The authors thank Davy Opdenacker for technical assistance and photography. We greatly thank Dr. Annick Bleys for helpful suggestions to improve the manuscript. This work was financed by the Interuniversity Attraction Poles Programme IUAP P7/29 'MARS' from the Belgian Federal Science Policy Office, by the FWO grant G027313N and by the Agency for Innovation by Science and Technology, IWT (IR).

1. Arabidopsis LRIS Protocol
Note: The text refers to &#34;small&#34; or &#34;large&#34; scale experiments. Small scale experiments, such as marker line analysis and histological staining6, 14, require only a few samples. Large scale experiments, such as quantitative real-time qRT-PCR, micro-arrays9-11 or RNA sequencing, require a larger amount of samples. As such, an amount of ~1000 seedlings per sample was used by Vanneste et al.11 to perform microarray experiment after root segment dissection.
DAY 1
<ol>
	<li>Sterilization of Arabidopsis Seeds 
	Note: Select one of the following procedures for seed sterilization. Any of them is suitable for the next steps of the protocol. Gas sterilization (1.1.2) presents two main advantages over liquid sterilization (1.1.1): it takes less time when handling a large number of seeds, since no pipetting has to occur for the individual samples; and the sterilized seeds can be stored for a longer period. However, it requires a desiccator and careful handling.
	<ol>
		<li>Liquid sterilization
		<ol>
			<li>Pour the desired number of seeds in micro-centrifuge tubes. Use up to 20 mg (~800 seeds) in a 1.5&#160;ml&#160;tube or 40 mg (~1600 seeds) in a 2 ml&#160;micro-centrifuge tubes.</li>
			<li>Add 1 ml of 70% ethanol. Invert or gently shake for 2 min.</li>
			<li>Replace the 70% ethanol with 1 ml sterilization solution for 15 min. (Prepare fresh sterilization solution: 3.85 ml sodium hypochlorite (NaOCl) stock (12%) (CAUTION: Use fume hood), 5 &#181;l&#160;Tween 20, up to 10 ml with water. Invert the tubes several times to make sure that all seeds come in contact with the solution.</li>
			<li>In a laminar air flow cabinet, replace the sterilization solution with 1 ml sterile distilled water and rinse the seeds 5 times for 5 min by repeatedly replacing with 1 ml of fresh sterile distilled water.</li>
		</ol>
		</li>
		<li>Gas Sterilization
		<ol>
			<li>Pour the desired number of seeds in a 2 ml micro-centrifuge tube. Use individual tubes when working with several independent lines, and arrange them opened in a plastic micro-centrifuge tubes box or holder. If the number of seeds in one tube exceeds 500 (12.5 mg), subdivide the seeds in the appropriate number of tubes to ensure successful sterilization.&#160;Make sure the caps of neighboring tubes do not cover each other. Fit together the lid of the box on the bottom, as it needs to be in the desiccator as well for sterilization.</li>
			<li>Place the box in the bowl of a desiccator, along with a glass beaker (CAUTION: Use fume hood).</li>
			<li>Fill the beaker with 100 ml of 12% NaOCl (CAUTION: Use fume hood). Put the lid on the desiccator, but leave a small aperture where the beaker is placed.</li>
			<li>Add 3 ml of 37% hydrochloric acid (fuming) (CAUTION: Use fume hood) to the beaker through the small aperture and quickly close the desiccator. The solution will bubble for some time due to Cl2-gas formation. Leave the system closed O/N (or at least 8 hr).</li>
			<li>Remove the lid of the desiccator. Take out the box and cover it with the lid to avoid contamination during transport.</li>
			<li>Put the box in a laminar air flow cabinet, remove the lid and leave the seeds for about 1 hr at RT&#160;to allow gas release. 
			Note: Seeds can be safely stored dry in closed micro-centrifuge tubes for up to 2 weeks at 4 &#176;C.&#160;&#160;&#160;</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Lateral Root Induction in Arabidopsis
	<ol>
		<li>Lateral Root Inhibition (NPA Treatment)
		<ol>
			<li>Prepare growth medium for in vitro growth. The medium contains half strength Murashige and Skoog salt mixture15, 0.1 g/L myo-inositol, 10 g/L sucrose, and is buffered with 0.5 g/L 2-(N-morpholino)ethanesulfonic acid (MES).</li>
			<li>Adjust the pH to 5.7 with 1 M KOH. Add 8 g/L of plant tissue agar and autoclave the medium for 20 min at 121 &#176;C.</li>
			<li>Prepare a 25 mM stock solution of NPA in dimethylsulfoxide (DMSO) (CAUTION: Use gloves). In a laminar air flow cabinet, cool the autoclaved medium down to approximately 65 &#176;C (which is the temperature at which the bottle can be held by hand), and add 25 mM NPA stock solution to obtain a final concentration of 10 &#181;M NPA.</li>
			<li>Homogenize upon addition by gently shaking the bottle for 10 sec. Pour 50 ml of medium per square petri dish (12 cm x 12 cm). 
			Note: In case of large scale experiment, apply a nylon mesh (20 &#181;m) to ensure easy transfer. Prepare a mesh (9 cm x 9 cm) for autoclaving (Figure 1A). When autoclaved, apply the mesh to the growth medium using sterile tweezers (Figure 1B). Gently push the mesh to the growth medium using a sterilized&#160;drigalsky to make sure it is in good contact with the growth medium (Figure 1B) (CAUTION: Work in sterile conditions).&#160;</li>
			<li>Sow the seeds on the NPA-plates. 
			Note: In case a large scale experiment is planned, sow 2 dense and well-aligned rows of 50 seeds to facilitate the sampling (see 1.2.2.3).
			<ol>
				<li>In case of liquid sterilization, sow the seeds on NPA-plates using a 200 &#181;l pipet. Cut off 3 - 4 mm of the end of the pipetting&#160;tips in sterile conditions (or before sterilization of the tips) in order to be able to pipet the seeds. Pipet up and down a couple of times to re-suspend the seeds, then pipet approximately 150 &#181;l sterile water with 10 - 20 seeds and wait till the seeds sediment at the bottom of the tip. (CAUTION: Work in sterile conditions) 
				Note: When touching the agar or the mesh gently with the tip, a drop of water with a seed will be released from it (Figure 1C).</li>
				<li>In case of gas sterilization, sow the seeds using autoclaved toothpicks.Pinch the toothpick into the agar before taking the seeds to ensure a sticky surface. Pick up the seeds one by one using the toothpick and distribute the seeds on the plates (Figure 1D). Alternatively, add sterile water to the seeds, and sow as described in 1.2.1.5.1 (CAUTION: Work in sterile conditions).</li>
			</ol>
			</li>
			<li>Seal the plates with breathable adhesive tape and store them plates at 4 &#176;C in the dark for at least 2 days and maximum one week. This is needed for stratification and ensures synchronized and more efficient germination. 
			Note: Alternatively, seeds can be stratified before sowing, immersed in distilled water in micro-centrifuge tubes, which requires less refrigerator space. In this case, store the tubes for at least one week at 4 &#176;C, and move the plates to the growth cabinet immediately after sowing (see 1.2.1.7). 
			DAY 3</li>
			<li>Move the plates to the growth cabinet (continuous light (110 &#181;E m-2 s-1), 21 &#176;C) for 5 days (2 days of germination and 3 days of growth) in a nearly vertical position (80 to 90 &#176;) to ensure root growth on, and not in the medium. 
			DAY 8&#160;</li>
		</ol>
		</li>
		<li>Lateral Root Induction (NAA Treatment)
		<ol>
			<li>Prepare the same growth medium as described in 1.2.1.1 and 1.2.1.2. Prepare a 50 mM stock solution of NAA in DMSO (CAUTION: Use gloves). Cool the autoclaved medium down to 65 &#176;C and add NAA solution to the medium to obtain a final concentration of 10 &#181;M NAA (CAUTION: Work in sterile conditions).
			<ol>
				<li>Homogenize upon addition by gently shaking the bottle for 10 sec. Pour 50 ml of medium per square petri dish (12 cm x 12 cm).</li>
			</ol>
			</li>
			<li>Transfer the seedlings from the plates containing growth medium supplemented with 10 &#181;M NPA to those supplemented with 10 &#181;M NAA.
			<ol>
				<li>Hook the arms of curved tweezers under the cotyledons of the seedling and gently remove it from the plate. Only transfer seedlings of which the roots have grown entirely in contact with the NPA-growth medium and preferably downwards.</li>
				<li>Skim the root over the NAA-containing growth medium surface over a small distance. Make sure that the plant roots are in good contact with the growth medium. If needed, press the root gently to the growth medium surface with the tweezers. 
				Note: In case of a large-scale experiment, remove all seedlings that are not in contact with the mesh and transfer by lifting the mesh at the two upper corners with tweezers. Make sure the mesh is in good contact with the NAA-containing medium by skimming the mesh over the agar surface over a small distance (Figure 1E).&#160;</li>
			</ol>
			</li>
			<li>Seal the new plates with breathable tape and place them in the growth cabinet (continuous light (110 &#181;E m-2 s-1), 21 &#176;C) in a vertical position for the desired time after induction until sampling. 
			Note: In case of a large-scale experiment, use a scalpel to cut the root segments all at once directly on the mesh and sample them by gently scraping the surface of the mesh.&#160;&#160;</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. LRIS Maize Protocol
<ol>
	<li>Stratification of Maize Kernels
	<ol>
		<li>Incubate the maize kernels at 4 &#176;C in the dark for at least 1 week. 
		Note: This protocol has been developed using the B73 maize inbred line.</li>
	</ol>
	</li>
	<li>Sterilization of Maize Kernels 
	DAY 1 
	Note: Although maize seedlings do not have to be grown in sterile conditions, it is recommended to sterilize the maize kernels and work with sterile material to prevent fungal growth in the paper roll system.
	<ol>
		<li>Put the necessary number of maize kernels in a sterilized glass beaker.</li>
		<li>Add 100 ml of sterilization solution (6% NaOCl in water) (CAUTION: Use fume hood).</li>
		<li>Add a magnetic stir bar and place the beaker on a magnetic stirrer at low stirring speed (approximately 250 rpm) at RT&#160;for 5 min.</li>
		<li>Rinse five times for 5 min by replacing the solution with 100 ml of fresh sterile water.</li>
	</ol>
	</li>
	<li>&#160;Sowing Maize Kernels
	<ol>
		<li>Put on gloves to reduce the risk of contamination, and take a roll of paper towels.</li>
		<li>Tear off two stretches of hand towel paper with a total length of two sheets (approximately 92 cm x 24 cm) and place them on top of each other on a clean surface (Figure 2A).</li>
		<li>Fold the sheets double over the length (approximately 92 cm x 12 cm) (Figure 2A).</li>
		<li>Use tweezers to distribute 10 kernels at approximately 2 cm from the top over the entire length of the paper, while keeping an interspace of 8 cm between each kernel and 8 cm free at both ends (Figure 2B). Make sure the radicle of the kernel is facing down and toward the paper (Figure 2B).</li>
		<li>Gently roll the paper over the length, while keeping the seeds in place (Figure 2B). To facilitate the rolling, it is optional to first spray the paper with sterile water.</li>
		<li>Put the paper rolls in sterilized glass tubes of approximately 6 cm diameter and 14 cm height (e.g., 250 ml centrifuge tubes) and place them in a rack (Figure 2C).</li>
	</ol>
	</li>
	<li>Lateral Root Induction in Maize
	<ol>
		<li>Prepare a 50 mM NPA stock solution (dissolved in DMSO) (CAUTION: Use gloves).</li>
		<li>For each tube, make a 50 &#181;M NPA solution by adding 125 &#181;l from the 50 mM NPA stock solution to 125 ml sterile water in a sterilized glass beaker.</li>
		<li>Mix well and pour 125 ml of the 50 &#181;M NPA solution over the paper roll in the tube. The paper roll will absorb the solution and become completely soaked. 
		Note: When using paper rolls and tubes with other dimensions, adjust the volume accordingly. The liquid should reach halfway the tube to ensure sufficient uptake.</li>
		<li>Place the paper roll system in a growth cabinet for three days (27 &#176;C, continuous light, 70% relative humidity). Make sure that the paper rolls remain soaked by adding extra 50 &#181;M NPA solution, since the solution evaporates over time (Figure 2D). 
		DAY 4</li>
		<li>Prepare a 50 mM NAA stock solution (dissolved in DMSO) (CAUTION: Use gloves).</li>
		<li>For each tube, prepare a 50 &#181;M NAA solution by adding 125 &#181;l from the 50 mM NAA stock to 125 ml sterile water in a sterilized glass beaker.</li>
		<li>Gently squeeze out most of the remaining NPA solution from the paper rolls and place them in sterile water for 5 min to wash it out (CAUTION: Use gloves). Gently squeeze out most of the water from the paper rolls. Repeat this washing step three times.</li>
		<li>Mix well and pour the 50 &#181;M NAA solution over the paper rolls in the tubes. Make sure they are completely soaked.</li>
		<li>Place the paper roll system in the growth cabinet (27 &#176;C, continuous light, 70% relative humidity) for the desired duration after induction.</li>
	</ol>
	</li>
	<li>Lateral Root Induction in Adventitious Crown Roots of Maize 
	Note: The LRIS as described above induces lateral roots in the primary root. However, in maize and other monocotyledons, the primary root and the embryonic seminal roots, together with their lateral roots, are mainly important during seedling development. At a later stage in plant growth, the post-embryonic adventitious roots arise on the stem and also develop lateral roots to form a new root system16. The LRIS can also be used to induce lateral roots on these post-embryonic adventitious crown roots by following some minor adjustments to the LRIS on the embryonic primary root.
	<ol>
		<li>To make the paper rolls, create a sandwich of papers with respectively two layers of hand towel paper on the outer side, and two layers of germination paper within. Place the sterilized kernels (see steps 2.1 to 2.2) in between the two sheets of germination paper. Germination paper, compared to hand towel paper, will be less prone to be penetrated by root hairs and lateral roots, which will make the opening of the paper rolls easier later on. On the other hand, the two external layers of hand towel paper will facilitate absorption of the liquid.</li>
		<li>Insert the rolls in 700 ml glass tubes and pour sterile water without NPA over them. Make sure they are completely soaked.</li>
		<li>Germinate the sterilized kernels in the growth cabinet (see step 2.4.9).</li>
		<li>Grow the seedlings till the adventitious crown roots start to emerge (6 days for B73). Make sure the paper rolls are kept wet at all times by adding sterile water when necessary.</li>
		<li>Transfer to a 25 &#181;M NPA solution for 4 days (see steps 2.4.1 to 2.4.4), followed by a similar induction of lateral root initiation by replacing the NPA solution with a 50 &#181;M NAA solution after a washing step (see step 2.4.5 to 2.4.9).</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Van Norman, J. M., Xuan, W., Beeckman, T., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=To+branch+or+not+to+branch:+the+role+of+pre-patterning+in+lateral+root+formation.">To branch or not to branch: the role of pre-patterning in lateral root formation.</a> Development. 140, 4301-4310 (2013).</li><li>Dolan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+organisation+of+the+Arabidopsis+thaliana+root.">Cellular organisation of the Arabidopsis thaliana root.</a> Development. 119, 71-84 (1993).</li><li>Bell, J. K., McCully, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+histological+study+of+lateral+root+initiation+and+development+in+Zea+mays.">A histological study of lateral root initiation and development in Zea mays.</a> Protoplasma. 70, 179-205 (1970).</li><li>Benkova, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Local,+efflux-dependent+auxin+gradients+as+a+common+module+for+plant+organ+formation.">Local, efflux-dependent auxin gradients as a common module for plant organ formation.</a> Cell. 115, 591-602 (2003).</li><li>Beeckman, T., Burssens, S., Inz&#233;, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+peri-cell-cycle+in+Arabidopsis.">The peri-cell-cycle in Arabidopsis.</a> J. Exp. Bot. 52, 403-411 (2001).</li><li>Himanen, K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inz&#233;, D., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin-mediated+cell+cycle+activation+during+early+lateral+root+initiation.">Auxin-mediated cell cycle activation during early lateral root initiation.</a> Plant Cell. 14, 2339-2351 (2002).</li><li>Jansen, L., Parizot, B., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+system+for+lateral+roots+in+Arabidopsis+thaliana+and+maize.">Inducible system for lateral roots in Arabidopsis thaliana and maize.</a> Methods Mol Biol. 959, 149-158 (2013).</li><li>Casimiro, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+transport+promotes+Arabidopsis+lateral+root+initiation.">Auxin transport promotes Arabidopsis lateral root initiation.</a> Plant Cell. 13, 843-852 (2001).</li><li>Himanen, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+profiling+of+early+lateral+root+initiation.">Transcript profiling of early lateral root initiation.</a> Proc. Natl. Acad. Sci. USA. 101, 5146-5151 (2004).</li><li>De Smet, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Receptor-like+kinase+ACR4+restricts+formative+cell+divisions+in+the+Arabidopsis+root.">Receptor-like kinase ACR4 restricts formative cell divisions in the Arabidopsis root.</a> Science. 322, 594-597 (2008).</li><li>Vanneste, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+progression+in+the+pericycle+is+not+sufficient+for+SOLITARY+ROOT/IAA14-mediated+lateral+root+initiation+in+Arabidopsis+thaliana.">Cell cycle progression in the pericycle is not sufficient for SOLITARY ROOT/IAA14-mediated lateral root initiation in Arabidopsis thaliana.</a> Plant Cell. 17, 3035-3050 (2005).</li><li>De Rybel, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+role+for+the+root+cap+in+root+branching+revealed+by+the+non-auxin+probe+naxillin.">A role for the root cap in root branching revealed by the non-auxin probe naxillin.</a> Nat. Chem. Biol. 8, 798-805 (2012).</li><li>Jansen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+transcriptomics+as+a+tool+for+the+identification+of+root+branching+genes+in+maize.">Comparative transcriptomics as a tool for the identification of root branching genes in maize.</a> Plant Biotechnol. J. 11, 1092-1102 (2013).</li><li>Parizot, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diarch+symmetry+of+the+vascular+bundle+in+Arabidopsis+root+encompasses+the+pericycle+and+is+reflected+in+distich+lateral+root+initiation.">Diarch symmetry of the vascular bundle in Arabidopsis root encompasses the pericycle and is reflected in distich lateral root initiation.</a> Plant Physiol. 146, 140-148 (2008).</li><li>Murashige, T., Skoog, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+revised+medium+for+rapid+growth+and+bio+assays+with+tobacco+tissue+cultures.">A revised medium for rapid growth and bio assays with tobacco tissue cultures.</a> Physiol. Plant. 15, 473-497 (1962).</li><li>Bellini, C., Pacurar, D. I., Perrone, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adventitious+roots+and+lateral+roots:+similarities+and+differences.">Adventitious roots and lateral roots: similarities and differences.</a> Annu Rev Plant Biol. 65, 639-666 (2014).</li><li>Grunewald, W., Parizot, B., Inz&#233;, D., Gheysen, G., Beeckman, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developmental+biology+of+roots:+One+common+pathway+for+all+angiosperms?.">Developmental biology of roots: One common pathway for all angiosperms?.</a> Int. J. Plant Dev. Biol. 1, 212-225 (2007).</li><li>Parizot, B., Beeckman, T., Crespi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+of+root+development.">Genomics of root development.</a> Root Genomics and Soil Interactions. , 3-28 (2012).</li><li>Bargmann, B. O., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+activated+cell+sorting+of+plant+protoplasts.">Fluorescence activated cell sorting of plant protoplasts.</a> Journal of visualized experiments : JoVE. , (2010).</li><li>Nakazono, M., Qiu, F., Borsuk, L. A., Schnable, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser-capture+microdissection,+a+tool+for+the+global+analysis+of+gene+expression+in+specific+plant+cell+types:+identification+of+genes+expressed+differentially+in+epidermal+cells+or+vascular+tissues+of+maize.">Laser-capture microdissection, a tool for the global analysis of gene expression in specific plant cell types: identification of genes expressed differentially in epidermal cells or vascular tissues of maize.</a> Plant Cell. 15, 583-596 (2003).</li><li>Ludwig, Y., Hochholdinger, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+microdissection+of+plant+cells.">Laser microdissection of plant cells.</a> Methods Mol Biol. 1080, 249-258 (2014).</li><li>Beeckman, T., Engler, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+easy+technique+for+the+clearing+of+histochemically+stained+plant+tissue.">An easy technique for the clearing of histochemically stained plant tissue.</a> Plant Mol. Biol. Rep. 12, 37-42 (1994).</li><li>Ditengou, F. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+induction+of+lateral+root+initiation+in+Arabidopsis+thaliana.">Mechanical induction of lateral root initiation in Arabidopsis thaliana.</a> Proc. Natl. Acad. Sci. USA. 105, 18818-18823 (2008).</li><li>Lucas, M., Godin, C., Jay-Allemand, C., Laplaze, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+fluxes+in+the+root+apex+co-regulate+gravitropism+and+lateral+root+initiation.">Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation.</a> J. Exp. Bot. 59, 55-66 (2008).</li><li>Wang, S., Taketa, S., Ichii, M., Xu, L., Xia, K., Zhou, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+root+formation+in+rice+(Oryza+Sativa.+L.):+differential+effects+of+indole-3-acetic+acid+and+indole-3-butyric+acid.">Lateral root formation in rice (Oryza Sativa. L.): differential effects of indole-3-acetic acid and indole-3-butyric acid.</a> Plant Growth Regul. 41, 41-47 (2003).</li><li>Martinez-de la Cruz, E., Garcia-Ramirez, E., Vazquez-Ramos, J. M., Reyes de la Cruz, H., Lopez-Bucio, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxins+differentially+regulate+root+system+architecture+and+cell+cycle+protein+levels+in+maize+seedlings.">Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings.</a> J Plant Physiol. 176, 147-156 (2015).</li><li>Beyer, E. M., Morgan, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+ethylene+on+uptake,+distribution,+and+metabolism+of+indoleacetic+acid-1-14C+and+-2-14C+and+naphthaleneacetic+acid-1-14C.">Effect of ethylene on uptake, distribution, and metabolism of indoleacetic acid-1-14C and -2-14C and naphthaleneacetic acid-1-14C.</a> Plant Physiol. 46, 157-162 (1970).</li><li>Delbarre, A., Muller, P., Imhoff, V., Guern, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+mechanisms+controlling+uptake+and+accumulation+of+2,4-dichlorophenoxy+acetic+acid,+naphthalene-1-acetic+acid,+and+indole-3-acetic+acid+in+suspension-cultured+tobacco+cells.">Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells.</a> Planta. 198, 532-541 (1996).</li><li>Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microgenomics:+genome-scale,+cell-specific+monitoring+of+multiple+gene+regulation+tiers.">Microgenomics: genome-scale, cell-specific monitoring of multiple gene regulation tiers.</a> Annu Rev Plant Biol. 64, 293-325 (2013).</li><li>Perez-Torres, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphate+availability+alters+lateral+root+development+in+Arabidopsis+by+modulating+auxin+sensitivity+via+a+mechanism+involving+the+TIR1+auxin+receptor.">Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor.</a> Plant Cell. 20, 3258-3272 (2008).</li></ol>

The authors have nothing to disclose.

In the Arabidopsis LRIS protocol, it is important to only transfer the seedlings that have grown entirely in contact with the NPA-containing growth medium. This ensures that lateral root initiation is blocked over the entire root length. In order to prevent wounding the plantlets during transfer, the arms of the curved forceps can be hooked under the cotyledons of the seedling. Upon transfer, make sure that the seedling roots are in sufficient contact with the NAA-containing agar medium. This can be achieved by skimming the root over the agar surface over a small distance. This will ensure an efficient synchronized induction of the lateral root initiation over the total root length. The roots can be grown exposed to light without negatively affecting their growth and lateral root induction.
In the maize LRIS protocol, it is important that the radicle of the kernel faces down and toward the paper to ensure the root will grow downwards and attach to the paper at the correct side16. After three days of NPA treatment, the seedlings should have emerged from the kernel with a small shoot, a primary root and seminal roots16.&#160; The primary root should be approximately 2 cm long before proceeding to the induction of lateral root initiation. This protocol has been developed using the B73 maize inbred line, but in case of a maize line with a different growth rate, adjust the incubation time accordingly. Make sure that the paper rolls remain soaked by adding regularly 50 &#181;M NPA solution when the liquid vaporizes over time, otherwise NPA treatment could be inefficient and unwanted early lateral root development could occur. The system itself prevents exposition of the roots to the light, but light is&#160;not a major issue and doesn&#39;t affect root growth and lateral root induction.
Alternative ways for controlled induction of lateral roots are the use of mechanical bending23 or gravistimulation24. The main advantage of these systems is that they have a more &#39;natural&#39; induction compared to the hormone treatments in the LRIS, but the disadvantage is that they are limited in the amount of material that can be harvested at a given time point because they only yield one lateral root initiation event in the bend per seedling compared to a full induction of the pericycle in the LRIS.
The LRIS used in Arabidopsis and maize can be used in a variety of plants, though favorable conditions need to be optimized. To install an LRIS, two important successive steps have to be achieved: (1) blocking of auxin transport and (2) accumulation of auxin to induce lateral root initiation. The growing system should allow for efficient and uniform uptake of the compounds and should permit good development of the seedlings. Alternative systems to solid medium (Arabidopsis) and paper rolls (maize), such as liquid culture, hydroponics, or aeroponics, could be used for other species. The first stage in the LRIS, i.e., the blocking of the auxin transport, can be achieved by adding an auxin transport inhibitor. Although NPA leads to an efficient block of lateral root initiation in Arabidopsis and maize, alternative compounds such as 2,3,5-triiodobenzoic acid (TIBA) or p-chlorophenoxyisobutyric acid (PCIB) might work better in other species. A similar optimization can be done for the second step of the LRIS, i.e., the auxin treatment. The synthetic auxin NAA seems to be the most suited for an LRIS. The auxin precursor indol-3-butyric acid (IBA) might be a good alternative as it also strongly induces lateral roots and has a high bioactivity in different plants25, 26 . On the other hand, the natural auxin indole-3-acetic acid (IAA) is less stable and more easily metabolized27, rationalizing its weaker effect on root development in for example maize or rice25, 26. The synthetic auxin 2,4-dichlorophenoxyacetic acid (2,4D) accumulates highly in pericycle cells, partially because it is not exported from the cells28, impairing proper lateral root initiation and inducing artificial fused structures. Also other compounds interacting with auxin pathways, such as naxillin12, have been shown to induce lateral root initiation in Arabidopsis and can be tested in other species.
In some cases, germination is inefficient in the presence of NPA and one might choose to first germinate the seeds in the absence of NPA, to subsequently transfer the seedlings to the NPA-containing system. This induces a possible risk of having early lateral root primordia initiated before lateral root induction with NAA treatment and, hence, it is important to only sample the region of the root that elongated during NPA treatment. Following this general strategy, one should be able to optimize an LRIS for practically any (seed) plant and as such have an easy system to study lateral root development for the plant of interest. Further characterization of the timing of the lateral root initiation can occur via marker lines, as exemplified for Arabidopsis. If marker lines are difficult to obtain, a detailed histological study could be done, but this is time-consuming and the first cell divisions are not easily recognizable. Alternatively, expression analysis of cell division markers can be used to indicate the timing of the first cell divisions.
The LRIS can be used for different purposes, such as transcriptome analysis9-13 as briefly described in the results, as well as histological observations at the macroscopic and microscopic level during lateral root initiation14. Different types of sampling, ranging from organ to cell scale29, might allow unraveling different aspects of the lateral root initiation. In addition, the LRIS can be used to monitor the effect of different compounds on the lateral root initiation12, 30. Finally, by using reporter lines, a LRIS can also be used to easily characterize the gene expression and/or protein localization during lateral root development.

The root system is crucial for plant growth, since it ensures anchorage and uptake of water and nutrients from the soil. Because the expansion of a root system mainly relies on the production of lateral roots, their initiation and formation have been widely studied. Lateral roots are initiated in a specific subset of pericycle cells, called founder cells1. In most dicots, such as Arabidopsis thaliana, these cells are located at the protoxylem poles2, whereas in monocots, such as maize, they are found at the phloem poles3. Founder cells are marked by an increased auxin response4, followed by expression of specific cell cycle genes (e.g.,&#160;CYCLIN B1;1 / CYCB1;1), after which they undergo a first round of asymmetric anticlinal divisions5. After a series of coordinated anticlinal and periclinal divisions, a lateral root primordium is formed that finally will emerge as an autonomous lateral root. The location and timing of lateral root initiation are however not predictable, since these events are neither abundant nor synchronized. This impedes the use of molecular approaches such as transcriptomics to study this process.
To tackle this, a Lateral Root Inducible System (LRIS) has been developed6, 7. In this system, seedlings are first treated with N-1-naphthylphthalamic acid (NPA), which inhibits auxin transport and accumulation, consequently blocking lateral root initiation8. By subsequently transferring the seedling to medium containing the synthetic auxin 1-naphthalene acetic acid (NAA), the entire pericycle layer responds to the elevated auxin levels thereby massively inducing lateral root initiating cell divisions6. As such, this system leads to fast, synchronous and extensive lateral roots initiations, allowing easy collection of root samples enriched for a specific stage of lateral root development. Subsequently, these samples can be used to determine genome-wide expression profiles during lateral root formation. The LRIS has yielded already significant knowledge about lateral root initiation in Arabidopsis and maize9-13, but the need to apply this system to other plant species becomes more apparent as more genomes are sequenced and there is an increasing interest to transfer knowledge to economical important species.
Here, the detailed protocols of the Arabidopsis and maize LRISs are given. Next, an example of the use of the system is provided, by illustrating how transcriptomics data gained from the maize LRIS can be used to identify functional homologs that have a conserved function during lateral root initiation across different plant species. Finally, guidelines to optimize the LRIS for other plant species are proposed.

<table><tbody><tr><td>&lt;strong&gt;ARABIDOPSIS LRIS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Seeds&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Arabidopsis seeds</td><td></td><td></td><td>Col-0 ecotype</td></tr><tr><td>&lt;strong&gt;Gas sterilization of seeds&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>micro-centrifuge tubes 1.5 ml</td><td>SIGMA-ALDRICH</td><td>0030 125.215</td><td>Eppendorf microtubes 3810X, PCR clean</td></tr><tr><td>micro-centrifuge tubes 2 ml</td><td>SIGMA-ALDRICH</td><td>0030 120.094</td><td>Eppendorf Safe-Lock microcentrifuge tubes</td></tr><tr><td>hydrochloric acid</td><td>Merck KGaA</td><td>1,003,171,000</td><td>37% (fuming) for analysis EMSURE ACS,ISO,Reag. Ph Eu</td></tr><tr><td>glass desiccator</td><td>SIGMA-ALDRICH</td><td></td><td>Pyrex</td></tr><tr><td>glass beaker</td><td></td><td></td><td></td></tr><tr><td>plastic micro-centrifuge tubes box or holder</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Bleach sterilization of seeds&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>ethanol</td><td>Chem-Lab nv</td><td>CL00.0505.1000</td><td>Ethanol, abs. 100% a.r. dilute to 70%</td></tr><tr><td>sodium hypochlorite (NaOCl)</td><td>Carl Roth</td><td>9062.3</td><td>12%</td></tr><tr><td>Tween 20</td><td>SIGMA-ALDRICH</td><td>P1379</td><td></td></tr><tr><td>sterile water</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Growth medium&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Murashige and Skoog salt mixture</td><td>DUCHEFA Biochemie B.V.</td><td>M0221-0050</td><td></td></tr><tr><td>myo-inositol</td><td>SIGMA-ALDRICH</td><td>I5125-100G</td><td></td></tr><tr><td>2-(N-morpholino)ethanesulfonic acid (MES)</td><td>DUCHEFA Biochemie B.V.</td><td>M1503.0100</td><td></td></tr><tr><td>sucrose</td><td>VWR, Internation LLC</td><td>27483.294</td><td>D(+)-Sucrose Ph. Eur.</td></tr><tr><td>KOH</td><td>Merck KGaA</td><td>1050211000</td><td>pellets for analysis (max. 0.002% Na) EMSURE ACS,ISO,Reag. Ph Eur</td></tr><tr><td>Plant Tissue Culture Agar</td><td>LabM Limited</td><td>MC029</td><td></td></tr><tr><td>&lt;strong&gt;Lateral root induction chemicals&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-1-naphthylphthalamic acid (NPA)</td><td>DUCHEFA Biochemie B.V.</td><td>No. N0926.0250</td><td>10 &amp;micro;M (Arabidopsis)</td></tr><tr><td>1-naphthalene acetic acid (NAA)</td><td>DUCHEFA Biochemie B.V.</td><td>No. N0903.0050</td><td>10 &amp;micro;M (Arabidopsis)</td></tr><tr><td>dimethylsulfoxide (DMSO)</td><td>SIGMA-ALDRICH</td><td>494429-1L</td><td></td></tr><tr><td>&lt;strong&gt;Making a mesh for transfer&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>nylon mesh</td><td>Prosep byba</td><td></td><td>Synthetic nylon mesh 20 &amp;micro;m</td></tr><tr><td>&lt;strong&gt;Sowing and seedling handling&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>square petri dish plates</td><td>GOSSELIN</td><td>BP124-05</td><td>12 x 12 cm</td></tr><tr><td>50 ml DURAN tubes</td><td>SIGMA-ALDRICH</td><td>CLS430304</td><td>Corning&amp;nbsp;50 ml centrifuge tubes</td></tr><tr><td>drigalski</td><td>Carl Roth</td><td>K732.1</td><td></td></tr><tr><td>pipette</td><td></td><td></td><td></td></tr><tr><td>cut pipette tips</td><td>Daslab</td><td>162001X</td><td>Universal 200, cut off 5 mm of tip before autoclaving</td></tr><tr><td>breathable tape&amp;nbsp;</td><td>3M Deutschland GmbH</td><td>cat. no. 1530-1</td><td></td></tr><tr><td>tweezers</td><td>Fiers nv/sa</td><td>K342.1; K344.1</td><td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td></tr><tr><td>&lt;strong&gt;Growth conditions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>growth room</td><td></td><td></td><td>21 &amp;deg;C, continuous light</td></tr><tr><td>&lt;strong&gt;Materials&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;MAIZE LRIS&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Seeds&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Maize kernels</td><td></td><td></td><td>B-73</td></tr><tr><td>&lt;strong&gt;Bleach sterilization of kernels&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>glass beaker</td><td></td><td></td><td></td></tr><tr><td>magnetic stirrer&amp;nbsp;</td><td>Fiers nv/sa</td><td>C267.1</td><td></td></tr><tr><td>sodium hypochlorite (NaOCl)</td><td>Carl Roth</td><td>9062.3</td><td>12%</td></tr><tr><td>sterile water</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Lateral root induction chemicals&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-1-naphthylphthalamic acid (NPA)</td><td>DUCHEFA Biochemie B.V.</td><td>No. N0926.0250</td><td>50 &amp;micro;M (maize primary root), 25 &amp;micro;M (maize adventitious root)</td></tr><tr><td>1-naphthalene acetic acid (NAA)</td><td>DUCHEFA Biochemie B.V.</td><td>No. N0903.0050</td><td>50 &amp;micro;M (maize)</td></tr><tr><td>dimethylsulfoxide (DMSO)</td><td>SIGMA-ALDRICH</td><td>494429-1L</td><td></td></tr><tr><td>&lt;strong&gt;Sowing and seedling handling&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>paper hand towels</td><td>Kimberly-Clark Professional*</td><td>6681</td><td>SCOTT Hand Towels - Roll / White; sheet size (24 x 46 cm)</td></tr><tr><td>seed germination paper</td><td>Anchor Paper Company</td><td></td><td>10 X 15 38# seed germination paper</td></tr><tr><td>tweezers</td><td>Fiers nv/sa</td><td>K342.1; K344.1</td><td>Dumont tweezers type a nr 5; Dumont tweezers type e nr 7</td></tr><tr><td>250 ml (centrifuge) tubes</td><td>SCHOTT DURAN</td><td>2160136</td><td>approx. 5.6 cm diameter and 14.7 cm height&amp;nbsp;</td></tr><tr><td>700 ml tubes</td><td>DURAN GROUP</td><td>213994609</td><td>cylinders, round foot tube, D 60&amp;nbsp; x 250</td></tr><tr><td>rack</td><td></td><td></td><td>for maize tubes, home made</td></tr><tr><td>sterile water</td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Growth conditions&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>growth cabinet</td><td></td><td></td><td>27 &amp;deg;C, continuous light, 70% relative humidity</td></tr></tbody></table>

lateral root inducible system in arabidopsis and maize

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is however tedious, because it occurs only in a few cells inside the root and in an unpredictable manner. To circumvent this problem, a Lateral Root Inducible System (LRIS) has been developed. By treating seedlings consecutively with an auxin transport inhibitor and a synthetic auxin, highly controlled lateral root initiation occurs synchronously in the primary root, allowing abundant sampling of a desired developmental stage. The LRIS has first been developed for Arabidopsis thaliana, but can be applied to other plants as well. Accordingly, it has been adapted for use in maize (Zea mays). A detailed overview of the different steps of the LRIS in both plants is given. The combination of this system with comparative transcriptomics made it possible to identify functional homologs of Arabidopsis lateral root initiation genes in other species as illustrated here for the CYCLIN B1;1 (CYCB1;1) cell cycle gene in maize. Finally, the principles that need to be taken into account when an LRIS is developed for other plant species are discussed.

Application of the LRIS to Perform Comparative Transcriptomics of the Lateral Root Initiation Process
One application of the LRIS is the comparison and correlation of gene expression profiles during lateral root formation in different species. Comparative transcriptomics approaches create the possibility to pinpoint orthologous genes involved in the lateral root development process in different species. Lateral root initiation, which consists of the formation of a new organ from a subset of cells contained in an already formed root axis, is the major mechanism shared by angiosperms to control their root architecture. Consequently, it is very likely that it evolved from existing pathways present in a common ancestor and was conserved throughout evolution. Indeed, common potential regulators of lateral root initiation have been found in different species17, 18.
Sampling Material using the LRIS in Arabidopsis and Maize, and Transcriptome Analysis
The LRIS has been established in two different species: Arabidopsis and maize10, 13. In both species, it was decided to sample the plants just before NAA treatment, and shortly after induction, at the onset of, or during the auxin response, as well as at the onset of, or during the first divisions in the pericycle. Furthermore, Fluorescence Activated Cell Sorting19 (FACS) was used in Arabidopsis or Laser Capture Microscopy20, 21 (LCM) in maize to select for pericycle cells. In Arabidopsis, the time points of 2 and 6 hr after induction were chosen based on the transcriptional characterization of the pDR5::GUS auxin response and pCYCB1;1::GUS cell cycle marker lines9 (Figure 3). In maize, the time points 2, 3 and 4 hr after induction, were selected after microscopic characterization of cell division activity and the analysis of several cell cycle marker genes expression using real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)13. RNA was extracted from the isolated cells and hybridized on microarray platforms as previously described10, 13.
Finding the Ortholog of ArabidopsisCYCB1;1 (AtCYCB1;1) in Maize
In Arabidopsis, the marker line pCYCB1;1::GUS has been widely used to track the first divisions of the pericycle during lateral root initiation. Such marker would be very useful in maize. Several homologs of AtCYCB1;1 were found in maize (www.maizesequence.org, all peptides, BLASTP, default settings). Six of them were present on the microarray performed after LRIS in maize and showed significant enrichment. The best BLAST hit, GRMZM2G310115, showed very high transcription levels after LRIS, similar to what was observed in Arabidopsis for AtCYCB1;1 (Figure 4).
Application of the LRIS to Check Individual Gene Expression
To validate GRMZM2G310115 as a good candidate ortholog of AtCYCB1;1 in maize lateral root initiation, a real-time qRT-PCR on samples taken at different time points was performed during the course of an LRIS13. Plants were treated as described in the above-mentioned protocol and harvested at different time points: before NAA treatment (NPA), and after 2, 3 and 4 hr of NAA treatment. Also, material of plants grown only in water was harvested to compare gene expression between LRIS and neutral conditions. Immediately after harvesting, root segments corresponding to a region comprised between 5 mm and 15 mm above the root tip were dissected under the binocular. Using tweezers, the cortex was separated from the stele (which contains the pericycle), and RNA was extracted from both tissues. This last step was performed instead of LCM, because it is much faster and cheaper for validation. Using the following respective forward and reverse qRT-PCR primers, AGCAGGACGCAGTTGGAGAG and GAGCCGAGAGCACAGAAGAAAG, GRMZM2G310115 was validated to be up-regulated upon LRIS, and to be specific for the stele tissues (Figure 5). Additionally, this experiment shows that without synchronous induction, the discrete events of lateral root initiation happening in a root growing in water are not detectable, and illustrate the need of the LRIS to reveal differential gene expression related to the process of lateral root initiation.
<img alt="Figure 1" src="/files/ftp_upload/53481/53481fig1.jpg" /> 
Figure 1.&#160;Lateral Root Inducible System for Arabidopsis. (A) Preparing the nylon mesh (20 &#181;m): cut the nylon mesh (9 cm by 9 cm), wrap it in aluminum foil and put it in a glass beaker for autoclaving. (B) Apply the nylon mesh on an NPA-containing plate (10 &#181;M) using tweezers. Then use a sterile drigalski in order to eliminate air bubbles. (C) Sowing seeds on the nylon mesh using a pipet. (D) Sowing seeds on the nylon mesh using a toothpick. (E) Transfer the nylon mesh to an NAA-containing plate (10 &#181;M) using tweezers. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53481/53481fig2.jpg" /> 
Figure 2.&#160;Lateral Root Inducible System for Maize.&#160;(A) Preparing the paper rolls: place two layers of paper (92 cm x 24 cm, length of two sheets) on top of each other and fold them double over the length (92 cm x 12 cm). (B) Put 10 sterilized maize kernels with the radicle facing down on the paper at 2 cm from the top with an interspacing of 8 cm. Then roll up the paper while keeping the maize kernels in place. (C) Place the paper rolls in tubes (e.g., 250 ml centrifuge tubes) and put them in a rack. (D) Grow the maize seedlings for three days in a 50 &#181;M NPA solution (at 27 &#176;C, continuous light, relative humidity 70%). (E) Left: seedling just before transfer to NAA; Middle: microtome transversal sections just before transfer to NAA and 2 days after transfer to NAA; Right: seedling with visible emerged lateral roots 5 days after transfer to NAA. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53481/53481fig3.jpg" /> 
Figure 3.&#160;Lateral Root Initiation is Stimulated Upon Prolonged NAA Treatment. (A-F) Time course showing the auxin response during an NAA treatment using the pDR5::GUS marker line. The auxin response, which is one of the first events triggering lateral root initiation,&#160;starts 2 hr after the start of the NAA treatment. In the upper panel, an overview of the whole seedling is given; the lower panel shows the auxin response in the root tip. (G-M) Time course of an NAA treatment using the pCYCB1;1::GUS marker line. The GUS signal represents the expression of the CYCB1;1 gene, indicating that the first cell divisions leading to lateral root formation start 6 h after the start of the NAA treatment. In the upper panel, an overview of the whole seedling is given; the lower panel shows CYCB1;1 expression in the root tip (GUS staining according to Beeckman and Engler, 199422). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53481/53481fig4.jpg" /> 
Figure 4.&#160;Expression Profile of CYCB1 Genes in Arabidopsis and Maize during LRIS.&#160;(A) Microarray expression values of AtCYCB1;1 during LRIS as described by De Smet et al. 200810 (B) Microarray expression values of potential orthologs of AtCYCB1;1 during LRIS as described by Jansen et al. 201313 BLASTP score is the score obtained when blasting the protein sequence of AtCYCB1;1 on the maize genome. Error bars express standard deviation and ** stands for a p-value &#8804;0.01. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53481/53481fig5.jpg" /> 
Figure 5.&#160;Expression of GRMZM2G310115 in the Stele and the Cortex of Maize Roots during LRIS. The expression of GRMZM2G310115 during LRIS in maize was evaluated by quantitative real-time qRT-PCR on dissected stele and cortex samples. A supplementary sampling was performed on plants grown on water. Values were normalized for expression in the stele in water. Error bars express standard deviation and ** stands for a p-value &#8804;0.01 (primers and reference genes according to Jansen et al. 201313). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53481/53481fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Lateral Root Inducible System in Arabidopsis and Maize at JoVE.com

Lateral Root Inducible System in Arabidopsis and Maize | Biology | Video

Lateral Root Inducible System in Arabidopsis and Maize

The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Lateral Root Inducible System in Arabidopsis and Maize

Lateral root development contributes significantly to the root system, and hence is crucial for plant growth. The study of lateral root initiation is ...

lateral-root-inducible-system-in-arabidopsis-and-maize

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Plant Biology

Plant Structure, Growth, and Nutrition

SCIENTISTS IN ACTION

13.7K Views.  Ghent. The Lateral Root Inducible System (LRIS) allows for synchronous induction of lateral roots and is presented for Arabidopsis thaliana and maize.

Video: Lateral Root Inducible System in Arabidopsis and Maize

Experimental Design for Laser Microdissection RNA-Seq: Lessons from an Analysis of Maize Leaf Development

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not detected or are not identified as differentially expressed (DE) in transcriptomic analyses of whole plant organs. Laser Microdissection RNA-Seq (LM RNA-Seq) is a powerful tool to identify genes that are DE in specific developmental domains. However, the choice of cellular domains to microdissect and compare, and the accuracy of the microdissections are crucial to the success of the experiments. Here, two examples illustrate design considerations for transcriptomics experiments; a LM RNA-seq analysis to identify genes that are DE along the maize leaf proximal-distal axis, and a second experiment to identify genes that are DE in liguleless1-R (lg1-R) mutants compared to wild-type. Key elements that contributed to the success of these experiments were detailed histological and in situ hybridization analyses of the region to be analyzed, selection of leaf primordia at equivalent developmental stages, the use of morphological landmarks to select regions for microdissection, and microdissection of precisely measured domains. This paper provides a detailed protocol for the analysis of developmental domains by LM RNA-Seq. The data presented here illustrate how the region selected for microdissection will affect the results obtained.

Many developmentally important genes have cell- or tissue-specific expression patterns. This paper describes LM RNA-seq experiments to identify genes that are differentially expressed at the maize leaf blade-sheath boundary and in lg1-R mutants compared to wild-type. The experimental considerations discussed here apply to transcriptomic analyses of other developmental phenomena.

Genes with important roles in development frequently have spatially and/or temporally restricted expression patterns. Often these gene transcripts are not ...

Biochemistry

Measuring Gene Expression in Bombarded Barley Aleurone Layers with Increased Throughput

The aleurone layer of barley grains is an important model system for hormone-regulated gene expression in plants. In aleurone cells, genes required for germination or early seedling development are activated by gibberellin (GA), while genes associated with stress responses are activated by abscisic acid (ABA). The mechanisms of GA and ABA signaling can be interrogated by introducing reporter gene constructs into aleurone cells via particle bombardment, with the resulting transient expression measured using enzyme assays. An improved protocol is reported that partially automates and streamlines the grain homogenization step and the enzyme assays, allowing significantly more throughput than existing methods. Homogenization of the grain samples is carried out using an automated tissue homogenizer, and GUS (&#946;-glucuronidase) assays are carried out using a 96-well plate system. Representative results using the protocol suggest that phospholipase D activity may play an important role in the activation of HVA1 gene expression by ABA, through the transcription factor TaABF1.

An improved protocol is presented for the measurement of transient gene expression from reporter constructs in barley aleurone cells after particle bombardment. The combination of automated grain grinding with 96-well plate enzyme assays provides high throughput for the procedure.

The aleurone layer of barley grains is an important model system for hormone-regulated gene expression in plants. In aleurone cells, genes required for ...

Genetics

Inducible, Cell Type-Specific Expression in Arabidopsis thaliana Through LhGR-Mediated Trans-Activation

Inducible, tissue-specific expression is an important and powerful tool to study the spatio-temporal dynamics of genetic perturbation. Combining the flexible and efficient GreenGate cloning system with the proven and benchmarked LhGR system (here termed GR-LhG4) for the inducible expression, we have generated a set of transgenic Arabidopsis lines that can drive the expression of an effector cassette in a range of specific cell types in the three main plant meristems. To this end, we chose the previously developed GR-LhG4 system based on a chimeric transcription factor and a cognate pOp-type promoter ensuring tight control over a wide range of expression levels. In addition, to visualize the expression domain where the synthetic transcription factor is active, an ER-localized mTurquoise2 fluorescent reporter under control of the pOp4 or pOp6 promoter is encoded in driver lines. Here, we describe the steps necessary to generate a driver or effector line and demonstrate how cell type specific expression can be induced and followed in the shoot apical meristem, the root apical meristem and the cambium of Arabidopsis. By using several or all driver lines, the context specific effect of expressing one or multiple factors (effectors) under control of the synthetic pOp promoter can be assessed rapidly, for example in F1 plants of a cross between one effector and multiple driver lines. This approach is exemplified by the ectopic expression of VND7, a NAC transcription factor capable of inducing ectopic secondary cell wall deposition in a cell autonomous manner.

Inducible, Cell Type-Specific Expression in Arabidopsis thaliana Through LhGR-Mediated Trans-Activation

Here, we describe the generation and application of a set of transgenic Arabidopsis thaliana lines enabling inducible, tissue-specific expression in the three main meristems, the shoot apical meristem, the root apical meristem, and the cambium.

Inducible, tissue-specific expression is an important and powerful tool to study the spatio-temporal dynamics of genetic perturbation. Combining the ...

Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis

To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure.

Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis

A double stranded RNA interference (dsRNAi) technique is employed to down-regulate the maize cinnamoyl coenzyme A reductase (ZmCCR1) gene to lower plant lignin content. Lignin down-regulation from the cell wall is visualized by microscopic analyses and quantified by the Klason method. Compositional changes in hemicellulose and crystalline cellulose are analyzed.

To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is ...

Bioengineering

Inoculation Strategies to Infect Plant Roots with Soil-Borne Microorganisms

The rhizosphere harbors a highly complex microbial community in which plant roots are constantly challenged. Roots are in close contact with a wide variety of microorganisms, but studies on soil-borne interactions are still behind those performed on aboveground organs. Although some inoculation strategies for infecting model plants with model root pathogens are described in the literature, it remains difficult to get a comprehensive methodological overview. To address this problem, three different root inoculation systems are precisely described that can be applied to gain insights into the biology of root-microbe interactions. For illustration, Verticillium species (namely, V. longisporum and V. dahliae) were employed as root invading model pathogens. However, the methods can be easily adapted to other root colonizing microbes - both pathogenic and beneficial. By colonizing the plant xylem, vascular soil-borne fungi such as Verticillium spp. exhibit a unique lifestyle. After root invasion, they spread via the xylem vessels acropetally, reach the shoot, and elicit disease symptoms. Three representative plant species were chosen as model hosts: Arabidopsis thaliana, economically important oilseed rape (Brassica napus), and tomato (Solanum lycopersicum). Step-by-step protocols are given. Representative results of pathogenicity assays, transcriptional analyses of marker genes, and independent confirmations by reporter constructs are shown. Furthermore, the advantages and disadvantages of each inoculation system are thoroughly discussed. These proven protocols can assist in providing approaches for research questions on root-microbe interactions. Knowing how plants cope with microbes in the soil is crucial for developing new strategies to improve agriculture.

This protocol presents a detailed summary of strategies to inoculate plant roots with soil-borne microbes. Exemplified for the fungi Verticillium longisporum and Verticillium dahliae, three different root infection systems are described. Potential applications and possible downstream analyses are highlighted, and advantages or disadvantages are discussed for each system.

The rhizosphere harbors a highly complex microbial community in which plant roots are constantly challenged. Roots are in close contact with a wide ...

Environment

Translating Ribosome Affinity Purification (TRAP) to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome affinity purification (TRAP) method and consecutive optimized low-input library preparation.
As starting material, we employ plant lines that express GFP-tagged ribosomal protein RPL18 in a cell type-specific manner by use of adequate promoters. Prior to immunopurification and RNA extraction, the tissue is snap frozen, which preserves tissue integrity and simultaneously allows execution of time series studies with high temporal resolution. Notably, cell wall structures remain intact, which is a major drawback in alternative procedures such as fluorescence-activated cell sorting-based approaches that rely on tissue protoplasting to isolate distinct cell populations. Additionally, no tissue fixation is necessary as in laser capture microdissection-based techniques, which allows high-quality RNA to be obtained.
However, sampling from subpopulations of cells and only isolating polysome-associated RNA severely limits RNA yields. It is, therefore, necessary to apply sufficiently sensitive library preparation methods for successful data acquisition by RNA-seq.
TRAP offers an ideal tool for plant research as many developmental processes involve cell wall-related and mechanical signaling pathways. The use of promoters to target specific cell populations is bridging the gap between organ and single-cell level that in turn suffer from little resolution or very high costs. Here, we apply TRAP to study cell-cell communication in lateral root formation.

Translating Ribosome Affinity Purification TRAP to Investigate Arabidopsis thaliana Root Development at a Cell Type-Specific Scale

Translating ribosome affinity purification (TRAP) offers the possibility to dissect developmental programs with minimal processing of organs and tissues. The protocol yields high-quality RNA from cells targeted with a green fluorescent protein (GFP)-labeled ribosomal subunit. Downstream analysis tools, such as qRT-PCR or RNA-seq, reveal tissue and cell type-specific expression profiles.

In this article, we give hands-on instructions to obtain translatome data from different Arabidopsis thaliana root cell types via the translating ribosome ...

Developmental Biology

Imaging Spatial Reorganization of a MAPK Signaling Pathway Using the Tobacco Transient Expression System

Visualization of dynamic signaling events in live cells has been a challenge. We expanded an established transient expression system, the biomolecular fluorescent complementation (BiFC) assay in tobacco epidermal cells, from testing protein-protein interaction to monitoring spatial distribution of signal transduction in plant cells. In this protocol, we used the BiFC assay to show that the interaction and the signaling between the Arabidopsis MAPKKK YODA and MAPK6 occur at the plasma membrane. When the scaffold protein BASL was co-expressed, the YODA-MAPK interaction redistributed and spatially co-polarized with CFP-BASL. This modified tobacco expression system allows for quick examination of signaling localization and dynamic changes (less than 4 days) and can accommodate multiple of fluorescent protein colors (at least three). We also presented detailed methods to quantify protein distribution (asymmetric spatial localization, or &#34;polarization&#34;) in tobacco cells. This advanced tobacco expression system has a potential to be used widely for quick testing of dynamic signaling events in live plant cells.

At the subcellular level, signaling events are dynamically modulated by developmental and environmental cues. Here we describe a protocol that employs the tobacco transient expression system to monitor dynamic protein-protein interaction and to disclose spatial organization of signal transduction in plant cells.

Visualization of dynamic signaling events in live cells has been a challenge. We expanded an established transient expression system, the biomolecular ...

Light Sheet Fluorescence Microscopy of Plant Roots Growing on the Surface of a Gel

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the observation of the whole organ with a high spatial- as well as temporal resolution over prolonged periods of time, which may cause photo-toxic effects. This protocol shows a plant sample preparation method for light-sheet microscopy, which is characterized by mounting the plant vertically on the surface of a gel. The plant is mounted in such a way that the roots are submerged in a liquid medium while the leaves remain in the air. In order to ensure photosynthetic activity of the plant, a custom-made lighting system illuminates the leaves. To keep the roots in darkness the water surface is covered with sheets of black plastic foil. This method allows long-term imaging of plant organ development in standardized conditions.

This protocol shows a plant sample preparation method for light-sheet microscopy. The setup is characterized by mounting the plant vertically on the surface of a gel and letting it grow in controlled bright conditions. This allows long-term observation of plant organ development in standardized conditions.

One of the key questions in understanding plant development is how single cells behave in a larger context of the tissue. Therefore, it requires the ...

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) and Wuschel2 (Wus2). Bbm is regulated by the maize phospholipid transferase gene (Pltp) promoter, and Wus2 is under the control of a maize auxin-inducible (Axig1) promoter. An Agrobacterium strain carrying these morphogenic genes on transfer DNA (T-DNA) and extra copies of Agrobacterium virulence (vir) genes are used to infect maize immature embryo explants. Somatic embryos form on the scutella of infected embryos and can be selected by herbicide resistance and germinated into plants. A heat-activated cre/loxP recombination system built into the DNA construct allows for removal of morphogenic genes from the maize genome during an early stage of the transformation process. Transformation frequencies of approximately 14%, 4%, and 4% (numbers of independent transgenic events per 100 infected embryos) can be achieved for W22, B73, and Mo17, respectively, using this protocol.

Agrobacterium-Mediated Immature Embryo Transformation of Recalcitrant Maize Inbred Lines Using Morphogenic Genes

Plant morphogenic genes can be used to improve genetic transformation of recalcitrant genotypes. Described here is an Agrobacterium-mediated genetic transformation (QuickCorn) protocol for three important public maize inbred lines.

Demonstrated here is a detailed protocol for Agrobacterium-mediated genetic transformation of maize inbred lines using morphogenic genes Baby boom (Bbm) ...

Agrobacterium-Mediated Hairy Root Induction and Regeneration in Plants

Hairy Root Transformation and Regeneration in Arabidopsis thaliana and Brassica napus

Hairy root transformation represents a versatile tool for plant biotechnology in various species. Infection by an Agrobacterium strain carrying a Root-inducing (Ri) plasmid induces the formation of hairy roots at the wounding site after the transfer of T-DNA from the Ri plasmid into the plant genome. The protocol describes in detail the procedure of the injection-based hairy root induction in Brassica napus DH12075 and Arabidopsis thaliana Col-0. The hairy roots may be used to analyze a transgene of interest or processed for the generation of transgenic plants. Regeneration medium containing cytokinin 6-benzylaminopurine (5 mg/L) and auxin 1-naphthaleneacetic acid (8 mg/L) successfully elicits shoot formation in both species. The protocol covers the genotyping and selection of regenerants and T1 plants to obtain plants carrying a transgene of interest and free of T-DNA from the Ri plasmid. An alternative process leading to the formation of a composite plant is also depicted. In this case, hairy roots are kept on the shoot (instead of the natural roots), which enables the study of a transgene in hairy root cultures in the context of the whole plant.

Author Spotlight: Optimizing Hairy Root-Based Transformation Protocols for Enhanced Efficiency in Brassicaceae

The protocol describes hairy root induction using Arabidopsis primary inflorescence stems and Brassica napus hypocotyls. The hairy roots can be cultured and used as explants to regenerate transgenic plants.

Lateral Root Inducible System in Arabidopsis and Maize

Samenvatting

Meer video's verkennen