저자는 기꺼이 실험 BMSB와 HB를 제공 하 고 식민지; 유지에 대 한 도널드 웨버와 메 간 헐리 히 요 (USDA, ARS 벨트 스 빌, 메릴랜드)를 인정 그리고 마리아 토니 곤잘레스, 살바도르 P. 로페즈, (USDA, ARS, 포트 피어스, 플로리다)와 재키 L. 메츠 (프로 리 다의 대학, 포트 피어스, 플로리다) 식민지 유지 관리, 샘플 준비 및 분석.

1. BMSB 양육
<ol><li>표준 실험실 연습와 앞에서 설명한63BMSB 곤충 후면.</li>
	<li>유리 공장 (22 ° C) 및 자연 채광에 감귤 꽃 에 ACP (D. citri) 곤충을 올립니다. 성인 ACP를 사용 하 여, 대략 5-7 일에 게시 일수로.</li>
</ol>2. 유전자 영역 및 체 외에서 합성 dsRNA의 선택
<ol><li>이전에 게시 transcriptome 프로필32에서 BMSB에 특정 유전자를 선택 합니다.</li>
	<li>200 ~ 500의 기본적인 쌍 사이 다를 선택 하는 관심 영역을 확인 합니다.</li>
	<li>연쇄 반응 (PCR) genomic DNA에서 선택 된 유전자와 관련 된 파편을 생성 하기 위해 아래 설명 된 조건을 사용 하 여 수행 합니다. 유전자 관련 oligonucleotides 표 1 을 참조 하십시오.<ol>
<li>PCR 반응: 0.25 mL PCR 튜브에 결합 PCR 버퍼, dNTP 혼합물 (2.5 m m 각)의 4 µ L, 2 µ L의 DNA 템플렛 (50 ng / µ L), 2.5 µ L 각 뇌관 1과 2 (10 µ M), DNA 중 합 효소 (5 U / µ L)의 0.25 µ L의 X 10의 5 µ L DNase/RNase 무료 최대 50 µ L를 물.</li>
		<li>PCR 조건: 10 98 ° C의 30 주기 뒤 3 분 동안 95 ° C에 관심이 증폭 PCR 반응 사이클 s, 55 ° C 30 s, 1 분 품 추가 10 분 Purify 사용 하 여 PCR 반응을 위한 72 ° C에 반응 위한 72 ° C를 정화 키트입니다.</li>
	</ol>
</li>
	<li>T7 RNA 중 합 효소 발기인 순서 측면 유전자 특정 한 뇌관으로 얻은 PCR 파편을 더 증폭 (5'-GAA 온 ATA CGA CTC 법 ATA GGG AGA-3')으로 언급 이전62.</li>
	<li>RNAi에 대 한 부정적인 컨트롤 (모의) LacZ 유전자를 사용 합니다. 참고: LacZ β-galactosidase (사용 하는 뇌관은 표 1에 나열 됩니다) Escherichiacoli genomic DNA에서 증폭을 인코딩하는 유전자 이다.</li>
	<li>설명된 이전62으로 dsRNA를 녹음 방송 생체 외에서 수행 합니다.</li>
	<li>분해 하 고 150 µ L DNase/RNase 무료 물에서 결과 dsRNA를 resuspend, 측정 농도, 나중에 사용-80 ° C에서 저장.</li>
</ol>3입니다. 배달 dsRNA 사용 녹색 콩의
<ol><li>선택 초기 4회 탈피 BMSB nymphs 동일한에서 부 화 계란 질량 그리고 dsRNA 먹이 전에 24 h에 대 한 그들을 굶 어.</li>
	<li>슬림 인증된 유기 녹색 콩 (Phaseolus vulgaris L.)를 선택 하 고 5 분 0.2% 염소 용액으로 세척. 참고: 슬림 콩 콩 쉽게 2 mL microcentrifuge 튜브에 수용 될 수 있도록 선정 됐다.</li>
	<li>DdH2O 3 번 세척 하 고 건조 공기를 허용.</li>
	<li>녹두를 꽃 받침 끝에서 깨끗 한 면도날을 사용 하 여 7.5 cm의 총 길이 잘라 주세요.</li>
	<li>제어 솔루션의 300 µ L을 포함 하는 뚜껑 없는 2 mL microcentrifuge 튜브에 세척 하 고 트림 녹두를 담가 (1시 10분 희석 녹색 식용 색소의 (성분: 물, 프로필 렌 글리콜, Fd & C 노란색 5, Fd & C 블루 1, 및 Propylparaben로 방부 제))입니다.</li>
	<li>생체 외에서 의 확인 희석 diluting 5 µ g 또는 RNase/DNase 무료 물 0.017 µ g / µ L 또는 0.067 µ µ g/L는의 최종 농도를 각각 300 µ L에서 20 µ g LacZ, JHAMT, 또는 Vg dsRNAs 합성.</li>
	<li>DsRNA 솔루션 (3.6 단계)에서 300 µ L를 포함 뚜껑 없는 2 mL microcentrifuge 튜브에서 세척 하 고 트림 녹두를 담가.</li>
	<li>포장 하 고 몰입된 콩 dsRNA 해결책의 증발을 방지 하 고 microcentrifuge 튜브에 들어가기에서 동물 방지를 포함 하는 microcentrifuge 튜브의 가장자리를 밀봉.</li>
	<li>DsRNA 솔루션 그린 빈을 통해 모 세관 작용에 의해 로드 될 수 있도록 3 시간 실 온에서 직 립 방식으로이 관을 배치 합니다.</li>
	<li>깨끗 한 문화 혈관 (폴 리 프로필 렌)에이 관을 배치 합니다. 장소 3 4회 탈피 BMSB nymphs 문화 선박에 굶주렸다.</li>
	<li>치료 3 동물 문화 선박 마다 각 녹색 식품 색소 또는 dsRNA 해결책을 가진 3 개의 녹색 콩을 포함. 인큐베이터에서 16 L: 8D photoperiod에서 25 ° C 및 72% 상대 습도에서 곤충을 유지 합니다.</li>
	<li>5 일 동안 녹색 콩 (몰입, dsRNA를 흡수)에 공급 하는 곤충을 허용 하지만 3 일 후 dsRNA 치료 녹색 구슬의 신선한 다이어트 보충.</li>
</ol>4. 실시간 정량 분석의 유전자 식 다음 RNAi 중재 입을 BMSB에 (정량)
<ol><li>정량에 의해 대 본 식의 수준에 RNAi의 효과 측정 합니다.</li>
	<li>DsRNA 치료 동물에서 총 RNA를 분리 하 고62cDNA 합성.</li>
	<li>실시간 PCR 시스템 및 표 1에 나열 된 프라이 머를 사용 하 여 정량 Pcr 반응 셋업 한다. 다음 정량 사이클링 조건을 사용 하 여: 15 95 ° C의 40 주기 뒤에 10 분 동안 95 ° C s, 95 ° C 15를 포함 하 여 분리 단계와 함께 1 분 동안 60 ° C s, 1 분, 15에 대 한 95 ° C에 대 한 60 ° C s 그리고 60 ° C 15에 대 한 s.</li>
	<li>정량 기준 결정: cDNA는 정량화에 대 한 참조 표준으로 정상적인 동물에서 분리 된 총 RNA에서 준비의 직렬 희석을 사용 하 여.</li>
	<li>내부 표준으로 BMSB 18s RNA를 사용 하 여 조직32에서 RNA 복구에 차이 대 한 수정.</li>
</ol>5. 잎 스프레이 응용 프로그램 큰 화분에 심은 감귤 나무 묘 목
참고: 'Carrizo' 유리창 (감귤 류 나무 XPoncirus trifoliata, 오렌지), 감귤 류의 품종의 식물 자연 채광 및 온도, 1.2 L 용기에 재배에서 유리 공장에서 유지 되었다. 식물 끊임없이 '플러시' 라는 새로운 잎 싹의 성장을 촉진 하는 정리 된 했다. ACP 피드 및 감귤 류64의 새로운 성장에 산란을 좋아한다.
<ol><li>식물 또는 묘 목을 선택 하 고 습기를 하지만 완전히 건조 건조 토양을 사용 하기 전에 2-3 일 동안 그들을 급수 하지 않는다.</li>
	<li>손 펌프 스프레이 용기를 사용 하 여 낮은 캐노피 (그림 4A) 적용할 dsRNA 솔루션 (0.5 mg/mL)의 200 mL. 참고: 위의 준비 DNase/RNase 무료 물에 dsRNA 솔루션을 언급.</li>
	<li>후 스프레이 응용 프로그램, 적용 된 dsRNA 해결책 잎에 의해 완전히 흡수 될 수 있습니다. 참고: 감귤 나무 적용된 dsRNA를 흡수 하 고 잎 어느 새로운 성장에서 또는 전에 응용 프로그램, 적용 된 지점에서 추출 되었다; dsRNA 정량 Pcr를 사용 하 여 감지 했다 고 3-4 h44,,4546에 최고 캐노피 나뭇잎으로 조직의 움직임을 보여주었다.</li>
	<li>25-40 일 수집 하 여 약 10 4 분기의 끝에서 출발 후 이전 얹어 나무에서 새로운 성장 샘플. 총 RNA를 추출 하 고 반전 녹음 방송 PCR (RT-PCR)에 의해 분석 정량 Pcr 뇌관을 사용 하 여 적용된 dsRNA 트리거의 존재에 대 한 표 1에 나열 된 및 이전에 설명한 방법46. 참고: 샘플 컬렉션, 총 RNA 격리, RT-PCR과 정량 앞에서 설명한46으로 수행 했다.</li>
	<li>마찬가지로, 몸에 붙이기도 경종 또는 작은 화분에 심는 나무 잎의 더 낮은 지역에 10 mL dsRNA 스프레이. 참고: Hemipteran 곤충 (ACP 및 GWSS) 24 h에 일반적으로 먹이 액세스를 부여 했다, 새로운 성장 (잎)을 했다 하지 되었습니다 직접 분무, 나는 성장 주 후, 또는 전체 식물 치료를 게시. 이 곤충 3, 6, 및 10 일에 dsRNA에 대 한 테스트는 긍정적인 수 유 포스트 생산.</li>
</ol>6. 토양/물 약 응용 프로그램에 큰 또는 작은 감귤 류 나무와 모 종 화분
<ol><li>식물 또는 묘 목을 선택 하 고 2-3 일 아니지만 습기를 밖으로 건조 하는 토양을 사용 하기 전에 그들을 급수 하지 않는다 완전히 건조 (이 공기 공간 적용 될 액체 솔루션을 만듭니다).</li>
	<li>큰 화분 (약 2.5 m)의 토양에 dsRNA 솔루션 (0.2 mg/mL) 1 리터를 추가 하 고 1 시간 후 물 (체이서) 1 패를 추가.</li>
	<li>100ml dsRNA 해결책 (1.33 mg/mL) 1 m 높이의 토양의 화분에 심는 나무 부분적으로 건조 토양에 적용 됩니다.</li>
	<li>작은 묘 목, 콘에서 토양 또는 벌 거 벗은 뿌리 (그림 4B, C) 10 mL dsRNA 해결책 (1 mg/mL)의 적용.</li>
	<li>식물을 30 분 동안 담가 수 토양 물 약으로는 dsRNA 솔루션을 받을 수 있습니다. 다음 경우 큰 화분 > 1 갤런 (20 mL 노란색 용기에 식물을 위해) 또는 100 mL 뿌리에 의해 흡수를 돕기 위해 일반 물만 치료 적용. 참고: 잎을 몸에 붙이기도 적용된 dsRNA 탐지 최대 원심 팁 3-6 h 게시물 치료, 나무를 통해 조직의 움직임을 보여주는 내 분기의 결과. 새로운 성장 분기 60-90 일 포스트 트리트먼트에 dsRNA에 대 한 긍정적인 테스트합니다. 잘라 먹이 생물 검정44dsRNA에 곤충 (ACP 및 GWSS)에 제공 됩니다.</li>
</ol>7. 줄기 큰 화분에 심은 감귤 나무와 묘에서 응용 프로그램 탭 (트리 트렁크 주입)
<ol><li>새로운, 또는 대략 3.5 년 오래 된 식물 줄기를 사용 하 여 dsRNA를 주입에 대 한 탭 (트렁크 주사) 방법 감귤 류의 묘 목을 선택 합니다.</li>
	<li>감귤 류 식물 훈련 및 2 cm, 또는 줄기의 약 절반 직경을 초과 하지 않도록 주의 복용 10 m m 드릴 비트를 사용 하 여 구멍을 드릴 합니다.</li>
	<li>팁 근처 누설을 방지 하기 위하여 필름을 씰링의 0.6 cm (¼ 인치) 넓은 스트립으로 4-6 시간 각 인젝터의 구리 끝부분을 바꿈.</li>
	<li>6 mL (1.7 mg/mL)에 dsRNA 솔루션 DNase/RNase 무료 물에 희석 하는 트리 트렁크 인젝터 채워 (표시 색된 솔루션으로 서 여기).</li>
	<li>나무의 줄기에 솔루션을 주입 하 고 6-10 h dsRNA 해결책의 흡수 수 있도록 트렁크에 인젝터를 둡니다. 3, 10, 30 일 게시물 치료에서 치료 나무에서 절단에 피드에 곤충을 허용 합니다. 참고: 트렁크 주입 방법을 사용 하 여 주입 dsRNA 나무에서 30-60 일41,,4244의 기간에 대 한 유지. RNAi에 대 한 유효성 검사는 표 1에 나열 된 프라이 머를 사용 하 여 정량에 의해 수행 되었다.</li>
</ol>8. dsRNA 곤충을 통해 토양으로의 배달을 위해 처리 점토 알갱이
<ol><li>튜브에 35 mL 마크 (흡수 성 찰 흙의 약 30 g) 50 mL 원뿔 관으로 흡수 성 찰 흙 밖으로 붓는 다.</li>
	<li>젖은 모든 흡수 관으로 dsRNA 솔루션 DNase/RNase 무료 물 (µ g/100ml)에 희석의 20 mL를 붓으십시오. 원뿔 튜브 캡, 튜브를 제거 하는 공기, 팁 및 튜브 캡.</li>
	<li>튜브 똑바로 놓고 그것은 솔루션을 흡수 하는 찰 흙 입자에 대 한 1-2 분 동안 서 보자.</li>
	<li>1 갤런 냄비를 채우기 위해 토양 혼합으로 충분 한 dsRNA에 젖은 점토를 추가 합니다.</li>
	<li>혼합 고 손으로 철저 하 게 토양으로 dsRNA에 젖은 흙을 혼합 하는 토양.</li>
	<li>사용 하 여이 토양 repot 묘 dsRNA 치료에 대 한 선택.</li>
	<li>DsRNA 없이 일반 물 200 mL와 함께 토양을 물. 1 시간 30 분, 후 일반 물 100 mL를 따릅니다. 24 시간 후 정상 급수 계획에 식물을 넣어.</li>
	<li>새로운 식물 성장의 가장 꼭대기 잎을 수집 하 여 4-6 잎 점토 absorbents와 dsRNA 치료 화분의 dsRNA에 대 한 각 달 게시물 치료를 테스트 합니다. 참고: 식물 또는 절단이 대우 식물에서 먹인 다 곤충에 언제 든 지 24 시간 치료를 게시 하 고 곤충 (되지 않은 데이터)를 최대 1 년을 위한 RNAi 배달 할 수 있다.</li>
</ol>

저자는 공개 없다.

RNAi 입증 유전자 생물학 기능 및 규정, 해충19,,6869,70, 의 관리에 대 한 활용을 중대 한 잠재력을 탐험을 위한 중요 한 도구 71. 디자인 및 특정 곤충 종과 곤충에 해당 dsRNA(s)의 납품의 방법에 입을 위한 적절 한 gene(s)의 선택은 매우 중요 둘 다. 곤충으로 dsRNA를 제공 하기 위한 최적의 방법이 결정 되어야 합니다 경험, 배달에 대 한 상대적인 복용량 선택 함께 이점 및 기타 제한 특정 방법을 제공할 수 있습니다. 궁극적으로 환경 방출에 대 한 적합 한 수 있습니다 분자 중국의 개발, 실현, 효율적이 고 유리한 전달 방법이 필요 합니다. 예를 들어 몸에 붙이기도 적용된 dsRNA 곤충 컨트롤을 감귤 류와 포도 덩굴42,44dsRNA 배달에 대 한 효과적인 것으로 나타났습니다. 직접 섭취, 식물에 dsRNA의 국 소 응용 프로그램 또는 특정 dsRNAs 수정 유전자 변형 식물의 생산에 대 한 baits, 자당 솔루션, 효 모 또는 세균성 dsRNA 생산의 사용과 같은 혁신적인 전략의 개발을 전진 했다 효과적인 RNAi 기반 컨트롤19,72.
좋은 예는 특히 충격과 세계적인 중요성의 곤충 해충을 감소 하도록 설계 되었습니다 (그림 1 및 그림 2) dsRNA를 전달 하기 위해 녹색 콩의 사용 여기 보여 줍니다. 새로 개발된 된 식물성 중재 dsRNA 배달 프로토콜 녹두의 세그먼트를 사용 하 여 포장 및 dsRNA 포화 BMSB에 애벌레의 개발을 위해 효과적으로 대상 유전자 특정 사용 되었습니다. 녹색 콩 BMSB으로 먹어 많은 야채 중 하나 이며 그래서이 dsRNA를 전달 하는 매체로 사용 했다. DsRNA 배달의 다른 매체 테스트 (데이터 표시 되지 않음) 했지만 가능성이 혈관 질감 차이로 인해 BMSB에 영양 공급에 실패 했다. 따라서, 우리 BMSB nymphs을 생체 외에서 합성 dsRNA를 제공 세그먼트 녹두의 사용. 식물 또는 식물성 중재 기술을 통해 전달 하는 핵 산 선택 여기 BMSB (그림 2)62에서 JHAMT 와 Vg 유전자의 소모와 관찰의 곤충에 RNAi를 유도 할 수 있습니다.
이 야채 중재 dsRNA 배달 프로토콜 유도 RNAi BMSB 뿐만 아니라 비록 collard 녹색 (그림 3)를 사용 하는 HB에서 배달 전략을 성공적으로 사용 되었습니다 그리고 각 유전자 및 곤충에 대 한 메서드를 최적화 해야 합니다. 따라서, 개별적으로 관심의 여러 유전자를 대상으로 배달 또는 스택 두 개 이상 dsRNAs phenotypic penetrance 더 얻기 위해 다양 한 방법을 테스트할 것이 좋습니다. 여러 가지 방법은 dsRNA 배달 곤충 및 곤충 세포13,22,73,74,75, microinjection 및 기타 기술을 몸으로 먹이 포함 한76 에 사용 하기 위해 요약 되어 있다 dsRNA 조직의 RNAi를 유도 통풍 관입니다. 치료 비-유전자 변형 식물에 섭취에 의해 다른 곤충에 RNAi를 유도 하는 dsRNA의 구두 납품을 위한 새로운 방법도 왔다탐험된 (그림 4, 그림 5, 그림 6). 감귤 나무 dsRNAs 뿌리를 통해 흡수, 탭 (트렁크 주사), 또는 잎 스프레이42,44줄기를 증명 했습니다. 이전, 감귤 류 나무와 성숙한 포도 덩굴 ACP에 GWSS AK 유전자에 해당 하는 곤충 특정 dsRNA와 처리 되었습니다. 이러한 치료 식물까지 다양 한 길이의 시간41,45ACP 및 대 한 GWSS 사망률에서 증가 발생합니다. 함께 이러한 결과 dsRNA 공부 곤충에 특정 유전자의 표정을 방해 수 있습니다 보여 줍니다.
곤충과 침 분 비, 또는 창 자 pH는 dsRNA47의 저하에 대 한 책임이 있을 수 있습니다 창 자 조직에 주로 표현 dsRNA nucleases (dsRNases)의 고유 그룹을 포함 하는 유전자 발현의 성공적인 침묵에 영향을 주는 문제 ,,7778. 그러나, 이러한 성능 저하를 극복 하기 위해 조직의 RNAi 수 유도 될 효율적으로 곤충에 dsRNA의 높은 농도 활용 하거나 같은 저하62, 를 극복 하기 위해 유전자 특정 dsRNA의 구두 전달 다이어트에 PEG를 사용 하 여 79. 배달 및 dsRNA의 수 또한 안정화 될 운반대 분자, 나노 키토 산48같은80 , Lipofectamine 2000 Metafectene76, 같은 리의 도움으로 폴 리 에틸렌 글리콜79, 클레이 nanosheets81, 그리고 탄소 양자 점50. 연구는 유전자 특정 dsRNA를 주입 한 천 젤 조각을 사용 하 여 dsRNA의 효과적인 납품을 개선 하기 위해 진행 중에 (표시 되지 않음 데이터 추가 비디오 4참조). 이 기술은 생긴 수 지 또는 음식으로 둥지를 agar dsRNA를 수행할 수 있는 개미 dsRNA의 효과적인 복용량의 배달을 위해 사용할 수 있습니다.
DsRNA의 안정성, 뿐만 아니라 식물 조직에 dsRNA의 장기 지 속성은 농업 작물을 위해 특히 중요 합니다. 식물, 과일, 채소의 혈관 조직을 통해 dsRNA RNAi 메커니즘을 유도 하는 곤충에 의해 섭취 되 고 이전에 감소 된 효소 활동 xylem 그리고 체 관 부에 축적 수 있습니다. 그것은 해야 특정 dsRNA를 응용 프로그램 유지 짧은 기간 동안 같은 6 일 녹색 콩 이상 토양62,82 에 36 h에 대 한 환경에서 핵 산의 축적 가능성이 되도록 합니다. 그러나, 외. nanosheets로 조 저하에서 큰 dsRNAs 보호 수 시연 Neena 뿐만 아니라 중재 하십시오 잎 표면에 그들의 지속적인된 출시 적어도 30 일81의 기간 동안.
전반적으로 설명한 dsRNA 배달 전략 해충 관리에 대 한 곤충 특정 유전자를 침묵 하 사용 될 수 있습니다. 관개 물, 루트 물 약, 또는 트렁크 주입을 통해 식물에 dsRNA의 공급 루트 지류, 효율적인 제어 방법은 현재 사용할 수 있는 등 해충 곤충에 대 한 효과적인 전략이 될 수 있습니다. 캐리어를 사용 하 여 또는 찰 흙 또는 한 천 같은 매체를 안정화 dsRNA의 납품 식물 통풍 관에 대 한 토양에 직접 추가 수 있습니다. RNAi 중재 분자 biopesticides 개발에 느린 진행에 대 한 주요 원인 중 하나는 효율적인 RNAi 및 환경 조건83에서 안정성을 시작 하려면 효율적인 구두 전달 기술의 부족 되었습니다. 여기에 설명 된 방법을 미래에 사용할 수 있습니다 제공 핵 산 중재 유전자 치료 입을 공장 구두 배달 수액 먹이 씹는 곤충 세계 식량 생산에 곤충 손상을 감소 시키고 지속 가능한 생태 해충을 개발 관리입니다.

Hemipteran 곤충 높은 인구 증가 달성 하 여 식물에 질병을 확산 그들의 능력의 agriculturebecause의 경제적으로 가장 중요 한 해충의 일부를 구성. BMSB, H. halys 찾을, 19961에 보고 된 첫 번째 보이 질와 아시아 (중국, 대만, 한국, 그리고 일본)에서 알 렌 타운, 펜실베이니아에 서반구에 실수로 도입 된 침입 해충 이다. 그것의 소개부터 BMSB Mid-atlantic (DE, MD, 펜 실바 니 아, 뉴저지, 버지니아, 그리고 웨스트 버지니아), 뿐만 아니라 캐나다, 유럽, 가장 높은 인구가 43 개 주에서 감지 되었습니다 하 고 농업2에 잠재적인 위협을 나타냅니다. Polyphagous 해충으로 BMSB 사과, 포도, 관 상용 식물, 씨앗, 콩, 작물과 옥수수 등 고부가가치 작물을 포함 하 여 약 300 확인 된 식물 호스트 손상을 선동 수 있습니다. 피해는 어디 동물 피어 호스트 작물 영양분을 혈관 조직2,3에서 액세스 하는 바늘 같은 stylet와 lacerate 및 플러시 라고 먹이의 모드 때문에 주로 발생 합니다. BMSB 학교 등 생활 지역에 거주지를 찾을 수 있습니다 그들은 실내 해충 이기도 하 고가을 겨울2집. 화학 물질 및 aeroallergens BMSB 발표 과일 자르기 근로자에서 불법 알레르기 반응으로 보고 되었다. BMSB 또한 접촉 피부염, 결막염, 그리고 민감한 개인4,5비 염 알레르기 질환에 기여할 수 있습니다. 또 다른 hemipteran 곤충, ACP, D. citri 쿠 (Hemiptera: Liviidae), 감귤 류 과일의 심각한 해충 이며 Huanglongbing (HLB), 더 잘 알려진 원인 체 관 부-제한 된 박테리아 (Candidatus Liberibacter asiaticus)를 전송 감귤 류 녹화 질병6,7로. HLB 중국 남부에서 처음 알려졌다 고 40 다른 아시아, 아프리카, 오세아니아, 한국 및 북미 국가7확산 하고있다. 감귤 류 녹화는 경제 및 재정 손실 때문에 감귤 류의 과일 손실; 위협 세계적인 문제 따라서, ACP의 관리는 방지 하 고 HLB 제어 매우 중요 간주 됩니다.
이러한 해충의 효과적인 제어를 위한 조치는 일반적으로 비교적 짧은 화학 살충제의 응용 프로그램 살 필요 합니다. 화학 살충제 제어 전략 종종 안전 환경 관리 전략 부족 또는 유해물 인구8,9농약 저항으로 인해 민감성을 감소. 따라서, 분자 biopesticides 가진 유해물의 생물학 통제는 잠재적인 대안 이다, 하지만 그것의 사용은 세계적으로 겸손, 남아 및 parasitoids (예를 들어, Trisolcus 나무)의 다양 한 종 자연 생물으로도 효과적일 수 있습니다. 제어 합니다. RNAi 분자 biopesticides10침략 적인 해충을 관리 하기 위한 기술을 신흥 잠재력 이다. RNAi는 결국 리드는 mRNA에 유전자 발현의 규칙 순서 특정 방식에서 dsRNAs 침입 뿐만 아니라 내 생의 효과적인 posttranscriptional 유전자 입을 용이 하 게 잘 설명된 유전자 규제 메커니즘 레벨11,12. 간단히, 외 인 dsRNA는 siRNAs에 bidentate nuclease RNase III superfamily의 구성원에 의해 처리 되는 셀에 내 면, 진화론에 벌레, 파리, 식물, 균 류, 포유류13, 보존 Dicer 호출 14 , 15.이 21-25의 뉴클레오티드 siRNA duplexes 다음 해제 및 RNAs를 가이드로 RNA 유도 입을 복잡 한 (RISC)에 통합. 이 RISC RNA 복잡 한 Watson 근육 경련 기본적인 쌍 수 하는 보완 대상 mRNA; 이 결국 지도 한다 분열 Argonaute 단백질, 멀티 도메인 단백질 저하 해당 mRNA 및 단백질 번역, 그로 인하여 입을16 posttranscriptional 유전자로 이어지는 감소는 RNase H-같은 도메인을 포함 하 여 , 17 , 18.
해충 관리를 위한 RNAi siRNA 통로 활성화 함으로써 dsRNA에서 vivo에서 , 관심사의 유전자를 침묵의 도입을 필요 합니다. 곤충 및 곤충 세포 dsRNA 배달 조직의 RNAi를 유도 하기 위해 사용 된 다양 한 방법이 포함10,19,20,21, microinjection22, 사업자 리 같은 몸으로 먹이 23, 그리고24다른 기술. RNAi 화재로 unc-22 유전자 발현을 침묵 하 꼬마 선 충 에서 처음 되었고 멜로25, 최저 초파리 melanogaster26에 frizzled 유전자의 표현에 의해 따라. 초기 기능 연구 활용 곤충, Apis mellifera22,27,28 Acyrthosiphon pisum, Blattella germanica29, dsRNA를 제공 microinjection H. halys30및 (Terenius 그 외 여러분 검토 lepidopteran 곤충 31). microinjection 곤충에 대 한 관심의 사이트를 정확 하 고 정확한 복용량을 제공 하는. 비록 같은 정화 조 자국 농업 biopesticides 개발에서의 실용성을 배제 외상32, 그러므로, 때문에 면역 관련된 유전자의 표정을 유도 수 있습니다.
DsRNA에서 vivo에서 제공 하는 또 다른 방법은입니다 몸을 담근 채, 섭취 또는 흡수 dsRNA의 동물 또는 세포의 dsRNA를 포함 하는 extracellular 매체에서 일반적으로 포함. 효율적으로 침묵 C. 선 충 뿐만 아니라 하류로의 Raf1 (DSOR1) 물질 활성화 한 단백질 키 니 아 제 키 니 아 제 (MAPKK)20, 억제 하기 위해 초파리 S2 조직 배양 세포에서 RNAi를 유도 하는 데 사용 되었습니다 젖어 pos-1 진33. 그러나, 몸으로 사용 하 여 배달 dsRNA microinjection20에 비해 RNAi를 유도 하는 것 덜 효율적입니다. RNAi 중재 씹는 곤충에 입을 인공 한 천 다이어트10으로 dsRNA를 일으키는 여 서 부 옥수수 rootworm (WCR) (Diabrotica virgifera virgifera)에 먼저 보였다. 이전 보고서는 dsRNA 절지동물34특정 자연 다이어트에 주입을 제공 하는 방법을 요약 있다. 이러한 전달 방법 추가 배달;의 인위적인 수단을 대 등 하 게 효과적일 수 결정 등 어디 동등한 최저 면역 관련 유전자의 dsRNA 혈액 식사 또는 microinjected35를 통해 전달 했다 때 관찰 되었다 체체파리 비행 (Glossina morsitans morsitans)의 경우. 마찬가지로, 꿀 꿀벌38,39 뿐만 아니라 밝은 갈색 애플 엄 (Epiphyas postvittana)36, 다이아몬드 나 방 (이용한 배 xylostella) 애벌레37, 방울 통해 dsRNA의 납품 효율적인 RNAi를 유도. 호스트 식물의 혈관 조직을 통해 전달 해야 합니다 때문에, hemipteran 곤충에 dsRNA의 구두 전달 힘든 때문에 hemipteran에 가장 효과적인 RNAi 실험 dsRNA40 의 주입 활용가. 효과적인 RNAi 또한 ACP와 유리 날개 사격의 명 수 leafhopper (GWSS) Homalodisca vitripennis에서 관찰 되었다: dsRNA 감귤 류와 루트 물 약, 잎을 통해 혈관 조직으로 dsRNA를 흡수 했다 포도 덩굴을 통해 전달 했다 스프레이, 트렁크 주사, 또는 절단41,,4243,44,45,46에 의해 흡수. 이것 또한 dsRNA ACP (2016, 미국 20170211082 A1)에 대 한 첫 번째 특허 귀착되는. SiRNA 나노 입자 등 리 캐리어를 사용 하 여 dsRNA의 납품 부여 안정성, 그리고 전달된의 dsRNA 효능 증가23,,4748,49 신흥 빠르게 ,50. 나노 기반 배달 차량의 생체 외에서 그리고 vivo에서 적당 한 배달 벡터51로 치료 응용 프로그램 엄청난 잠재력을 얻으며 수 있습니다에 대 한 구체적으로 요약 했다에 대 한 핵 산에 대 한 새로운 클래스. DsRNA에 대 한 배달 차량으로 나노 입자 용 해도, hydrophobicity, 또는 제한 된 bioaccumulation52를 포함 하 여 단점 있지만 적당 한 폴리머 탈출 배달 이러한 단점을 보상 수 있습니다. 개발 및 자체 제공 뉴클레오티드의 사용 이라는 '센스 oligonucleotides', 단일 좌초 RNA/DNA 쌍 신 회로46는 등장도 하고있다.
절지동물에 vitellogenesis 키가는 체 지방; Vg 합성의 주요 inducers 복제 제어 과정 및 젊은 호르몬 (JH) 또는 ecdysone 규제, Vg는 결국 Vg 수용 체 중재 된 endocytosis53통해 개발 oocyte에 의해 촬영. Vg은 polypeptides의 그룹 합성 extraovarially vitellin54,55, 주요 계란 노 른 자 단백질의 개발을 위한 필수 이며 따라서, 재생산 및 노화56에 중요 하다. Vg은 nematodes57 에 성공적으로 침묵 되었다 뿐 아니라 꿀벌 (Apis mellifera) 어디 RNAi 중재 Vg의 고갈에서에서 성인과 계란22에서 관찰 되었다. RNAi 그것의 고갈 같은 관찰 phenotypic 영향으로 이어질 것으로 생각 되었다 때문에 시험 되었다 중재 posttranscriptional 유전자 Vg의 입을 감소 산과 통치, 잠재적으로 BMSB 제어에 도움. JHAMT 유전자 인코딩하는 S-adenosyl-L-메티오닌 (SAM)-종속 JH 산 O-methyltransferase, JH 생 합성 통로58의 마지막 단계를 catalyzes. 이 통로 farnesyl 파이 인산 (FPP)는 순차적으로 farnesol에서 farnesoic 산 JHAMT에 의해 JH 메 틸 farnesoate의 변환 다음에 변형 됩니다. 이 통로 곤충 변 태 호르몬59,,6061에 의해 규제 발달 과정에 맞게 절지동물에 보존 됩니다. B. 모리, JHAMT 유전자 발현 및 Corpora allata에 JH 생 합성 활동 제안 JHAMT 유전자의 transcriptional 억제 JH 생 합성58의 종료에 대 한 결정적 이다. 따라서, JHAMT 및 Vg 유전자 RNAi를 사용 하 여 대상된 고갈에 대 한 선정 됐다. RNAi는 ACP와 GWSS의 제어를 위한 감귤 나무에서 또한 시험 되었다. 감귤 나무 dsRNA 루트 물 약을 통해 치료 했다, dsRNAs 곤충 특정 아르기닌 키 (AK) 녹취 록42,44에 대 한와 잎 스프레이 뿐만 아니라 탭 (트렁크 주사), 줄기. 감귤 나무, 식물 혈관 조직을 통해 효율적인 납품을 나타내는 고 귀착되 었 다 ACP GWSS41,42, 에서 사망률 증가의 캐노피 온통 dsRNA의 국 소 응용 프로그램 검색 되었습니다. 45.
현재 연구에서 우리는 dsRNA 등 치료에 대 한 자연 식단 배달 방법을 확인 했습니다. 새로 개발된 된이 기술은 이후 JHAMT 및 Vg 입을 사용 되었다 mRNA 유전자 특정 dsRNAs BMSB로 nymphs에 사용 하 여 이전62시연. 여기 설명 이러한 새로운 배달 프로토콜 국 소 스프레이 또는 microinjections를 사용 하는 기존 RNA 배달 시스템을 대체 합니다. 야채와 과일, 줄기 탭, 토양에는 억 수 같이 쏟아지는, 및 찰 흙 absorbents에서 사용할 수 있습니다 전달의 dsRNA,이 중국 해충 및 병원 체 관리의 지속적인된 발전에 매우 중요.

<table border="0" cellpadding="0" cellspacing="0" width="678">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">BMSB (H. halys) insects&#160;</td>
			<td style="width:176px;">USDA</td>
			<td style="width:119px;"></td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">ACP (D. citri) insects&#160;</td>
			<td style="width:176px;">USDA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">organic green beans</td>
			<td style="width:176px;">N/A</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Citrus plants</td>
			<td style="width:176px;">USDA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">sodium hypochlorite solution</td>
			<td>J.T. Baker</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">green food coloring&#160;</td>
			<td>McCormick &#38; Co., Inc</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Thermo Forma chambers&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Magenta vessel (Culture)</td>
			<td style="width:176px;">Sigma</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Primers&#160;</td>
			<td style="width:176px;">IDT DNA</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SensiMix SYBR</td>
			<td style="width:176px;">Bioline</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">qPCR ABI 7500</td>
			<td>Applied Biosystems&#160;</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Spray bottle</td>
			<td style="width:176px;">N/A</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Parafilm</td>
			<td>American Can Company</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">TaKaRa Ex Taq</td>
			<td style="width:176px;">Clontech</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">QIAquick</td>
			<td style="width:176px;">Qiagen</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

double-stranded rna oral delivery methods to induce rna interference in phloem and plant-sap-feeding hemipteran insects

체 관 부 및 식물 sap 먹이 곤충 침략 작물과 식량 작물을 손상 하는 과정에서 영양소를 검색 하는 과일의 무결성. Hemipteran 곤충 체 관 부 수액에 먹이로 작물을 손상 하는 식물의 경제적으로 상당한 해충의 숫자에 대 한 계정. 갈색 marmorated 악취 버그 (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae)와 아시아 감귤 류 psyllid (ACP), Diaphorina citri 쿠 (Hemiptera: Liviidae)는 북미 지역에서 도입 hemipteran 해충 어디 그들은 그들은 실내 집계 때 고부가가치 전문, 행, 및 주식 작물 및 감귤 류 과일의 침략 농업 유해물으로 귀찮은 해충 있습니다. 많은 종에서 살충제 저항 해충 관리 전략의 대체 방법의 개발을 주도하 고 있다. 이중 가닥 RNA (dsRNA)-중재 RNA 간섭 (RNAi)는 해충의 관리를 위한 공구로 잠재적인 응용 프로그램을 기능 게놈 연구에 대 한 메커니즘을 입을 유전자. 것 합성된 dsRNA 또는 작은 간섭 RNA (siRNA)은 동종 제시 하는 내 생 RNA의 저하를 통해 매우 효율적인 유전자 침묵 하는 것을 실행할 수 있습니다. 효과적이 고 환경으로 사용 RNAi 분자 biopesticides biocontrol hemipteran 곤충의 대 한 먹이 통해 dsRNAs 비보에 전달을 해야합니다. 여기 곤충 dsRNA의 납품을 위한 방법 제시: 침수로 녹색 콩으로 dsRNA의 로드 하 고 섭취를 통해 구두 전달 유전자 특정 dsRNA의 흡수. 우리는 또한 비-유전자 변형 식물 배달 방법을 사용 하 여 잎 스프레이, 루트 물 약, 트렁크 주사 뿐만 아니라 찰 흙과 립, 모두의 dsRNA의 지속적인된 출시에 필수적인 수 있습니다 설명 했습니다. 구두로 섭취 dsRNA에 의해 효율적인 배달 타겟된 유전자, 청소년 호르몬 산 O-methyltransferase 등 (JHAMT)와 vitellogenin (Vg)의 표현에 상당한 감소를 유도 하는 효과적인 복용량으로 확인 됐다. 이러한 혁신적인 방법 해충 관리에 대 한 환경 문제를 극복 하 고 작물 보호에 사용 하는 dsRNA의 납품에 대 한 전략을 나타냅니다.

BMSB 4회 탈피 님프에 먹이 통해 야채 중재 dsRNA 배달 분자 biopesticides RNAi를 사용 하 여 침입 곤충 해충에 대 한 개발에 대 한 테스트를 했다. BMSBs 피드로 알려진 메커니즘에 의해 그들의 바늘 같은 stylets를 사용 하 여 입힌 고 플 러쉬, 어떤 작물에 상당한 손상을 초래. 슬림 유기 녹색 콩, P. vulgaris L., 영양소 또는 dsRNA 전달 될 수 있는 비보에 BMSB에 먹이3테스트에 사용 되었다. 녹두의 세그먼트는 DNase/RNase 무료 물 또는 물과 녹색 식용 색소 BMSB (그림 1A)에서 배달 테스트 솔루션에 몰두 했다. 녹색 식용 색소는 dsRNA를 모방 하는 시각적 표시로 사용 되었다. 녹색 콩의 혈관 조직 모 세관 작용62여 녹색 식용 색소는 체 관 부를 통해 녹색 색깔된 해결책의 흐름 때문으로 포화 되었다. BMSB nymphs 녹두 (그림 1B)의 혈관 조직에 그들의 stylets를 삽입 하 여 녹색 콩의 세그먼트에 먹이 것이 보였다. 녹색 컬러 배설물 방울 곤충을 전달된 소재 했다 구두로 섭취 하 고 배설 (그림 1C, D 전에 용기를 통과 녹색 식품 색소를 나타내는 포화 콩에 지 루 했다에 2, 3 일 후 관찰 되었다 ).
이후 우리는 타겟된 유전자 발현의 상당한 소모 BMSB 섭취 통해 BMSB 특정 dsRNA의 그린 빈 중재 배달 사용 하 여 달성 하는 경우 테스트. 그린 빈 세그먼트 몰입 했다 고 흡수 0.067 µ g / µ L (DNase/RNase 무료 물 300 µ L에서 20 µ g) 또는 0.017 µ g / µ L (DNase/RNase 무료 물 300 µ L에 5 µ g) 체 외 합성 dsRNA BMSB JHAMT 및 Vg의 솔루션 각각. 녹두도 각각 컨트롤로 혼자 물, 0.067 µ g / µ L 또는 0.017 µ g / µ L LacZ dsRNA (모의)에 몰두 했다. 대 본 수준 JHAMT의 그 표현이 나타내는 정량 Pcr를 사용 하 여 평가 했다 및 Vg mRNA 크게 감소 했다 vivo에서 거의 4.5-그리고 2.2-fold, 각각 (그림 2A, B). 따라서, 결과 dsRNA 성공적인 RNAi를 유도 하기 위해 녹색 콩의 혈관 조직을 통해 전달 될 수 있습니다 나타냅니다.
또 다른 hemipteran 해충, 작물 양분 또는 dsRNA 치료의 성공적인 납품 야채를 사용 하 여 전달 될 수 있는 경우 테스트 또한 콜에 손상을 일으키는 할리 퀸 버그 (HB) (Murgantia histrionica), 배달 중재. 4회 탈피 HB nymphs 아기 collard 녹색 (브라시카 올레라케아 var먹이 수 있었습니다. 풀) 물 또는 녹색 식용 색소와 물 해결책에 몰두. 결과 표시 HB 먹이 섭취 했다 분명 배설물 (그림 3) 물에 야채를 섭취 하는 HB에 비해 그들의 녹색 색된 배설물에서 분명 했다 녹색 식용 색소.
살포 또는 루트/토양 식물 조직65,66의 모든 통풍 관 dsRNA에에서 결과 몸을 담글의 dsRNA의 과도 전달에 대 한 추가 기술. Sprayable RNAi 기반 제품 개발에 있으며 곧 승인이 가능할 수 있습니다. 스프레이 또는 루트 물 약을 사용 하 여 필드에 dsRNA의 납품 침입 곤충42,67관리에 도움이 될 수 있습니다. 전체 크기의 감귤 류 나무와 모 종 잎 스프레이, 또는 토양 또는 벌 거 벗은 루트 억 수 같이 쏟아지는, 각각 (그림 4)는 dsRNA에 노출 되었다. 결과 표시 dsRNAs 하거나 스프레이 하 여 전달 또는 토양/베어 루트 물 약 7 주 게시물 dsRNA42의 2 세대의 단일 노출에 대 한 감귤 류 식물 (높이 2.5 m)에서 검출 될 수 있습니다. 배달 및 psyllid dsRNA-AK (20 ng / µ L)의 섭취 30-45% (그림 4D)42psyllid 사망률 증가.
생체 외에서 복사할 dsRNA polyphagous 곤충 때44 같은 식물에 먹이 곤충에 의해 취득 될 수 있다 식물의 혈관 조직에 직접 유전자 특정 dsRNA의 줄기 탭 (트렁크 주사)를 사용 하 여 효율적으로 배달 될 수 있습니다 (그림 5). 트렁크 주사 하 여는 dsRNA에 노출 된 감귤 류 나무에 대 한는 dsRNA에서에서 검출 될 수 세 감귤 류 식물 (약 1 m 높이) 7 주 t DNase/RNase의 솔루션에 dsRNA의 1.7 mg/mL의 6 mL를 사용 하 여 단일 노출 무료 물 (그림 5A B). Hemipteran 곤충 체 관 부 먹이 다음 dsRNA 치료 이러한 호스트 식물에 피드 허용 되었다. dsRNA는 성공적으로 주입 하 고 사망률 dsRNA AK42에 먹 일 때 시연 ACP에 의해 섭취에 대 한 감귤 류 식물의 혈관 시스템을 통해 이동 가정.
생물 검정 2012 년 2008 년부터 개발, 다양 한 화분 상영 되었고 dsRNA는 식물이 흡수 하 고 조직의 dsRNA 보급41,42 dsRNA 이동 방식으로 납품을 제공 하기 위해 표시 . 한 가지 방법은 점토 매트릭스;으로 dsRNA 흡착과 찰 흙 흡수 성 구성 요소를 사용 이 뿐 아니라 다른 흡수 성 재료, 셀 루 로스, agars, 바이오 플라스틱, 점토, 풀러의 지구, 비 석, 및 다른 사람의 광범위 한 포함 등 점토 입자 보균자 먼지 무료 핵 산 활성 성분을 전달 하는 데 사용할 수 있습니다 토양 식물 통풍 관 및 궁극적으로 곤충 (그림 6) 배달을 위한 dsRNA 등. 복잡 한 찰 흙 특정 pH 또는 이온 조건 dsRNA 출시 화학적 구성 수 있습니다 또한. 식물으로 dsRNA의 클레이 전달 방법 dsRNA에 화분에 심은 감귤 나무, 및 14 개월 (데이터 표시 되지 않음) 다른 식물을 제공 표시 되었습니다. 이 전달 시스템 등 꽃 색, 식물 높이 (압도), 또는 다른 사람 식물 특성을 변경 사용할 수 있습니다. 현재,이 방법의 기본 사용은 효과적인 곤충 해충 및 병원 체 (바이러스) 제어 또는 관리의 개발입니다. 접근은 보육원 및 주택 소유자, 비용 효과적인 수 있으며 비-유전자 변형 방법입니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57390/57390fig1.jpg"> 그림 1 . 영양분 이나 녹두 통해 dsRNA의 납품. (A) 슬림 유기 녹색 콩의 몰입 했다 선분과 ddH2O 혼자 또는 ddH2O 3 h에 대 한 녹색 식용 색소와 300 µ L을 포함 하는 2 mL microcentrifuge 튜브에 솔루션을 흡수. 3 4회 탈피 BMSB nymphs 24 h에 대 한 굶 어 고 선박 당 3 녹두와 함께 문화 용기에 배치. (B) BMSB 녹두 물에 그들의 stylets와 영양소를 도달 하는 녹색 콩을 통해 피어 싱으로 몰입의 세그먼트에 피드. (C) 하루 2 생물 먹이 BMSB의 화살표 표시 배설물. (D) 주 3; (화살표로 표시) 증가 BMSB 배설물 관찰 ddH2O의 솔루션의 게시물 섭취와 녹색 식용 색소 녹색 콩을 통해. <a href="/files/ftp_upload/57390/57390fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57390/57390fig2.jpg"> 그림 2 . JHAMT 및 BMSB에 Vg의 고갈 RNAi 중재 후 대 본의 수준을 측정 하 양적 RT-PCR 분석. 3 개별 BMSB 4회 탈피 nymphs에서 총 RNA 20 µ g (0.067 µ g / µ L), JHAMT (A)에 먹이 Vg (B) 5 µ g (0.017 µ g / µ L) dsRNAs ddH2O의 300 µ L에 녹두의 세그먼트를 통해 전달, 격리 및 대 본 수준 정량에 의해 측정 되었다. LacZ dsRNA (모의) 부정적인 컨트롤로 제공 됩니다. BMSB 18s RNA는 조직에서 RNA 복구에 차이 대 한 수정 하는 내부 표준으로 사용 되었다. 결과 보고 3 생물 복제에서 그리고 오차 막대 표시 SEM. 단방향 분산 분석 (ANOVA) 데이터, p < 0.0001의 통계적 의미에 대 한 테스트를 수행 했습니다. Ghosh 외 에서 재현 하는 결과 62 <a href="/files/ftp_upload/57390/57390fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57390/57390fig3.jpg"> 그림 3 . 할리 퀸 버그에서 치료의 구두 전달 (M. histrionica ) 아기 collard 녹색을 사용 하 여. 오가닉 베이비 collard 녹색 했다 0.2% 염소로 세척, 손질, 및 포함 하는 (A) DNase/RNase 무료 ddH2O, 또는 (B) DNase/RNase 무료 ddH2의 솔루션의 300 µ L 2 mL 모자 없는 microcentrifuge 튜브에 O 솔루션 3 h 동안 녹색 식용 색소. 3 4 탈피 HB nymphs 24 h에 대 한 굶 어 하 고 문화 혈관에 배치 되었고 이러한 collard 녹색에 3 일 동안 먹을 수 있습니다. 흰색 화살표는 하루 3 게시물 먹이 배설물을 나타냅니다. <a href="/files/ftp_upload/57390/57390fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57390/57390fig4.jpg"> 그림 4 . 잎 스프레이 루트 물 감귤 류 나무와 묘에서 응용 프로그램 약. 선택 된 식물 또는 묘 이전 사용 하는 토양 습기를 하지만 완전히 건조 건조 수 있도록 2-3 일 동안 물을 하지. (A) 나무 했다 처음 그리고 낮은 속의 dsRNA 솔루션 (0.5 mg/mL) DNase/RNase 무료 물이 200 mL 적용 손으로 펌프 스프레이 병. (B) 100 mL dsRNA의 솔루션 (1 mg/mL) DNase/RNase 무료 물에 부분적으로 건조 토양에서 묘 목의 토양에 적용 되었습니다. (C)의 dsRNA 솔루션 (1 mg/mL) DNase/RNase 무료 물 약 3 헤 (D)에 대 한 모 종의 벌 거 벗은 뿌리에 적용 된 100 mL ACP dsRNA 벌 거 벗은 뿌리에 의해 흡수 했다 묘 종에 먹이 ACP 사망률을 증가 보였다. <a href="/files/ftp_upload/57390/57390fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57390/57390fig5.jpg"> 그림 5 . 감귤 류의 묘 종 트리 트렁크 주입. 감귤 류의 묘 높이 약 1 m 1.7 mg/mL의 dsRNA 주입 했다. (A) 드릴 구멍에 감귤 묘 목 10 m m 직경 드릴 비트를 사용 하 여 식물의 줄기에는 인젝터를 삽입. 노출된 구리 팁 각 인젝터의 누설을 방지 하기 위하여 필름을 씰링의 0.6 cm (¼ 인치) 넓은 스트립으로 포장 했다. (B) 인젝터 컬러 솔루션의 6 mL 가득 묘 목의 줄기 (트렁크)에 적용 했다. 인젝터는 솔루션의 완전 한 이해에 대 한 약 6-10 h에 대 한 장소에 남아 있었다. <a href="/files/ftp_upload/57390/57390fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57390/57390fig6.jpg"> 그림 6 . 토양을 통해 식물에 dsRNA의 찰 흙 토양 개정 배달. 자료 제공의 새로운 라인: 점토 토양 식물 통풍 관에 대 한 dsRNA 같은 활성 성분에 사용 하기 위해 먼지 무료 핵 산 캐리어는 궁극적으로 곤충에. (A) Unbaked 찰 흙 및 (B) 구운 점토 묘사한 물 공차/보존. <a href="/files/ftp_upload/57390/57390fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="4">잠재적인 H. halys 대상 유전자</td>
		</tr>
<tr>
<td>재산 가치</td>
			<td>크기</td>
			<td colspan="2">유전자 이름/상 동</td>
		</tr>
<tr>
<td>XP_014293026.1</td>
			<td>491</td>
			<td colspan="2">
Vitellogenin-A1-처럼 (Vg) (가능한 isoforms: vitellogenin-2-같 은 isoform X1 XP_014291483.1; vitellogenin-2-같 은 isoform X2 XP_014291484.1).</td>
		</tr>
<tr>
<td>XP_014290953.1</td>
			<td>545</td>
			<td colspan="2">
청소년 호르몬 산 O methyltransferase 같은 (JHAMT) (가능한 체: 청소년 호르몬 산 O methyltransferase XP_014283772.1).</td>
		</tr>
<tr>
<td colspan="4">뇌관</td>
		</tr>
<tr>
<td colspan="4">PCR</td>
		</tr>
<tr>
<td>유전자 이름/상 동</td>
			<td>뇌관 이름</td>
			<td colspan="2">시퀀스</td>
		</tr>
<tr>
<td>Vg</td>
			<td>BMSB Vitellog P2 F</td>
			<td colspan="2">CAATTTGATCCACCGACTGTT</td>
		</tr>
<tr>
<td>Vg</td>
			<td>BMSB Vitellog P2 R</td>
			<td colspan="2">CCGCATGAATCTTACTCTGGA</td>
		</tr>
<tr>
<td>JHAMT</td>
			<td>BMSB JH P1 F</td>
			<td colspan="2">GGATGCTTATGAATAATCCAG</td>
		</tr>
<tr>
<td>JHAMT</td>
			<td>BMSB JH P1 R</td>
			<td colspan="2">GTATAGGATTGCCATTTTGG</td>
		</tr>
<tr>
<td colspan="4">T7 PCR</td>
		</tr>
<tr>
<td>Vg</td>
			<td>T7 BMSB Vitellog P2 4263 F</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGACCAAAGTTGGAAGGGAATGA</td>
		</tr>
<tr>
<td>Vg</td>
			<td>T7 BMSB Vitellog P2 4753 R</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGACCGCATGAATCTTACTCTGGA</td>
		</tr>
<tr>
<td>JHAMT</td>
			<td>BMSB JH T7 P1 F</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGAGGATGCTTATGAATAATCCAG</td>
		</tr>
<tr>
<td>JHAMT</td>
			<td>BMSB JH T7 P1 R</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGAGTATAGGATTGCCATTTTGG</td>
		</tr>
<tr>
<td>LacZ</td>
			<td>T7 LacZ RNAi F</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGATGAAAGCTGGCTACAGGA</td>
		</tr>
<tr>
<td>LacZ</td>
			<td>T7 LacZ RNAi 연구</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGAGCAGGCTTCTGCTTCAAT</td>
		</tr>
<tr>
<td>AK로</td>
			<td>dsAK-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGTGGCATTCTTGTATGGCGTA</td>
		</tr>
<tr>
<td>AK로</td>
			<td>dsAK-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGGCCTGCAAGAATCTGTCTCC</td>
		</tr>
<tr>
<td>AK로</td>
			<td>dsAK 50-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGTGGCATTCTTGTATGGCGTA</td>
		</tr>
<tr>
<td>AK로</td>
			<td>dsAK 50-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGTGAAGCCCTTGTGGTAGTC</td>
		</tr>
<tr>
<td>AK로</td>
			<td>dsAK 30-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGACCCGGACTCTGGAGTAGG</td>
		</tr>
<tr>
<td>AK로</td>
			<td>dsAK 30-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGGCCTGCAAGAATCTGTCTCC</td>
		</tr>
<tr>
<td>GFP</td>
			<td>dsGFP-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGCCAACACTTGTCACTACTTTCTCTT</td>
		</tr>
<tr>
<td>GFP</td>
			<td>dsGFP-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGGTAATGGTTGTCTGGTAAAAGGA</td>
		</tr>
<tr>
<td colspan="4">정량</td>
		</tr>
<tr>
<td>Vg</td>
			<td>RT Vitellog P2 F</td>
			<td colspan="2">TTGATAGTTGTTTGGATTTTGAAGGT</td>
		</tr>
<tr>
<td>Vg</td>
			<td>RT Vitellog p 2 R</td>
			<td colspan="2">TCTTACTTGATCAGCGCTCAGAA</td>
		</tr>
<tr>
<td>JHAMT</td>
			<td>BMSB JH RT P1 F</td>
			<td colspan="2">AGGAAAACCCAAAATGGCAAT</td>
		</tr>
<tr>
<td>JHAMT</td>
			<td>BMSB JH RT P1 R</td>
			<td colspan="2">ATGTATTCTTCTTTTGGATCTTTTCTTGAG</td>
		</tr>
<tr>
<td>18S</td>
			<td>BMSB 18S F3</td>
			<td colspan="2">ATGCCCCCGCCTGTCCTTATT</td>
		</tr>
<tr>
<td>18S</td>
			<td>BMSB 18S R3</td>
			<td colspan="2">TGAAAGCAGCCTGAATAGTGG</td>
		</tr>
<tr>
<td>GFP</td>
			<td>GFP-F</td>
			<td colspan="2">GGTAAAAGGACAGGGCCATC</td>
		</tr>
<tr>
<td>GFP</td>
			<td>GFP-R</td>
			<td colspan="2">TCAAGGAGGACGGAAACATC</td>
		</tr>
<tr>
<td>AK로</td>
			<td>Ak로 양의 F</td>
			<td colspan="2">CGGACTTGAGGGAGAACTGA</td>
		</tr>
<tr>
<td>AK로</td>
			<td>Ak로 양의-R</td>
			<td colspan="2">GTGGTAGATACCGCGACCAG</td>
		</tr>
<tr>
<td>-욕조</td>
			<td>-욕조-F</td>
			<td colspan="2">GCGTCTCTTCGGTTTGACGG</td>
		</tr>
<tr>
<td>-욕조</td>
			<td>-욕조-R</td>
			<td colspan="2">CACTTCACCATCTGGTTGGC</td>
		</tr>
</tbody></table>표 1입니다. RNAi에 대 한 oligonucleotide 시퀀스입니다. 유전자와 oligonucleotides 성적 수준을 분석 하 PCR 파편, dsRNA, 및 정량 Pcr 뇌관을 생성 하는 데 사용 되는 나열 된.
보충 비디오 1: Agars와 absorbents 납품 및 dsRNA의 지속적인된 출시로 젤. 하이드레이션 합성 또는 자연 agars 및 젤 dsRNA 솔루션을 다양 한 절지동물에 대 한 미끼 또는 다이어트로 사용할 수 있습니다. <a href="/files/ftp_upload/57390/Supplementary_Video_1.mov">이 비디오를 다운로드 하려면 여기를 클릭 하십시오</a>

Watch this Scientific Journal Video about Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects at JoVE.com

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

체 관 부 식물 수액 공급 Hemipteran 곤충에 RNA 간섭을 유도 하 이중 가닥 RNA 구두 전달 방법

이 문서에는 RNA 간섭 (RNAi) 곤충 먹이 체 관 부 수액에 대 한 식물의 혈관 조직을 통해 이중 가닥 RNA (dsRNA)의 구두 납품을 위해 개발 된 새로운 기술을 보여 줍니다.

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran ...

double-stranded-rna-oral-delivery-methods-to-induce-rna-interference

Nanyang Technological University

Research

JoVE Journal

Environment

13.7K 조회수.  United States Department of Agriculture. 이 문서에는 RNA 간섭 (RNAi) 곤충 먹이 체 관 부 수액에 대 한 식물의 혈관 조직을 통해 이중 가닥 RNA (dsRNA)의 구두 납품을 위해 개발 된 새로운 기술을 보여 줍니다.

비디오: Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

Optimize Flue Gas Settings to Promote Microalgae Growth in Photobioreactors via Computer Simulations

Flue gas from power plants can promote algal cultivation and reduce greenhouse gas emissions1. Microalgae not only capture solar energy more efficiently than plants3, but also synthesize advanced biofuels2-4. Generally, atmospheric CO2 is not a sufficient source for supporting maximal algal growth5. On the other hand, the high concentrations of CO2 in industrial exhaust gases have adverse effects on algal physiology. Consequently, both cultivation conditions (such as nutrients and light) and the control of the flue gas flow into the photo-bioreactors are important to develop an efficient &ldquo;flue gas to algae&rdquo; system. Researchers have proposed different photobioreactor configurations4,6 and cultivation strategies7,8 with flue gas. Here, we present a protocol that demonstrates how to use models to predict the microalgal growth in response to flue gas settings. We perform both experimental illustration and model simulations to determine the favorable conditions for algal growth with flue gas. We develop a Monod-based model coupled with mass transfer and light intensity equations to simulate the microalgal growth in a homogenous photo-bioreactor. The model simulation compares algal growth and flue gas consumptions under different flue-gas settings. The model illustrates: 1) how algal growth is influenced by different volumetric mass transfer coefficients of CO2; 2) how we can find optimal CO2 concentration for algal growth via the dynamic optimization approach (DOA); 3) how we can design a rectangular on-off flue gas pulse to promote algal biomass growth and to reduce the usage of flue gas. On the experimental side, we present a protocol for growing Chlorella under the flue gas (generated by natural gas combustion). The experimental results qualitatively validate the model predictions that the high frequency flue gas pulses can significantly improve algal cultivation.

Flue gas from power plants is a cheap CO2 source for algal growth. We have built prototype &#34;flue gas to algal cultivation&#34; systems and described how to scale up the algal cultivation process. We have demonstrated the use of a mass-transfer bio-reaction model to simulate and to design the optimal operation of flue gas for the growth of Chlorella sp. in algal photo-bioreactors.

컴퓨터 시뮬레이션을 통해 광 바이오 반응기에서 미세 조류의 성장을 촉진하기 위해 연소 가스 설정을 최적화

Flue gas from power plants can promote algal cultivation and reduce greenhouse gas emissions1. Microalgae not only capture solar energy more efficiently ...

연구

환경과학

A New Application of the Electrical Penetration Graph (EPG) for Acquiring and Measuring Electrical Signals in Phloem Sieve Elements

Electrophysiological properties of cells are often studied in vitro, after dissociating them from their native environments. However, the study of electrical transmission between distant cells in an organism requires in vivo, artifact-free recordings of cells embedded within their native environment. The transmission of electrical signals from wounded to unwounded areas in a plant has since long piqued the interest of botanists. The phloem, the living part of the plant vasculature that is spread throughout the plant, has been postulated as a major tissue in electrical transmission in plants. The lack of suitable electrophysiological methods poses many challenges for the study of the electrical properties of the phloem cells in vivo. Here we present a novel approach for intracellular electrophysiology of sieve elements (SEs) that uses living aphids, or other phloem-feeding hemipteran insects, integrated in the electrical penetration graph (EPG) circuit. The versatility, robustness, and accuracy of this method made it possible to record and study in detail the wound-induced electrical signals in SEs of central veins of the model plant Arabidopsis thaliana1. Here we show that EPG-electrodes can be easily implemented for intracellular electrophysiological recordings of SEs in marginal veins, as well as to study the capacity of SEs to respond with electrical signals to several external stimuli. The EPG approach applied to intracellular electrophysiology of SEs can be implemented to a wide variety of plant species, in a large number of plant/insect combinations, and for many research aims.

A New Application of the Electrical Penetration Graph EPG for Acquiring and Measuring Electrical Signals in Phloem Sieve Elements

Electrical Penetration Graph (EPG) is a well-established technique for studying the feeding behavior of stylet-bearing insects. Here we show a new application of EPG as a non-invasive tool for the acquisition of intracellular electrophysiology recordings of sieve elements (SEs), the cells that form the phloem vasculature in plants.

체관부 체 요소에 전기 신호를 획득 및 측정을위한 전기 침투 그래프 (EPG)의 새로운 응용 프로그램

Electrophysiological properties of cells are often studied in vitro, after dissociating them from their native environments. However, the study of ...

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with &#39;end-point&#39; PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. The methodology includes the co-extraction of DNA and RNA; preparation of DNA-free RNA; and 16S rRNA gene and transcript quantification via RT-q-PCR, including standard curve construction.

실시간 PCR에 의한 연안 퇴적물 및 정량 16S의 rRNA의 유전자 및 성적 증명서에서 동시 DNA-RNA 추출

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

Methods of Soil Resampling to Monitor Changes in the Chemical Concentrations of Forest Soils

Recent soils research has shown that important chemical soil characteristics can change in less than a decade, often the result of broad environmental changes. Repeated sampling to monitor these changes in forest soils is a relatively new practice that is not well documented in the literature and has only recently been broadly embraced by the scientific community. The objective of this protocol is therefore to synthesize the latest information on methods of soil resampling in a format that can be used to design and implement a soil monitoring program. Successful monitoring of forest soils requires that a study unit be defined within an area of forested land that can be characterized with replicate sampling locations. A resampling interval of 5 years is recommended, but if monitoring is done to evaluate a specific environmental driver, the rate of change expected in that driver should be taken into consideration. Here, we show that the sampling of the profile can be done by horizon where boundaries can be clearly identified and horizons are sufficiently thick to remove soil without contamination from horizons above or below. Otherwise, sampling can be done by depth interval. Archiving of sample for future reanalysis is a key step in avoiding analytical bias and providing the opportunity for additional analyses as new questions arise.

Repeated soil sampling has recently been shown to be an effective way to monitor forest soil change over years and decades. To support its use, a protocol is presented that synthesizes the latest information on soil resampling methods to aid in the design and implementation of successful soil monitoring programs.

Recent soils research has shown that important chemical soil characteristics can change in less than a decade, often the result of broad environmental ...

Data Processing Methods for 3D Seismic Imaging of Subsurface Volcanoes: Applications to the Tarim Flood Basalt

The morphology and structure of plumbing systems can provide key information on the eruption rate and style of basalt lava fields. The most powerful way to study subsurface geo-bodies is to use industrial 3D&#160;reflection seismological imaging. However, strategies to image subsurface volcanoes are very different from that of oil and gas reservoirs. In this study, we process seismic data cubes from the Northern Tarim Basin, China, to illustrate how to visualize sills through opacity rendering techniques and how to image the conduits by time-slicing. In the first case, we isolated probes by the seismic horizons marking the contacts between sills and encasing strata, applying opacity rendering techniques to extract sills from the seismic cube. The resulting detailed sill morphology shows that the flow direction is from the dome center to the rim. In the second seismic cube, we use time-slices to image the conduits, which corresponds to marked discontinuities within the encasing rocks. A set of time-slices obtained at different depths show that the Tarim flood basalts erupted from central volcanoes, fed by separate pipe-like conduits.

Three-dimensional (3D) reflection seismology is a powerful method for imaging subsurface volcanoes. By using industrial 3D seismological data from the Tarim Basin, we illustrate how to extract the sills and the conduits of subsurface volcanoes from seismic data cubes.

표면 화산 3 차원 지진 이미징 데이터 처리 방법: 응용 프로그램 타림 홍수 현무암을

The morphology and structure of plumbing systems can provide key information on the eruption rate and style of basalt lava fields. The most powerful way ...

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and rates of mortality in populations, which has a variety of applications in ecology, including agricultural ecosystems. Horizontal, or cohort-based, life tables provide for the most direct and accurate method of quantifying vital population rates because they follow a group of individuals in a population from birth to death. Here, protocols are presented for conducting and analyzing cohort-based life tables in the field that takes advantage of the sessile nature of the immature life stages of a global insect pest, Bemisia tabaci. Individual insects are located on the underside of cotton leaves and are marked by drawing a small circle around the insect with a non-toxic pen. This insect can then be observed repeatedly over time with the aid of hand lenses to measure development from one stage to the next and to identify stage-specific causes of death associated with natural and introduced mortality forces. Analyses explain how to correctly measure multiple mortality forces that act contemporaneously within each stage and how to use such data to provide meaningful population dynamic metrics. The method does not directly account for adult survival and reproduction, which limits inference to dynamics of immature stages. An example is presented that focused on measuring the impact of bottom-up (plant quality) and top-down (natural enemies) effects on the mortality dynamics of B. tabaci in the cotton system.

Methodology for Developing Life Tables for Sessile Insects in the Field Using the Whitefly, Bemisia tabaci, in Cotton As a Model System

Life tables allow quantification of the sources and rates of mortality in insect populations and contribute to understanding, predicting and manipulating population dynamics in agroecosystems. Methods for conducting and analyzing cohort-based life tables in the field for an insect with sessile immature life stages are presented.

Life tables provide a means of measuring the schedules of birth and death from populations over time. They also can be used to quantify the sources and ...

Experimental Methods of Dust Charging and Mobilization on Surfaces with Exposure to Ultraviolet Radiation or Plasmas

Electrostatic dust transport has been hypothesized to explain a number of observations of unusual planetary phenomena. Here, it is demonstrated using three recently developed experiments in which dust particles are exposed to thermal plasma with beam electrons, beam electrons only, or ultraviolet (UV) radiation only. The UV light source has a narrow bandwidth in wavelength centered at 172 nm. The beam electrons with the energy of 120 eV are created with a negatively biased hot filament. When the vacuum chamber is filled with the argon gas, a thermal plasma is created in addition to the electron beam. Insulating dust particles of a few tens of microns in diameter are used in the experiments. Dust particles are recorded to be lofted to a height up to a few centimeters with a launch speed up to 1 m/s. These experiments demonstrate that photo and/or secondary electron emission from a dusty surface changes the charging mechanism of dust particles. According to the recently developed &#34;patched charge model&#34;, the emitted electrons can be re-absorbed inside microcavities between neighboring dust particles below the surface, causing the accumulation of enhanced negative charges on the surrounding dust particles. The repulsive forces between these negatively charged particles may be large enough to mobilize and lift them off the surface. These experiments present the advanced understanding of dust charging and transport on dusty surfaces, and laid a foundation for future investigations of its role in the surface evolution of airless planetary bodies.

Dust charging and mobilization is demonstrated in three experiments with exposure to thermal plasma with beam electrons, beam electrons only, or ultraviolet (UV) radiation only. These experiments present the advanced understanding of electrostatic dust transport and its role in shaping the surfaces of airless planetary bodies.

먼지가 충전 및 자외선 또는 플라즈마에 노출 표면에 동원의 실험 방법

Electrostatic dust transport has been hypothesized to explain a number of observations of unusual planetary phenomena. Here, it is demonstrated using ...

Harvesting Venom Toxins from Assassin Bugs and Other Heteropteran Insects

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, and the majority of extant heteropterans retain this trophic strategy. Some heteropterans have transitioned to feeding on vertebrate blood (such as the kissing bugs, Triatominae; and bed bugs, Cimicidae) while others have reverted to feeding on plants (most Pentatomomorpha). However, with the exception of saliva used by kissing bugs to facilitate blood-feeding, little is known about heteropteran venoms compared to the venoms of spiders, scorpions and snakes.
One obstacle to the characterization of heteropteran venom toxins is the structure and function of the venom/labial glands, which are both morphologically complex and perform multiple biological roles (defense, prey capture, and extra-oral digestion). In this article, we describe three methods we have successfully used to collect heteropteran venoms. First, we present electrostimulation as a convenient way to collect venom that is often lethal when injected into prey animals, and which obviates contamination by glandular tissue. Second, we show that gentle harassment of animals is sufficient to produce venom extrusion from the proboscis and/or venom spitting in some groups of heteropterans. Third, we describe methods to harvest venom toxins by dissection of anaesthetized animals to obtain the venom glands. This method is complementary to other methods, as it may allow harvesting of toxins from taxa in which electrostimulation and harassment are ineffective. These protocols will enable researchers to harvest toxins from heteropteran insects for structure-function characterization and possible applications in medicine and agriculture.

Although many insects in the suborder Heteroptera (Insecta: Hemiptera) are venomous, their venom composition and the functions of their venom toxins are mostly unknown. This protocol describes methods to harvest heteropteran venoms for further characterization, using electrostimulation, harassment, and gland dissection.

독 독 소 암살자 버그와 다른 Heteropteran 곤충에서 수확

Heteropteran insects such as assassin bugs (Reduviidae) and giant water bugs (Belostomatidae) descended from a common predaceous and venomous ancestor, ...

Composition and Distribution Analysis of Bioaerosols Under Different Environmental Conditions

Variable microorganisms in particulate matter (PM) under different environmental conditions may have significant impacts on human health. In this study, we described a protocol for multiple analyses of the biological compositions in environmental PM. Five experiments are presented: (1) PM number monitoring by using a laser particle counter; (2) PM collection by using a cyclonic aerosol sampler; (3) PM collection by using a high-volume air sampler with filters; (4) culturable microbes collection by the Andersen six-stage sampler; and (5) detection of biological composition of environmental PM by bacterial 16SrDNA and fungal ITS region sequencing. We selected hazy days and a livestock farm as two typical examples of the application in this protocol. In this study, these two sampling methods, cyclonic aerosol sampler and filter sampler, showed different sampling efficiency. The cyclonic aerosol sampler performed much better in terms of collecting bacteria, while these two methods showed the same efficiency in collecting fungi. Filter samplers can work under low temperature conditions while cyclonic aerosol samplers have a sampling limitation for temperature. A solid impacting sampler, such as an Andersen six-stage sampler, can be used to sample bioaerosols directly into the culture medium, which increases the survival rate of culturable microorganisms. However, this method mainly relies on culture while more than 99% of microbes cannot be cultured. DNA extracted from the culturable bacteria collected by the Andersen six-stage sampler and samples collected by cyclonic aerosol sampler and filter sampler were detected by bacterial 16S rDNA and fungal ITS region sequencing.All the methods above may have wide application in many fields of study, such as environmental monitoring and airborne pathogen detection. From these results, we can conclude that these methods can be used under different conditions and may help other researchers further explore the health impacts of environmental bioaerosols.

Understanding the biological composition of environmental particulate matter is important for the study of its significant impacts on human health and disease spread. Here, we used three types of bioaerosol sampling methods and a biological analysis of airborne microbes to better explore airborne microbial communities under different environmental conditions.

구성 및 다른 환경 조건에서 Bioaerosols의 유통 분석

Variable microorganisms in particulate matter (PM) under different environmental conditions may have significant impacts on human health. In this study, ...

Leaf Area Index Estimation Using Three Distinct Methods in Pure Deciduous Stands

Accurate estimations of leaf area index (LAI), defined as half of the total leaf surface area per unit of horizontal ground surface area, are crucial for describing the vegetation structure in the fields of ecology, forestry, and agriculture. Therefore, procedures of three commercially used methods (litter traps, needle technique, and a plant canopy analyzer) for performing LAI estimation were presented step-by-step. Specific methodological approaches were compared, and their current advantages, controversies, challenges, and future perspectives were discussed in this protocol. Litter traps are usually deemed as the reference level. Both the needle technique and the plant canopy analyzer (e.g., LAI-2000) frequently underestimate LAI values in comparison with the reference. The needle technique is easy to use in deciduous stands where the litter completely decomposes each year (e.g., oak and beech stands). However, calibration based on litter traps or direct destructive methods is necessary. The plant canopy analyzer is a commonly used device for performing LAI estimation in ecology, forestry, and agriculture, but is subject to potential error due to foliage clumping and the contribution of woody elements in the field of view (FOV) of the sensor. Eliminating these potential error sources was discussed. The plant canopy analyzer is a very suitable device for performing LAI estimations at the high spatial level, observing a seasonal LAI dynamic, and for long-term monitoring of LAI.

An accurate estimation of leaf area index (LAI) is crucial for many models of material and energy fluxes within plant ecosystems and between an ecosystem and the atmospheric boundary layer. Therefore, three methods (litter traps, needle technique, and PCA) for taking precise LAI measurements were in the presented protocol.

순수 낙엽 스탠드에서 세 가지 뚜렷한 방법을 사용한 잎 영역 지수 추정

Accurate estimations of leaf area index (LAI), defined as half of the total leaf surface area per unit of horizontal ground surface area, are crucial for ...