			<td>N90, bp</td>
			<td>/</td>
			<td>16,753</td>
		</tr>
		<tr>
			<td>Max length, bp</td>
			<td>/</td>
			<td>390,511</td>
		</tr>
		<tr>
			<td>Min length, bp</td>
			<td>/</td>
			<td>503</td>
		</tr>
		<tr>
			<td>GC content, %</td>
			<td>26.18</td>
			<td>39.89</td>
		</tr>
		<tr>
			<td colspan="3">a Information presented below are all based on scaffolds.</td>
		</tr>
	</tbody>
</table>
Table 2: General Features of Portiera and Hamiltonella Draft Genome.

Watch this Scientific Journal Video about Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci at JoVE.com

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Here, we present a protocol to isolate endosymbionts from the whitefly Bemisia tabaci through dissection and filtration. After amplification, the DNA samples are suitable for subsequent sequencing and study of the mutualism between endosymbionts and whitefly.

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Bacterial symbionts form an intimate relationship with their hosts and confer advantages to the hosts in most cases. Genomic information is critical to ...

methods-for-extraction-endosymbionts-from-whitefly-bemisia

Nanyang Technological University

Research

JoVE Journal

Biology

9.8K Views.  Zhejiang University.  Hier presenteren wij een protocol om endosymbionten van de whitefly Bemisia tabaci te isoleren door dissectie en filtratie. Na amplificatie zijn de DNA monsters geschikt voor latere sequencing en studie van de mutualiteit tussen endosymbionten en whitefly. 

Video: Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and rates of mortality in populations, which has a variety of applications in ecology, including agricultural ecosystems. Horizontal, or cohort-based, life tables provide for the most direct and accurate method of quantifying vital population rates because they follow a group of individuals in a population from birth to death. Here, protocols are presented for conducting and analyzing cohort-based life tables in the field that takes advantage of the sessile nature of the immature life stages of a global insect pest, Bemisia tabaci. Individual insects are located on the underside of cotton leaves and are marked by drawing a small circle around the insect with a non-toxic pen. This insect can then be observed repeatedly over time with the aid of hand lenses to measure development from one stage to the next and to identify stage-specific causes of death associated with natural and introduced mortality forces. Analyses explain how to correctly measure multiple mortality forces that act contemporaneously within each stage and how to use such data to provide meaningful population dynamic metrics. The method does not directly account for adult survival and reproduction, which limits inference to dynamics of immature stages. An example is presented that focused on measuring the impact of bottom-up (plant quality) and top-down (natural enemies) effects on the mortality dynamics of B. tabaci in the cotton system.

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables allow quantification of the sources and rates of mortality in insect populations and contribute to understanding, predicting and manipulating population dynamics in agroecosystems. Methods for conducting and analyzing cohort-based life tables in the field for an insect with sessile immature life stages are presented.

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and ...

Environment

Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

Aphids are excellent experimental models for a variety of biological questions ranging from the evolution of symbioses and the development of polyphenisms to questions surrounding insect's interactions with their host plants. Genomic resources are available for several aphid species, and with advances in the next-generation sequencing, transcriptomic studies are being extended to non-model organisms that lack genomes. Furthermore, aphid cultures can be collected from the field and reared in the laboratory for the use in organismal and molecular experiments to bridge the gap between ecological and genetic studies. Last, many aphids can be maintained in the laboratory on their preferred host plants in perpetual, parthenogenic life cycles allowing for comparisons of asexually reproducing genotypes. Aphis nerii, the milkweed-oleander aphid, provides one such model to study insect interactions with toxic plants using both organismal and molecular experiments. Methods for the generation and maintenance of the plant and aphid cultures in the greenhouse and laboratory, DNA and RNA extractions, microsatellite analysis, de novo transcriptome assembly and annotation, transcriptome differential expression analysis, and qPCR verification of differentially expressed genes are outlined and discussed here.

Maintaining Biological Cultures and Measuring Gene Expression in Aphis nerii: A Non-model System for Plant-insect Interactions

The aphid Aphis nerii colonizes on highly-defended plants in the dogbane family (Apocyanaceae) and provides numerous opportunities to study plant-insect interactions. Here, we present a series of protocols for the maintenance of plant and aphid cultures, and the generation and analysis of molecular and -omic data for A. nerii.

Aphids are excellent experimental models for a variety of biological questions ranging from the evolution of symbioses and the development of polyphenisms ...

Genetics

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

A few species of sap-sucking whiteflies are some of the most damaging terrestrial pests worldwide because of the crop damage they inflict and plant viruses they vector. Despite numerous studies of the biology of these species in different environments, a key life history parameter, offspring sex ratios, has received little attention, yet is important for predicting population dynamics. The primary sex ratio (sex ratio at oviposition) of Bemisia tabaci has never been reported but can be found by determining the egg fertilization rate of this haplodiploid insect. The technique involves the dechorionation of eggs with bleach, a series of fixation steps, and the application of the general DNA fluorescent stain, DAPI (4&#8242;,6-diamidino-2-phenylindole, a DNA-binding fluorescent dye), to bind to female and male pronuclei. Here, we present the technique, and an example of its application, to test whether an endosymbiotic bacterium, Rickettsia sp. nr. bellii, influenced the primary sex ratio of B. tabaci. This method may assist in population studies of whiteflies, or in determining if sex allocation exists with certain environmental stimuli.

Determining the Egg Fertilization Rate of Bemisia tabaci Using a Cytogenetic Technique

We present a simple cytogenetic technique using 4&#8242;,6-diamidino-2-phenylindole (DAPI) to determine the fertilization rate and primary sex ratio of the haplodiploid invasive pest Bemisia tabaci.

A few species of sap-sucking whiteflies are some of the most damaging terrestrial pests worldwide because of the crop damage they inflict and plant ...

A Loop-mediated Isothermal Amplification (LAMP) Assay for Rapid Identification of Bemisia tabaci

The whitefly Bemisia tabaci (Gennadius) is an invasive pest of considerable importance, affecting the production of vegetable and ornamental crops in many countries around the world. Severe yield losses are caused by direct feeding, and even more importantly, also by the transmission of more than 100 harmful plant pathogenic viruses. As for other invasive pests, increased international trade facilitates the dispersal of B. tabaci to areas beyond its native range. Inspections of plant import products at points of entry such as seaports and airports are, therefore, seen as an important prevention measure. However, this last line of defense against pest invasions is only effective if rapid identification methods for suspicious insect specimens are readily available. Because the morphological differentiation between the regulated B. tabaci and close relatives without quarantine status is difficult for non-taxonomists, a rapid molecular identification assay based on the loop-mediated isothermal amplification (LAMP) technology has been developed. This publication reports the detailed protocol of the novel assay describing rapid DNA extraction, set-up of the LAMP reaction, as well as interpretation of its read-out, which allows identifying B. tabaci specimens within one hour. Compared to existing protocols for the detection of specific B. tabaci biotypes, the developed method targets the whole B. tabaci species complex in one assay. Moreover the assay is designed to be applied on-site by plant health inspectors with minimal laboratory training directly at points of entry. Thorough validation performed under laboratory and on-site conditions demonstrates that the reported LAMP assay is a rapid and reliable identification tool, improving the management of B. tabaci.

A Loop-mediated Isothermal Amplification LAMP Assay for Rapid Identification of Bemisia tabaci

This paper reports the protocol for a rapid identification assay for Bemisia tabaci based on loop-mediated isothermal amplification (LAMP) technology. The protocol requires minimal laboratory training and can, therefore, be implemented on-site at points of entry for plant imports such as seaports and airports.

The whitefly Bemisia tabaci (Gennadius) is an invasive pest of considerable importance, affecting the production of vegetable and ornamental crops in many ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Immunology and Infection

Artificial Host Parasitization by Trichogramma dendrolimi and Venom Extraction

Extracting Venom from the Parasitoid Wasp Trichogramma dendrolimi Using an Artificial Host

Parasitoid wasps are a diverse group of hymenopteran insects that serve as invaluable resources for pest biocontrol. To ensure successful parasitism, parasitoid wasps inject venom into their hosts to suppress their hosts&#39; immunity, modulate hosts&#39; development, metabolism, and even behavior. With over 600,000 estimated species, the diversity of parasitoid wasps surpasses that of other venomous animals, such as snakes, cone snails, and spiders. Parasitoid wasp venom is an underexplored source of bioactive molecules with potential applications in pest control and medicine. However, collecting parasitoid venom is challenging due to the inability to use direct or electrical stimulation and the difficulty in dissection because of their small size. Trichogramma is a genus of tiny (~0.5 mm) egg parasitoid wasps that are widely used for the biological control of lepidopteran pests in both agriculture and forests. Here, we report a method for extracting venom from T. dendrolimi using artificial hosts. These artificial hosts are created with polyethylene film and amino acid solutions and then inoculated with Trichogramma wasps for parasitism. The venom was subsequently collected and concentrated. This method enables the extraction of large amounts of Trichogramma venom while avoiding contamination from other tissues caused by dissection, a common issue in venom reservoir dissection protocols. This innovative approach facilitates the study of Trichogramma venom, paving the way for new research and potential applications.

Author Spotlight: Efficient Venom Extraction Method from Trichogramma Parasitoid Wasps 

Here, we present a protocol for extracting venom from Trichogramma dendrolimi using an artificial host created with polyethylene film and amino acid solution.

Parasitoid wasps are a diverse group of hymenopteran insects that serve as invaluable resources for pest biocontrol. To ensure successful parasitism, ...

Biochemistry

Transmitting Plant Viruses Using Whiteflies

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species5, are vectors of many plant viruses. Several genera of these whitefly-transmitted plant viruses (Begomovirus, Carlavirus, Crinivirus, Ipomovirus, Torradovirus) include several hundred species of emerging and economically significant pathogens of important food and fiber crops (reviewed by9,10,16). These viruses do not replicate in their vector but nevertheless are moved readily from plant to plant by the adult whitefly by various means (reviewed by2,6,7,9,10,11,17). For most of these viruses whitefly feeding is required for acquisition and inoculation, while for others only probing is required. Many of these viruses are unable or cannot be easily transmitted by other means. Therefore maintenance of virus cultures, biological and molecular characterization (identification of host range and symptoms)3,13, ecology2,12, require that the viruses be transmitted to experimental hosts using the whitefly vector. In addition the development of new approaches to management, such as evaluation of new chemicals14 or compounds15, new cultural approaches1,4,19, or the selection and development of resistant cultivars7,8,18, requires the use of whiteflies for virus transmission. The use of whitefly transmission of plant viruses for the selection and development of resistant cultivars in breeding programs is particularly challenging7. Effective selection and screening for resistance employs large numbers of plants and there is a need for 100% of the plants to be inoculated in order to find the few genotypes which possess resistance genes. These studies use very large numbers of viruliferous whiteflies, often several times per year.
Whitefly maintenance described here can generate hundreds or thousands of adult whiteflies on plants each week, year round, without the contamination of other plant viruses. Plants free of both whiteflies and virus must be produced to introduce into the whitefly colony each week. Whitefly cultures must be kept free of whitefly pathogens, parasites, and parasitoids that can reduce whitefly populations and/or reduce the transmission efficiency of the virus. Colonies produced in the manner described can be quickly scaled to increase or decrease population numbers as needed, and can be adjusted to accommodate the feeding preferences of the whitefly based on the plant host of the virus.
There are two basic types of whitefly colonies that can be maintained: a nonviruliferous and a viruliferous whitefly colony. The nonviruliferous colony is composed of whiteflies reared on virus-free plants and allows the weekly availability of whiteflies which can be used to transmit viruses from different cultures. The viruliferous whitefly colony, composed of whiteflies reared on virus-infected plants, allows weekly availability of whiteflies which have acquired the virus thus omitting one step in the virus transmission process.

Improving our understanding of and our ability to manage many of the insect-transmitted plant viruses requires the use of the vector. Insect transmission of plant viruses is a tritrophic interaction, and as such requires the manipulation of insects, virus, and plant. Vectors must be reared in large numbers and manipulated in such a way as to insure high rates of transmission to test plants. The basics of rearing and manipulating the whitefly, Bemisa tabaci (Hemiptera: Aleyrodidae), a vector of plant viruses belonging to several emerging plant virus genera, representing a large number of economically significant viruses is presented.

Whiteflies, Hemiptera: Aleyrodidae, Bemisia tabaci, a complex of morphologically indistinquishable species5, are vectors of many plant viruses. Several ...

Localization and Quantification of Begomoviruses in Whitefly Tissues by Immunofluorescence and Quantitative PCR

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. Considering the extensive damage caused by begomoviruses to crop production worldwide, it is imperative to understand the interaction between begomoviruses and their whitefly vector. To do so, localization and quantification of the virus in the vector tissues is crucial. Here, using tomato yellow leaf curl virus (TYLCV) as an example, we describe a detailed protocol to localize begomoviruses in whitefly midguts, primary salivary glands, and ovaries by immunofluorescence. The method is based on the use of specific antibodies against a virus coat protein, dye-labeled secondary antibodies, and a confocal microscope. The protocol can also be used to colocalize begomoviral and whitefly proteins. We further describe a protocol for the quantification of TYLCV in whitefly midguts, primary salivary glands, hemolymph, and ovaries by quantitative PCR (qPCR). Using primers specifically designed for TYLCV, the protocols for quantification allow the comparison of the amount of TYLCV in different tissues of the whitefly. The described protocol is potentially useful for the quantification of begomoviruses in the body of a whitefly and a virus-infected plant. These protocols can be used to analyze the circulation pathway of begomoviruses in the whitefly or as a complement to other methods to study whitefly-begomovirus interactions.

We describe an immunofluorescence and quantitative PCR method for the localization and quantification of begomoviruses in insect tissues. The immunofluorescence protocol can be used to colocalize viral and vector proteins. The quantitative PCR protocol can be extended to quantify viruses in whole whitefly bodies and virus-infected plants.

Begomoviruses (genus Begomovirus, family Geminiviridae) are transmitted by whiteflies of the Bemisia tabaci complex in a persistent, circulative manner. ...

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to identify commensal or mutualistic bacteria species. The latter ones, have been observed to serve multiple functions to the insect, i.e. helping in insect reproduction1, boosting the immune response2, pheromone production3, as well as nutrition, including the synthesis of essential amino acids4, among others. &#160; &#160;
Due to the importance of these associations, many efforts have been made to characterize the communities down to the individual members. However, most of these efforts were either based on cultivation methods or relied on the generation of 16S rRNA gene fragments which were sequenced for final identification. Unfortunately, these approaches only identified the bacterial species present in the gut and provided no information on the metabolic activity of the microorganisms.
To characterize the metabolically active bacterial species in the gut of an insect, we used stable isotope probing (SIP) in vivo employing 13C-glucose as a universal substrate. This is a promising culture-free technique that allows the linkage of microbial phylogenies to their particular metabolic activity. This is possible by tracking stable, isotope labeled atoms from substrates into microbial biomarkers, such as DNA and RNA5. The incorporation of 13C isotopes into DNA increases the density of the labeled DNA compared to the unlabeled (12C) one. In the end, the 13C-labeled DNA or RNA is separated by density-gradient ultracentrifugation from the 12C-unlabeled similar one6. Subsequent molecular analysis of the separated nucleic acid isotopomers provides the connection between metabolic activity and identity of the species.
Here, we present the protocol used to characterize the metabolically active bacteria in the gut of a generalist insect (our model system), Spodoptera littoralis (Lepidoptera, Noctuidae). The phylogenetic analysis of the DNA was done using pyrosequencing, which allowed high resolution and precision in the identification of insect gut bacterial community. As main substrate, 13C-labeled glucose was used in the experiments. The substrate was fed to the insects using an artificial diet.

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

The active bacterial community associated with the gut of Spodoptera littoralis, was determined by stable-isotope-probing (SIP) coupled to pyrosequencing. Using this methodology, identification of the metabolically active bacteria species within the community was done with high resolution and precision.

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation of RNA virus transmission using Wolbachia-transfected mosquitoes. Key strategies to control viruses include the manipulation of host reproduction via cytoplasmic incompatibility and the inhibition of viral transcripts via immune priming and competition for host-derived resources. However, the underlying mechanisms of the responses of Wolbachia-transfected mosquitoes to viral infection are poorly understood. This paper presents a protocol for the in vitro identification of Wolbachia infection at the nucleic acid and protein levels in Aedes albopictus (Diptera: Culicidae) Aa23 cells to enhance the understanding of the interactions between Wolbachia and its insect vectors. Through the combined use of polymerase chain reaction (PCR), quantitative PCR, western blot, and immunological analytical methods, a standard morphologic protocol has been described for the detection of Wolbachia-infected cells that is more accurate than the use of a single method. This approach may also be applied to the detection of Wolbachia infection in other insect taxa.

Detecting Wolbachia Strain wAlbB in Aedes albopictus Cell Lines

Four methods were used to detect intracellular Wolbachia, which complemented each other and improved the detection accuracy of Wolbachia infection of Aedes albopictus-derived Aa23 and Aa23-T&#160;cured of native Wolbachia infection using antibiotics.

As a maternally harbored endosymbiont, Wolbachia infects large proportions of insect populations. Studies have recently reported the successful regulation ...

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Samenvatting

Meer video's verkennen