Name: double-stranded rna oral delivery methods to induce rna interference in phloem and plant-sap-feeding hemipteran insects
Uploaded: 2018-05-04T14:00:00.000+00:00
Duration: 10 min 14 s
Description: Watch this Scientific Journal Video about Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects at JoVE.com

The authors gratefully acknowledge Donald Weber and Megan Herlihy (USDA, ARS Beltsville, MD) for providing BMSB and HB for experimentation and maintaining the colonies; and Maria T. Gonzalez, Salvador P. Lopez, (USDA, ARS, Fort Pierce, FL) and Jackie L. Metz (University of Florida, Fort Pierce, FL) for colony maintenance, sample preparation, and analyses.

1. BMSB Rearing
<ol>
	<li>Rear BMSB insects as per standard lab practice and previously described63.</li>
	<li>Raise ACP (D. citri) insects on Citrus macrophylla in a glasshouse (22 &#176;C) and natural light. Use adult ACP, at approximately 5-7 days post eclosion.</li>
</ol>
2. Selection of Gene Regions and In Vitro Synthesis of dsRNA
<ol>
	<li>Select genes specific to BMSB from previously published transcriptome profiles32.</li>
	<li>Ensure the regions of interest selected vary between 200 to 500 base pairs.</li>
	<li>Perform polymerase chain reaction (PCR) using the conditions described below to generate fragments associated with the selected gene of interest from genomic DNA. See Table 1 for the gene-specific oligonucleotides.
	<ol>
		<li>PCR reaction: In a 0.25 mL PCR tube, combine 5 &#181;L of 10X PCR Buffer, 4 &#181;L of dNTP Mixture (2.5 mM each), 2 &#181;L of DNA template (50 ng/&#181;L), 2.5 &#181;L each of Primers 1 and 2 (10 &#181;M), 0.25 &#181;L of DNA polymerase (5 U/&#181;L), and DNase/RNase free water up to 50 &#181;L.</li>
		<li>PCR condition: Cycle the PCR reaction to amplify the region of interest at 95 &#176;C for 3 min followed by 30 cycles of 98 &#176;C for 10 s, 55 &#176;C for 30 s, 72&#176;C for 1 min. Incubate the reaction at 72 &#176;C for an additional 10 min. Purify the PCR reaction using a purification kit.</li>
	</ol>
	</li>
	<li>Amplify the obtained PCR fragments further with gene specific primers flanked with the T7 RNA polymerase promoter sequence (5&#39;-GAA TTA ATA CGA CTC ACT ATA GGG AGA-3&#39;) as mentioned earlier62.</li>
	<li>Use LacZ gene as a negative control (mock) for RNAi. 
	NOTE: LacZ is a gene that encodes &#946;-galactosidase amplified from Escherichiacoli genomic DNA (the primers used are listed in Table 1).</li>
	<li>Perform in vitro transcription to yield dsRNA as described earlier62.</li>
	<li>Dissolve and resuspend the resulting dsRNA in 150 &#181;L DNase/RNase free water, measure the concentration, and store at -80 &#176;C for future use.</li>
</ol>
3. Delivery of dsRNA Using Green Beans
<ol>
	<li>Select early 4th instar BMSB nymphs hatched from the same egg mass and starve them for 24 h prior to dsRNA feeding.</li>
	<li>Select slender certified organic green beans (Phaseolus vulgaris L.) and wash with 0.2% sodium hypochlorite solution for 5 min. 
	NOTE: Slender green beans were selected so that the beans can easily be accommodated in the 2 mL microcentrifuge tubes.</li>
	<li>Wash 3 times with ddH2O and allow to air dry.</li>
	<li>Trim the green beans from the calyx end to a total length of 7.5 cm using a clean razor blade.</li>
	<li>Immerse the washed and trimmed green beans in a cap-less 2 mL microcentrifuge tube containing 300 &#181;L of control solution (a 1:10 dilution of green food coloring (ingredients: Water, Propylene Glycol, Fd&#38;C Yellow 5, Fd&#38;C Blue 1, and Propylparaben as preservative)).</li>
	<li>Make dilutions of the in vitro synthesized LacZ, JHAMT, or Vg dsRNAs by diluting 5 &#181;g or 20 &#181;g in 300 &#181;L of RNase/DNase free water to yield final concentrations of 0.017 &#181;g/&#181;L or 0.067 &#181;g/&#181;L, respectively.</li>
	<li>Immerse the washed and trimmed green beans in a cap-less 2 mL microcentrifuge tube containing 300 &#181;L of dsRNA solution (from step 3.6).</li>
	<li>Wrap and seal the edges of the microcentrifuge tubes enclosing the immersed beans to avoid evaporation of the dsRNA solution and to prevent the animals from entering the microcentrifuge tube.</li>
	<li>Position these tubes in an upright manner at room temperature for 3 h to allow the dsRNA solution to be loaded throughout the green bean by capillary action.</li>
	<li>Place these tubes in clean culture vessels (polypropylene). Place three starved 4th instar BMSB nymphs in the culture vessels.</li>
	<li>Treat three animals per culture vessel each containing three green beans with green food coloring or dsRNA solution. Maintain the insects at 25 &#176;C and 72% relative humidity, under a 16L:8D photoperiod in an incubator.</li>
	<li>Allow the insects to feed on the green beans (immersed and absorbed with dsRNA) for 5 days but replenish with fresh diets of dsRNA treatment green beads after 3 days.</li>
</ol>
4. Real-time Quantitative (qPCR) Analysis of Gene Expression Following RNAi Mediated Silencing in BMSB
<ol>
	<li>Measure the effect of RNAi on the levels of transcript expression by qPCR.</li>
	<li>Isolate the total RNA from the dsRNA treated animals and synthesize the cDNA62.</li>
	<li>Setup the qPCR reactions using a real-time PCR system and the primers listed in Table 1. Use the following qPCR cycling condition: 95 &#176;C for 10 min followed by 40 cycles of 95 &#176;C for 15 s, 60 &#176;C for 1 min, along with dissociation step including 95 &#176;C for 15 s, 60 &#176;C for 1 min, 95 &#176;C for 15 s, and 60 &#176;C for 15 s.</li>
	<li>Determine the qPCR standards: use the serial dilution of cDNA prepared from total RNA isolated from a normal animal as a reference standard for the quantification.</li>
	<li>Use BMSB 18s RNA as an internal standard to correct for differences in RNA recovery from tissues32.</li>
</ol>
5. Foliar Spray Application in Large Potted Citrus Trees and Seedlings
Note: Plants of the citrus cultivar &#39;Carrizo&#39; citrange (Citrus sinensis XPoncirus trifoliata, Rutaceae), were maintained in a glasshouse under natural light and temperature, grown in 1.2 L containers. The plants were constantly pruned to promote growth of new foliar shoots, called &#39;flush&#39;. ACP prefers to feed and oviposition on the new growth of citrus64.
<ol>
	<li>Select plants or seedlings and do not water them for 2-3 days prior to use to let the soil dry out to damp but not completely dry.</li>
	<li>Using a hand pump spray bottle apply a 200 mL of dsRNA solution (0.5 mg/mL) to the lower canopy (Figure 4A). 
	NOTE: Prepare the above mentioned dsRNA solutions in DNase/RNase free water.</li>
	<li>Post-spray application, allow the applied dsRNA solution to be completely absorbed by the leaves. 
	NOTE: Citrus trees absorbed the applied dsRNA, and then leaves from either new growth or from branches that were covered prior to application, were extracted; the dsRNA was detectable using qPCR and showed systemic movement into the tree top canopy leaves in 3-4 h44,45,46.</li>
	<li>Sample the new growth from previously topped trees after 25-40 days by collecting approximately 10 leaves from the tips of four branches. Extract the total RNA and analyze it by reverse transcription PCR (RT-PCR) and qPCR for the presence of the applied dsRNA trigger using the primers listed in Table 1 and previously described methods46. 
	NOTE: The sample collection, total RNA isolation, RT-PCR, and qPCR were performed as previously described46.</li>
	<li>Similarly, topically spray 10 mL dsRNA to the lower region of a seedling or small potted tree foliage. 
	NOTE: Hemipteran insects (ACP and GWSS) were given feeding access normally at 24 h, post treatments on new growth (leaves) which had not been directly sprayed, or which grew weeks later, or whole plants. This produced insects which tested positive for the dsRNA at 3, 6, and 10 days, post feeding.</li>
</ol>
6. Soil/Root Drench Application in Large or Small Potted Citrus Trees and Seedlings
<ol>
	<li>Select plants or seedlings and do not water them for 2-3 days prior to use to let the soil dry out to damp but not completely dry (this creates air space to hold the liquid solution to be applied).</li>
	<li>Add 1 L of dsRNA solution (0.2 mg/mL) to the soil of large potted plants (approximately 2.5 m) and add 1 L of water (chaser) after 1 h.</li>
	<li>Apply 100 mL of dsRNA solution (1.33 mg/mL) to the soil of 1 m tall potted trees in partially dry soils.</li>
	<li>For small seedlings, apply 10 mL of dsRNA solution (1 mg/mL) to the soil in the cones or to the bare roots (Figure 4B, C).</li>
	<li>Allow the plants that receive the dsRNA solution applied as a soil drench to soak for 30 min. Then apply plain water only treatment to aid absorption by roots (20 mL for plants in yellow containers, or 100 mL if larger plant pots are &#62; 1 gallon). 
	NOTE: Topically applied dsRNA to foliage resulted in detection at most distal tips of branches within 3-6 h post treatments, showing systemic movement through trees. New growth branches tested positive for dsRNA at 60-90 days post treatments. Cuttings are provided to insects (ACP and GWSS) in a dsRNA feeding bioassay44.</li>
</ol>
7. Stem Tap (Tree Trunk Injection) Application in Large Potted Citrus Trees and Seedlings
<ol>
	<li>Select citrus seedlings, new, or approximately 3.5 years old plants for injecting dsRNA using the stem tap (trunk injections) method.</li>
	<li>Drill holes in the citrus plants using a drill and a 10 mm drill bit, taking care not to exceed 2 cm, or about half the diameter of the stem.</li>
	<li>Wrap the copper tip of each injector 4-6 times with a 0.6 cm (&#188; inch) wide strip of sealing film to prevent leakage near the tip.</li>
	<li>Fill the tree trunk injectors with 6 mL (1.7 mg/mL) of dsRNA solution diluted in DNase/RNase free water (denoted here as colored solution).</li>
	<li>Inject the solution into the trunk of the tree and leave the injector in the trunk for 6-10 h to allow absorption of the dsRNA solution. Allow the insects to feed on the cuttings from treated trees at 3, 10, and 30 days post treatment. 
	NOTE: The dsRNA injected using the trunk injection method persisted in the trees for a period of 30-60 days41,42,44. Validation for RNAi was performed by qPCR using the primers listed in Table 1.</li>
</ol>
8. dsRNA Treated Clay Granules for Delivery to Insects Through Soil
<ol>
	<li>Pour out the clay absorbent into a 50-mL conical tube to the 35 mL mark (approximately 30 g of clay absorbent) on the tube.</li>
	<li>Pour 20 mL of dsRNA solution diluted in DNase/RNase free water (100 &#181;g/mL) into the tube to wet all the absorbent. Cap the conical tube, tip the tube to help remove air, and cap the tube.</li>
	<li>Place the tube upright and let it stand for 1-2 min for the clay particles to absorb the solution.</li>
	<li>Add enough dsRNA-soaked clay into the soil mix to fill a 1 gallon pot.</li>
	<li>Mix and turn the soil by hand to thoroughly mix the dsRNA-soaked clay into the soil.</li>
	<li>Use this soil to repot seedlings selected for the dsRNA treatment.</li>
	<li>Water the soil with 200 mL of plain water without dsRNA. After 30 min to 1 h, follow with 100 mL of plain water. After 24 h, put the plant on a normal watering schedule.</li>
	<li>Test 4-6 leaves of the treated potted plants with clay absorbents and dsRNA each month post treatment for dsRNA by collecting the most apical leaves of new plant growth. 
	NOTE: Plants or cuttings from these treated plants are fed to insects any time after 24 h post treatment and have been able to delivery RNAi for up to a year to insects (unpublished data).</li>
</ol>

The authors have nothing to disclose.

RNAi has proven to be an important tool for exploring gene biological function and regulation, with great potential to be utilized for management of insect pests19,68,69,70,71. The design and selection of an appropriate gene(s) for silencing in a given insect species and the method of delivery of the corresponding dsRNA(s) to the insect are both of utmost importance. The optimal method for delivering dsRNA into an insect must be determined empirically, along with the relative dose selection for delivery, as certain methods may offer advantages and other limitations. For the development of a molecular biopesticide that may ultimately be suitable for environmental release, a feasible, efficient and advantageous delivery method is required. For example, topically applied dsRNA has shown to be effective for dsRNA delivery for insect control to citrus and grapevines42,44. Innovative strategies such as use of baits, sucrose solutions, yeast or bacterial dsRNA production for direct ingestion, topical application of dsRNA onto plants, or production of specific dsRNAs by modified transgenic plants, have advanced the development of effective RNAi-based controls19,72.
A good example is demonstrated here with the use of green beans to deliver dsRNA (Figure 1 and Figure 2) designed to specifically impact and reduce an insect pest of global importance. The newly developed vegetable mediated dsRNA delivery protocol using segments of green beans immersed and saturated with dsRNA has been used to effectively target genes specific for larval development in BMSB. Green beans are one of the many vegetables that are devoured by BMSB and so these were used as a medium to deliver dsRNA. Other mediums of dsRNA delivery were tested (data not shown) but were unsuccessful in supplying nutrition to the BMSB possibly due to differences in vascular texture. Therefore, we used segments of green beans to deliver in vitro synthesized dsRNA to the BMSB nymphs. The nucleic acids delivered through a plant or vegetable mediated technique may potentially be able to induce RNAi in the insect of choice as observed here with depletion of JHAMT and Vg genes in BMSB (Figure 2)62.
This vegetable mediated dsRNA delivery protocol has been used successfully to induce RNAi not only in BMSB but also in HB using collard greens (Figure 3), though delivery strategies and methods must be optimized for each gene and insect. Hence, it is recommended that various methods be tested for delivery as well as to target multiple genes of interest individually or by stacking at least two dsRNAs in order to obtain better phenotypic penetrance. Several methods have been summarized for dsRNA delivery to insects and insect cells including feeding13,22, soaking73,74, microinjection75, and other techniques76 used for dsRNA uptake to induce systemic RNAi. Newer methods for oral delivery of dsRNA to induce RNAi in other insects by ingestion on treated non-transgenic plants also have been explored (Figure 4, Figure 5, and Figure 6). Citrus trees have been demonstrated to absorb dsRNAs either through roots, stem tap (trunk injections), or foliar sprays42,44. Previously, citrus trees and mature grapevines have been treated with insect specific dsRNA corresponding to the AK gene in both ACP and GWSS. These treated plants caused an increase in mortality for both the ACP and GWSS for up to various lengths of time41,45. Together these results demonstrate that dsRNA can impede expression of specific genes in the studied insects.
Challenges that affect successful silencing of gene expression include unique groups of dsRNA nucleases (dsRNases) expressed primarily in the gut tissue of insects and salivary secretions, or the gut pH which, may be responsible for degradation of dsRNA47,77,78. However, to overcome such degradation, systemic RNAi may be induced efficiently in insects by utilizing higher concentrations of dsRNA and/or using PEG in the diet for oral delivery of gene-specific dsRNA to overcome such degradation62,79. Delivery and uptake of dsRNA may also be stabilized with the help of carrier molecules, such as nanoparticles80 like Chitosan48, liposomes like Lipofectamine 2000 and Metafectene76, polyethylene glycol79, clay nanosheets81, and carbon quantum dot50. Research is in progress to improve the effective delivery of dsRNA using agar and gel pieces infused with gene specific dsRNA (data not shown, see Supplemental Video 4). This technique may be used for delivery of an effective dose of dsRNA to ants that can carry the dsRNA infused resin or agar to the nest as food.
In addition to stability of dsRNA, long-term persistence of dsRNA in plant tissues is of importance, especially for agricultural crops. dsRNA distributed through vascular tissues of plants, fruits, or vegetables may accumulate in the xylem and phloem with reduced enzyme activity prior to being ingested by insects to induce the RNAi mechanism. It may be necessary for certain applications to have dsRNA persist for a short period, such as for 6 days in green beans or longer, for 36 h in the soil62,82 so that the accumulation of nucleic acids in the environment becomes unlikely. However, Neena et al. demonstrated that nanosheets could protect large dsRNAs from premature degradation as well as mediate their sustained release on leaf surfaces over a period of at least 30 days81.
Overall the dsRNA delivery strategies discussed here could be used to silence insect specific genes for pest management. Supply of dsRNA to plants through irrigation water, root drench, or trunk injection could be an effective strategy for pest insects, such as root feeders, for which no efficient control method is currently available. Delivery of dsRNA using a carrier or stabilizing medium such as clay or agar may be directly added to the soil for uptake by plants. One of the main causes for slow progress in the development of RNAi mediated molecular biopesticides has been the lack of efficient oral delivery techniques to initiate efficient RNAi and stability under environmental conditions83. The oral delivery methods outlined here may in the future be used for delivering nucleic acid mediated gene silencing treatments to plant sap feeding as well as chewing insects to reduce insect damage in global food production and develop sustainable ecological pest management.

Hemipteran insects comprise some of the most economically significant pests of agriculturebecause of their ability to attain elevated population growth and spread diseases in plants. The BMSB, H. halys St&#229;l, is an invasive pest that was accidentally introduced in the Western hemisphere in Allentown, Pennsylvania from Asia (China, Taiwan, Korea, and Japan) with the first sighting reported in 19961. Since its introduction, BMSB has been detected in 43 states, with the highest populations in the Mid-Atlantic (DE, MD, PA, NJ, VA, and WV), as well as in Canada and Europe, and represents a potential threat to agriculture2. As a polyphagous pest, BMSB can instigate damage to approximately 300 identified plant hosts including high-value crops such as apples, grapes, ornamental plants, seed crops, soybeans, and corn. Damage is caused primarily due the mode of feeding known as lacerate and flush where the animal pierces the host crop with its needle-like stylet to gain access to the nutrients from the vascular tissues2,3. BMSB is also an indoor pest as they may find residence in living areas such as schools and houses during autumn through winter2. Chemicals and aeroallergens released by BMSB were reported to illicit allergic reaction in fruit crop workers. BMSB may also contribute to allergic disease leading to contact dermatitis, conjunctivitis, and rhinitis in sensitive individuals4,5. Another hemipteran insect, the ACP, D. citri Kuwayama (Hemiptera: Liviidae), is a serious pest of citrus fruits, and transmits the phloem-limited bacteria (Candidatus Liberibacter asiaticus) causing Huanglongbing (HLB), better known as citrus greening disease6,7. HLB was first reported from Southern China and has spread to 40 different Asian, African, Oceanian, South and North American countries7. Citrus greening is a worldwide problem with threatening economic and financial losses due to citrus fruit loss; hence, management of ACP is considered of utmost importance to prevent and control HLB.
Measures for effective control of these insect pests usually requires the application of chemical pesticides that are relatively short lived. Chemical insecticide control strategies often lack safe environmental management strategies or have decreased susceptibility due to pesticide resistance in pest populations8,9. Hence, the biological control of pests with molecular biopesticides is a potential alternative, but its use globally remains modest, and various species of parasitoids (e.g., Trisolcus japonicus) may also be effective as natural biological controls. RNAi is a potential emerging technology for managing invasive insect pests with molecular biopesticides10. RNAi is a well described gene regulatory mechanism that facilitates the effective posttranscriptional gene silencing of endogenous as well as invading dsRNAs in a sequence-specific manner, that eventually leads to the regulation of gene expression at the mRNA level11,12. Briefly, when exogenous dsRNA is internalized into a cell it is processed into siRNAs by a member of the bidentate nuclease RNase III superfamily, called Dicer, which is evolutionarily conserved in worms, flies, plants, fungi, and mammals13,14,15. These 21-25 nucleotide siRNA duplexes are then unwound and integrated in the RNA-induced silencing complex (RISC) as guide RNAs. This RISC-RNA complex allows Watson-Crick base pairing to the complementary target mRNA; this eventually leads to cleavage by the Argonaute protein, a multi domain protein containing an RNase H-like domain, which degrades the corresponding mRNA and reduces protein translation, thereby leading to posttranscriptional gene silencing16,17,18.
RNAi for pest management requires the introduction of dsRNA in vivo to silence the gene of interest, thereby activating the siRNA pathway. Various methods that have been used for dsRNA delivery to insects and insect cells to induce systemic RNAi include feeding10,19, soaking20,21, microinjection22, carriers such as liposomes23, and other techniques24. RNAi was first demonstrated in Caenorhabditis elegans to silence unc-22 gene expression by Fire and Mello25, followed by knockdown in expression of the frizzled genes in Drosophila melanogaster26. Initial functional studies utilized microinjection to deliver dsRNA in insects, such as Apis mellifera22,27, Acyrthosiphon pisum28, Blattella germanica29, H. halys30, and lepidopteran insects (reviewed by Terenius et al.31). Microinjection is advantageous to deliver an accurate and precise dose to the site of interest in the insect. Albeit such septic punctures may elicit expression of immune related genes due to trauma32, hence, ruling out its practicality in agricultural biopesticides development.
Another method of delivering dsRNA in vivo is by soaking, which involves ingestion or absorption of dsRNA by suspension of animals or cells generally in extracellular medium containing dsRNA. Soaking has been used to efficiently induce RNAi in Drosophila S2 tissue culture cells to inhibit Downstream-of-Raf1 (DSOR1) mitogen-activated protein kinase kinase (MAPKK)20, as well as in C. elegans to silence the pos-1 gene33. However, dsRNA delivered using soaking is less efficient to induce RNAi compared to microinjection20. RNAi mediated silencing in a chewing insect was first shown in the Western corn rootworm (WCR) (Diabrotica virgifera virgifera) by infusing the dsRNA into an artificial agar diet10. Earlier reports have summarized methods to deliver dsRNA infused in natural diets specific to arthropods34. These delivery methods were further determined to be comparably effective to artificial means of delivery; such as the case of the tsetse fly (Glossina morsitans morsitans), where equal knockdown of an immune-related gene was observed when dsRNA was delivered either through blood meal or microinjected35. Similarly, delivery of dsRNA through droplets in light brown apple moth (Epiphyas postvittana)36, diamondback moth (Plutella xylostella) larvae37, as well as honey bees38,39 induced efficient RNAi. Most effective RNAi experiments in hemipteran have utilized injection of dsRNA40 because oral delivery of dsRNA in hemipteran insects is arduous since it must be delivered through the host plant&#39;s vascular tissues. Effective RNAi was also observed in ACP and glassy-winged sharpshooter leafhopper (GWSS), Homalodisca vitripennis: dsRNA was delivered through citrus and grapevines that had absorbed dsRNA into the vascular tissues through root drench, foliar sprays, trunk injections, or absorption by cuttings41,42,43,44,45,46. This also resulted in the first patent for dsRNA against the ACP (2016, US 20170211082 A1). Delivery of siRNA and dsRNA using carriers such as nanoparticles and liposomes imparts stability, and increases in delivered dsRNA efficacy are rapidly emerging23,47,48,49,50. A new class of nanoparticle-based delivery vehicles for nucleic acids for in vitro and in vivo that was summarized specifically for therapeutic applications may impart immense potential as suitable delivery vectors51. Nanoparticles as a delivery vehicle for dsRNA may have disadvantages including solubility, hydrophobicity, or limited bioaccumulation52, but a suitable polymer aiding delivery may compensate these disadvantages. Development and use of self-delivering nucleotides are also emerging called &#39;antisense oligonucleotides&#39;, which are single stranded RNA/DNA duplexes46.
Vitellogenesis in arthropods is a key process controlling reproduction and regulated by juvenile hormone (JH) or ecdysone, which are the key inducers of Vg synthesis by the body fat; the Vg is eventually taken up by the developing oocyte via Vg receptor mediated endocytosis53. Vg is a group of polypeptides synthesized extraovarially, which is essential for development of the major egg yolk protein, vitellin54,55, and therefore, it is important in reproduction and aging56. Vg has been successfully silenced in nematodes57 as well as in honey bee (Apis mellifera) where RNAi mediated depletion of Vg was observed in adults and eggs22. RNAi mediated posttranscriptional gene silencing of Vg was tested because it was thought its depletion would lead to an observable phenotypic effect such as reduced fertility and fecundity, to potentially aid in BMSB control. The JHAMT gene that encodes the S-adenosyl-L-methionine (SAM)-dependent JH acid O-methyltransferase, catalyzes the final step of the JH biosynthesis pathway58. In this pathway farnesyl pyrophosphate (FPP) is sequentially transformed from farnesol, to farnesoic acid followed by conversion of methyl farnesoate to JH by JHAMT. This pathway is conserved in insects and arthropods specifically for metamorphosis, a process that is developmentally regulated by hormones59,60,61. In B. mori, JHAMT gene expression and the JH biosynthetic activity in the Corpora allata suggest that the transcriptional suppression of the JHAMT gene is crucial for the termination of JH biosynthesis58. Therefore, the JHAMT and Vg genes were selected for targeted depletion using RNAi. RNAi was also tested in citrus trees for control of ACP and GWSS. Citrus trees were treated with dsRNA through root drench, stem tap (trunk injections), as well as foliar sprays with dsRNAs against insect specific arginine kinase (AK) transcripts42,44. The topical application of dsRNA was detected all over the canopy of citrus trees, indicating efficient delivery through the plants vascular tissues, and resulted in increased mortality in ACP and GWSS41,42,45.
In the current study, we have identified a natural diet delivery method for treatments such as dsRNA. This newly developed technique was subsequently used for silencing the JHAMT and Vg mRNA using gene specific dsRNAs in BMSB nymphs as demonstrated earlier62. These new delivery protocols demonstrated here supersede conventional RNA delivery systems that use topical sprays or microinjections. Vegetables and fruits, stem tap, soil drenching, and clay absorbents in may be used for delivery of dsRNA, which is critical to the continued development of biopesticide pest and pathogen management.

<table><tbody><tr><td>BMSB (H. halys) insects&amp;nbsp;</td><td>USDA</td><td></td><td></td></tr><tr><td>ACP (D. citri) insects&amp;nbsp;</td><td>USDA</td><td></td><td></td></tr><tr><td>organic green beans</td><td>N/A</td><td></td><td></td></tr><tr><td>Citrus plants</td><td>USDA</td><td></td><td></td></tr><tr><td>sodium hypochlorite solution</td><td>J.T. Baker</td><td></td><td></td></tr><tr><td>green food coloring&amp;nbsp;</td><td>McCormick &amp;amp; Co., Inc</td><td></td><td></td></tr><tr><td>Thermo Forma chambers&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td></td><td></td></tr><tr><td>Magenta vessel (Culture)</td><td>Sigma</td><td></td><td></td></tr><tr><td>Primers&amp;nbsp;</td><td>IDT DNA</td><td></td><td></td></tr><tr><td>SensiMix SYBR</td><td>Bioline</td><td></td><td></td></tr><tr><td>qPCR ABI 7500</td><td>Applied Biosystems&amp;nbsp;</td><td></td><td></td></tr><tr><td>Spray bottle</td><td>N/A</td><td></td><td></td></tr><tr><td>Parafilm</td><td>American Can Company</td><td></td><td></td></tr><tr><td>TaKaRa Ex Taq</td><td>Clontech</td><td></td><td></td></tr><tr><td>QIAquick</td><td>Qiagen</td><td></td><td></td></tr></tbody></table>

double-stranded rna oral delivery methods to induce rna interference in phloem and plant-sap-feeding hemipteran insects

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for delivery of dsRNA to use in crop protection and overcome environmental challenges for pest management.

Vegetable mediated dsRNA delivery through feeding in BMSB 4th instar nymphs was tested for the development of molecular biopesticides using RNAi for invasive insect pests. BMSBs feed using their needle-like stylets by a mechanism known as lacerate and flush, which causes considerable damage to crops. Slender organic green beans, P. vulgaris L., were used to test if nutrients or dsRNA could be delivered in vivo to BMSB through feeding3. Segments of green beans were immersed in DNase/RNase free water or a solution of water and green food coloring to test delivery in BMSB (Figure 1A). The green food coloring was used as a visual indication to imitate dsRNA. The vascular tissue of the green beans were saturated with green food coloring due to the flow of green colored solution through the phloem by capillary action62. BMSB nymphs were seen feeding on the segments of green beans by inserting their stylets into the vascular tissues of the green beans (Figure 1B). Green colored excreta droplets were observed after days 2 and 3 in insects that were fed on beans saturated with green food coloring indicating the delivered material had been ingested orally and passed through the gut before excretion (Figure 1C, D).
Subsequently we tested if significant depletion of targeted gene expression was accomplished using the green bean mediated delivery of BMSB specific dsRNA through ingestion in BMSB. Green bean segments were immersed and absorbed a solution of either 0.067 &#181;g/&#181;L (20 &#181;g in 300 &#181;L of DNase/RNase free water) or 0.017 &#181;g/&#181;L (5 &#181;g in 300 &#181;L of DNase/RNase free water) of in vitro synthesized dsRNA specific to BMSB JHAMT and Vg, respectively. Green beans were also immersed in water alone, 0.067 &#181;g/&#181;L or 0.017 &#181;g/&#181;L LacZ dsRNA (Mock) as respective controls. Transcript levels were evaluated using qPCR indicating that expression of JHAMT and Vg mRNA was significantly reduced in vivo by almost 4.5- and 2.2-fold, respectively (Figure 2A, B). Consequently, the results indicate that dsRNA may be delivered through the vascular tissues of green beans to induce successful RNAi.
Another hemipteran pest, the Harlequin bug (HB) (Murgantia histrionica), that causes damage to cole crops were also tested if successful delivery of nutrients or dsRNA treatments could be delivered using the vegetable mediated delivery. The 4th instar HB nymphs were allowed to feed on baby collard greens (Brassica oleracea var. viridis) immersed in either water or a solution of water with green food coloring. Results indicated that HB fed and ingested the green food coloring, which was apparent from their green colored excreta, as compared to HB that ingested the vegetables immersed in water, which had clear excreta (Figure 3).
Additional techniques for the transient delivery of dsRNA of spraying or root/soil soaking results in dsRNA uptake in all of the plant tissues65,66. Sprayable RNAi-based products are in development and may be available soon pending approval. Delivery of dsRNA in the fields using sprays or root drench may aid in managing invasive insects42,67. Full-sized citrus trees and seedlings were exposed to the dsRNA either by foliar spray, or by soil or bare root drenching, respectively (Figure 4). Results indicated that dsRNAs delivered by either sprays or soil/bare root drench could be detected in Citrus plants (2.5 m tall) for 7 weeks post a single exposure of 2 g of dsRNA42. Delivery and ingestion of psyllid dsRNA-AK (20 ng/&#181;L) increased psyllid mortality by 30-45% (Figure 4D)42.
In vitro transcribed dsRNA can be efficiently delivered to polyphagous insects using stem tap (trunk injections) of gene specific dsRNA directly into the vascular tissues of the plant, which can be acquired by the insects when preying on such plants44 (Figure 5). For citrus trees that were exposed to the dsRNA by trunk injections, the dsRNA could be detected in aged citrus plants (approximately 1 m tall) for 7 weeks post a single exposure using 6 mL of 1.7 mg/mL of dsRNA in a solution of DNase/RNase free water (Figure 5A, B). Phloem-feeding hemipteran insects were then allowed to feed on these host plants treated with dsRNA. It is assumed that the dsRNA was successfully infused and moved through the vascular system of the citrus plants for ingestion by ACP, which demonstrated mortality when fed on dsRNA-AK42.
Bioassays developed from 2008 to 2012, have been screened across a wide variety of potted plants and shown to provide dsRNA delivery in a manner by which plants can absorb and translocate the dsRNA for systemic dsRNA dissemination41,42. One method uses a clay absorbent component with dsRNA adsorption into the clay matrix; this includes a wide variety of clays, Fuller&#39;s Earth, Zeolite, and others, as well as other absorbent materials, cellulose, agars, bioplastics, etc. Clay particles are dust free nucleic acid carriers that may be used for delivering active ingredients such as dsRNA to soils for plant uptake and ultimately delivery to insects (Figure 6). The clay complex can also be chemically configured to release the dsRNA under specific pH or ionic conditions. Clay delivery methods of dsRNA into plants have been shown to provide dsRNA into potted citrus trees, and other plants for over 14 months (data not shown). This delivery system can be used to alter plant traits, such as flower colors, plant height (dwarfing), or others. Currently, the primary use of this method is for the development of an effective insect pest and pathogen (virus) control or management. The approach can be cost effective for nurseries and homeowners, and is a non-transgenic method.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57390/57390fig1.jpg" /> 
Figure 1. Delivery of nutrients or dsRNA through green beans. (A) Segments of slender organic green beans were immersed and absorbed the solution in a 2 mL microcentrifuge tube containing 300 &#181;L of either ddH2O alone or ddH2O with green food coloring, for 3 h. Three 4th instar BMSB nymphs were starved for 24 h and placed in culture vessels along with 3 green beans per vessel. (B) BMSB feed on segments of green beans immersed in water by piercing through the green beans to reach the nutrients with their stylets. (C) Day 2 of the BMSB feeding bioassay, arrows denote excreta. (D) Day 3; Increased BMSB excreta (denoted by arrow) observed post ingestion of a solution of ddH2O and green food coloring through green beans. <a href="/files/ftp_upload/57390/57390fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57390/57390fig2.jpg" /> 
Figure 2. Quantitative RT-PCR analysis to measure the level of transcript after RNAi-mediated depletion of JHAMT and Vg in BMSB. Total RNA from 3 individual BMSB 4th instar nymphs fed on JHAMT (A) 20 &#181;g (0.067 &#181;g/&#181;L), and Vg (B) 5 &#181;g (0.017 &#181;g/&#181;L) dsRNAs in 300 &#181;L of ddH2O delivered through segments of green beans, was isolated and the transcript levels were measured by qPCR. LacZ dsRNA (Mock) served as a negative control. BMSB 18s RNA was used as an internal standard to correct for differences in RNA recovery from tissues. Results reported are from three biological replicates, and error bars indicate SEM. A one-way analysis of variance (ANOVA) was performed to test for statistical significance of data, p &#60; 0.0001. Results reproduced from Ghosh et al.62 <a href="/files/ftp_upload/57390/57390fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57390/57390fig3.jpg" /> 
Figure 3. Oral delivery of treatment in Harlequin bug (M. histrionica) using baby collard greens. Organic baby collard greens were washed with 0.2% sodium hypochlorite, trimmed, and immersed in a 2 mL cap-less microcentrifuge tube containing 300 &#181;L of solution of (A) DNase/RNase free ddH2O, or (B) DNase/RNase free ddH2O solution with green food coloring, for a period of 3 h. Three 4th instar HB nymphs were starved for 24 h and then placed in culture vessels and allowed to feed on these collard greens for 3 days. White arrows indicate excreta observed on day 3 post feeding. <a href="/files/ftp_upload/57390/57390fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57390/57390fig4.jpg" /> 
Figure 4. Foliar spray and root drench application in citrus trees and seedlings. The selected plants or seedlings prior to use are not watered for 2-3 days to let the soil dry out to damp but not completely dry. (A) The trees were first topped and 200 mL of dsRNA solution (0.5 mg/mL) in DNase/RNase free water was applied by hand pump spray bottle to the lower canopy. (B) 100 mL of dsRNA solution (1 mg/mL) in DNase/RNase free water was applied to the soil of seedlings in partially dry soils. (C) 100 mL of dsRNA solution (1 mg/mL) in DNase/RNase free water was applied to the bare roots of seedlings for approximately 3 h. (D) ACP feeding on seedlings that had absorbed dsRNA by the bare roots, showed increased ACP mortality. <a href="/files/ftp_upload/57390/57390fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57390/57390fig5.jpg" /> 
Figure 5. Citrus Seedling tree trunk injection. Citrus seedlings approximately 1 m tall were injected with 1.7 mg/mL of dsRNA. (A) Drill holes in citrus seedlings using a 10 mm diameter drill bit to insert the injector into the stem of the plant. The exposed copper tip of each injector was wrapped with a 0.6 cm (&#188; inch) wide strip of sealing film to prevent leakage. (B) Injectors filled with 6 mL of colored solution were applied to the stem (trunk) of the seedlings. Injectors were left in place for approximately 6-10 h for complete uptake of the solution. <a href="/files/ftp_upload/57390/57390fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57390/57390fig6.jpg" /> 
Figure 6. Clay soil amendment delivery of dsRNA into plants through soil. A new line of delivering material: clay that is a dust free nucleic acid carrier for use in delivering active ingredients such as dsRNA to soils for uptake in plants and ultimately into insects. (A) Unbaked clay and (B) baked clay depicting water tolerance/retention. <a href="/files/ftp_upload/57390/57390fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Potential H. halys target genes</td>
		</tr>
		<tr>
			<td>Accession</td>
			<td>Size</td>
			<td colspan="2">Gene Name/Homology</td>
		</tr>
		<tr>
			<td>&#160;XP_014293026.1</td>
			<td>491</td>
			<td colspan="2">Vitellogenin-A1-like (Vg) (Possible isoforms: vitellogenin-2-like isoform X1 XP_014291483.1; vitellogenin-2-like isoform X2 XP_014291484.1).</td>
		</tr>
		<tr>
			<td>&#160;XP_014290953.1</td>
			<td>545</td>
			<td colspan="2">Juvenile hormone acid O-methyltransferase-like (JHAMT) (Possible homolog: juvenile hormone acid O-methyltransferase XP_014283772.1).</td>
		</tr>
		<tr>
			<td colspan="4">Primers</td>
		</tr>
		<tr>
			<td colspan="4">PCR</td>
		</tr>
		<tr>
			<td>Gene Name/Homology</td>
			<td>Primer Name</td>
			<td colspan="2">Sequence</td>
		</tr>
		<tr>
			<td>Vg</td>
			<td>BMSB Vitellog P2 F</td>
			<td colspan="2">CAATTTGATCCACCGACTGTT</td>
		</tr>
		<tr>
			<td>Vg</td>
			<td>BMSB Vitellog P2 R</td>
			<td colspan="2">CCGCATGAATCTTACTCTGGA</td>
		</tr>
		<tr>
			<td>JHAMT</td>
			<td>BMSB JH P1 F</td>
			<td colspan="2">GGATGCTTATGAATAATCCAG</td>
		</tr>
		<tr>
			<td>JHAMT</td>
			<td>BMSB JH P1 R</td>
			<td colspan="2">GTATAGGATTGCCATTTTGG</td>
		</tr>
		<tr>
			<td colspan="4">T7 PCR</td>
		</tr>
		<tr>
			<td>Vg</td>
			<td>T7 BMSB Vitellog P2 4263 F</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGACCAAAGTTGGAAGGGAATGA</td>
		</tr>
		<tr>
			<td>Vg</td>
			<td>T7 BMSB Vitellog P2 4753 R</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGACCGCATGAATCTTACTCTGGA</td>
		</tr>
		<tr>
			<td>JHAMT&#160;</td>
			<td>BMSB JH T7 P1 F</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGAGGATGCTTATGAATAATCCAG</td>
		</tr>
		<tr>
			<td>JHAMT&#160;</td>
			<td>BMSB JH T7 P1 R</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGAGTATAGGATTGCCATTTTGG</td>
		</tr>
		<tr>
			<td>LacZ</td>
			<td>T7 LacZ RNAi F</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGATGAAAGCTGGCTACAGGA</td>
		</tr>
		<tr>
			<td>LacZ</td>
			<td>T7 LacZ RNAi R</td>
			<td colspan="2">GAATTAATACGACTCACTATAGGGAGAGCAGGCTTCTGCTTCAAT</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>dsAK-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGTGGCATTCTTGTATGGCGTA</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>dsAK-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGGCCTGCAAGAATCTGTCTCC</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>dsAK 50-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGTGGCATTCTTGTATGGCGTA</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>dsAK 50-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGTGAAGCCCTTGTGGTAGTC</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>dsAK 30-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGACCCGGACTCTGGAGTAGG</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>dsAK 30-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGGCCTGCAAGAATCTGTCTCC</td>
		</tr>
		<tr>
			<td>GFP</td>
			<td>dsGFP-F</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGCCAACACTTGTCACTACTTTCTCTT</td>
		</tr>
		<tr>
			<td>GFP</td>
			<td>dsGFP-R</td>
			<td colspan="2">TAATACGACTCACTATAGGGAGGTAATGGTTGTCTGGTAAAAGGA</td>
		</tr>
		<tr>
			<td colspan="4">qPCR</td>
		</tr>
		<tr>
			<td>Vg</td>
			<td>RT Vitellog P2&#160; F</td>
			<td colspan="2">TTGATAGTTGTTTGGATTTTGAAGGT</td>
		</tr>
		<tr>
			<td>Vg</td>
			<td>RT Vitellog P2&#160; R</td>
			<td colspan="2">TCTTACTTGATCAGCGCTCAGAA</td>
		</tr>
		<tr>
			<td>JHAMT</td>
			<td>BMSB JH RT P1 F</td>
			<td colspan="2">AGGAAAACCCAAAATGGCAAT</td>
		</tr>
		<tr>
			<td>JHAMT</td>
			<td>BMSB JH RT P1 R</td>
			<td colspan="2">ATGTATTCTTCTTTTGGATCTTTTCTTGAG</td>
		</tr>
		<tr>
			<td>18S</td>
			<td>BMSB 18S F3</td>
			<td colspan="2">ATGCCCCCGCCTGTCCTTATT</td>
		</tr>
		<tr>
			<td>18S</td>
			<td>BMSB 18S R3</td>
			<td colspan="2">TGAAAGCAGCCTGAATAGTGG</td>
		</tr>
		<tr>
			<td>GFP</td>
			<td>GFP-F</td>
			<td colspan="2">GGTAAAAGGACAGGGCCATC</td>
		</tr>
		<tr>
			<td>GFP</td>
			<td>GFP-R</td>
			<td colspan="2">TCAAGGAGGACGGAAACATC</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>AK quant-F</td>
			<td colspan="2">CGGACTTGAGGGAGAACTGA</td>
		</tr>
		<tr>
			<td>AK</td>
			<td>AK quant-R</td>
			<td colspan="2">GTGGTAGATACCGCGACCAG</td>
		</tr>
		<tr>
			<td>a-Tub</td>
			<td>a-Tub-F</td>
			<td colspan="2">GCGTCTCTTCGGTTTGACGG&#160;</td>
		</tr>
		<tr>
			<td>a-Tub</td>
			<td>a-Tub-R</td>
			<td colspan="2">CACTTCACCATCTGGTTGGC&#160;</td>
		</tr>
	</tbody>
</table>
Table 1. Oligonucleotide sequences for RNAi. Listed are the genes and oligonucleotides used for generating PCR fragments, dsRNA, and qPCR primers to analyze the transcript levels.
Supplementary Video 1: Agars and gels as absorbents for delivery and sustained release of dsRNA. Hydrated synthetic or natural agars and gels with dsRNA solution that may be used as bait or diets for various arthropods. <a href="/files/ftp_upload/57390/Supplementary_Video_1.mov">Please click here to download this video</a>

Watch this Scientific Journal Video about Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects at JoVE.com

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

This article demonstrates novel techniques developed for oral delivery of double-stranded RNA (dsRNA) through the vascular tissues of plants for RNA interference (RNAi) in phloem sap feeding insects.

Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran ...

double-stranded-rna-oral-delivery-methods-to-induce-rna-interference

Nanyang Technological University

Research

JoVE Journal

Environment

13.8K Views.  United States Department of Agriculture. This article demonstrates novel techniques developed for oral delivery of double-stranded RNA (dsRNA) through the vascular tissues of plants for RNA interference (RNAi) in phloem sap feeding insects.

Video: Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Genetics

RNA Interference in Aquatic Beetles as a Powerful Tool for Manipulating Gene Expression at Specific Developmental Time Points

RNA interference (RNAi) remains a powerful technique that allows for the targeted reduction of gene expression through mRNA degradation. This technique is applicable to a wide variety of organisms and is highly efficient in the species-rich order Coleoptera (beetles). Here, we summarize the necessary steps for developing this technique in a novel organism and illustrate its application to the different developmental stages of the aquatic diving beetle Thermonectus marmoratus. Target gene sequences can be obtained cost-effectively through the assembly of transcriptomes against a close relative with known genomics or de novo. Candidate gene cloning utilizes a specific cloning vector (the pCR4-TOPO plasmid), which allows the synthesis of double-stranded RNA (dsRNA) for any gene with the use of a single common primer. The synthesized dsRNA can be injected into either embryos for early developmental processes or larvae for later developmental processes. We then illustrate how RNAi can be injected into aquatic larvae using immobilization in agarose. To demonstrate the technique, we provide several examples of RNAi experiments, generating specific knockdowns with predicted phenotypes. Specifically, RNAi for the tanning gene laccase2 leads to cuticle lightening in both larvae and adults, and RNAi for the eye pigmentation gene white produces a lightening/lack of pigmentation in eye tubes. In addition, the knockdown of a key lens protein leads to larvae with optical deficiencies and a reduced ability to hunt prey. Combined, these results exemplify the power of RNAi as a tool for investigating both morphological patterning and behavioral traits in organisms with only transcriptomic databases.

RNA interference is a widely applicable, powerful technique for manipulating gene expression at specific developmental stages. Here, we describe the necessary steps for implementing this technique in the aquatic diving beetle Thermonectus marmoratus, from the acquisition of gene sequences to the knockdown of genes that affect structure or behavior.

RNA interference (RNAi) remains a powerful technique that allows for the targeted reduction of gene expression through mRNA degradation. This technique is ...

RNAi-mediated Double Gene Knockdown and Gustatory Perception Measurement in Honey Bees (Apis mellifera)

This video demonstrates novel techniques of RNA interference (RNAi) which downregulate two genes simultaneously in honey bees using double-stranded RNA (dsRNA) injections. It also presents a protocol of proboscis extension response (PER) assay for measuring gustatory perception.	
	RNAi-mediated gene knockdown is an effective technique downregulating target gene expression. This technique is usually used for single gene manipulation, but it has limitations to detect interactions and joint effects between genes. In the first part of this video, we present two strategies to simultaneously knock down two genes (called double gene knockdown). We show both strategies are able to effectively suppress two genes, vitellogenin (vg) and ultraspiracle (usp), which are in a regulatory feedback loop. This double gene knockdown approach can be used to dissect interrelationships between genes and can be readily applied in different insect species.	
	The second part of this video is a demonstration of proboscis extension response (PER) assay in honey bees after the treatment of double gene knockdown. The PER assay is a standard test for measuring gustatory perception in honey bees, which is a key predictor for how fast a honey bee's behavioral maturation is. Greater gustatory perception of nest bees indicates increased behavioral development which is often associated with an earlier age at onset of foraging and foraging specialization in pollen. In addition, PER assay can be applied to identify metabolic states of satiation or hunger in honey bees. Finally, PER assay combined with pairing different odor stimuli for conditioning the bees is also widely used for learning and memory studies in honey bees.

RNAi-mediated Double Gene Knockdown and Gustatory Perception Measurement in Honey Bees Apis mellifera

In this protocol, we describe two strategies that simultaneously suppress two genes (double gene knockdown) in honey bees. Then we present how to use the proboscis extension response (PER) assay to study the effect of double gene knockdown on honey bee gustatory perception.

This video demonstrates novel techniques of RNA  interference (RNAi) which downregulate two genes simultaneously in honey bees  using double-stranded RNA ...

Neuroscience

RNAi Interference by dsRNA Injection into Drosophila Embryos

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements and tools for genetic manipulation have become available in Drosophila 2. Soon after the initial discovery by Frie and Mello 3 that double stranded RNA can be used to knockdown the activity of individual genes in Caenorhabditis elegans, RNA interference (RNAi) was shown to provide a powerful reverse genetic approach to analyze gene functions in Drosophila organ development 4, 5.
Many organs, including lung, kidney, liver, and vascular system, are composed of branched tubular networks that transport vital fluids or gases 6, 7. The analysis of Drosophila tracheal formation provides an excellent model system to study the morphogenesis of other tubular organs 8. The Berkeley Drosophila genome project has revealed hundreds of genes that are expressed in the tracheal system. To study the molecular and cellular mechanism of tube formation, the challenge is to understand the roles of these genes in tracheal development. Here, we described a detailed method of dsRNA injection into Drosophila embryo to knockdown individual gene expression. We successfully knocked down endogenous dysfusion(dys) gene expression by dsRNA injection. Dys is a bHLH-PAS protein expressed in tracheal fusion cells, and it is required for tracheal branch fusion 9, 10. dys-RNAi completely eliminated dys expression and resulted in tracheal fusion defect. This relatively simple method provides a tool to identify genes requried for tissure and organ development in Drosophila.

RNAi Interference by dsRNA Injection into Drosophila Embryos

RNA interference has been proven very effective to analyze gene function in Drosophila tracheal development. A detailed protocol used by Jiang lab to inject dsRNA into fly embryos to knockdown gene expression is illustrated. This technique has the potential for screening genes required for tissue and organ development in Drosophila.

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements ...

Biology

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects facilitated research in new facets of mosquito biology, including functional genetic studies in the primary African malaria vector Anopheles gambiae and the dengue and yellow fever vector Aedes aegypti. RNA interference- (RNAi-) mediated gene silencing has been used to target genes of interest in both of these disease vector mosquito species. Here, we describe a procedure for preparation of chitosan/interfering RNA nanoparticles that are combined with food and ingested by larvae. This technically straightforward, high-throughput, and relatively inexpensive methodology, which is compatible with long double stranded RNA (dsRNA) or small interfering RNA (siRNA) molecules, has been used for the successful knockdown of a number of different genes in A. gambiae and A. aegypti larvae. Following larval feedings, knockdown, which is verified through qRT-PCR or in situ hybridization, can persist at least through the late pupal stage. This methodology may be applicable to a wide variety of mosquito and other insect species, including agricultural pests, as well as other non-model organisms. In addition to its utility in the research laboratory, in the future, chitosan, an inexpensive, non-toxic and biodegradable polymer, could potentially be utilized in the field.

Here we describe a procedure for inhibiting gene function in disease vector mosquitoes through the use of chitosan/interfering RNA nanoparticles that are ingested by larvae.

Vector mosquitoes inflict more human suffering than any other organism&#8212;and kill more than one million people each year. The mosquito genome projects ...

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory for functional genomic studies. The ability to knockdown individual genes selectively via this reverse genetic technique has allowed many researchers to rapidly uncover the biological roles of numerous genes within many organisms, by evaluation of loss-of-function phenotypes. In the major human malaria vector Anopheles gambiae, the predominant method used to reduce the function of targeted genes involves injection of double-stranded (dsRNA) into the hemocoel of the adult mosquito. While this method has been successful, gene knockdown in adults excludes the functional assessment of genes that are expressed and potentially play roles during pre-adult stages, as well as genes that are expressed in limited numbers of cells in adult mosquitoes. We describe a method for the injection of Serine Protease Inhibitor 2 (SRPN2) dsRNA during the early pupal stage and validate SRPN2 protein knockdown by observing decreased target protein levels and the formation of melanotic pseudo-tumors in SRPN2 knockdown adult mosquitoes. This evident phenotype has been described previously for adult stage knockdown of SRPN2 function, and we have recapitulated this adult phenotype by SRPN2 knockdown initiated during pupal development. When used in conjunction with a dye-labeled dsRNA solution, this technique enables easy visualization by simple light microscopy of injection quality and distribution of dsRNA in the hemocoel.

RNAi Trigger Delivery into Anopheles gambiae Pupae

RNA interference (RNAi) is an extremely valuable tool for uncovering gene function. However, the ability to target genes using RNAi during pre-adult stages is limited in the major human malaria vector Anopheles gambiae. We describe an RNAi protocol to reduce gene function via direct injection during pupal development.

RNA interference (RNAi), a naturally occurring phenomenon in eukaryotic organisms, is an extremely valuable tool that can be utilized in the laboratory ...

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool operating by disruption of essential gene expression. Although different methods, such as injection, feeding, and soaking, have been reported for successful delivery of double-stranded RNA (dsRNA), the efficiency of RNAi through oral delivery of dsRNA is highly variable among different insect groups. The German cockroach, Blattella germanica, is highly sensitive to the injection of dsRNA, as shown by many studies published previously. The present study describes a method to demonstrate that the dsRNA encapsulated with liposome carriers is sufficient to retard the degradation of dsRNA by midgut juice. Notably, the continuous feeding of dsRNA encapsulated by liposomes significantly reduces the tubulin expression in the midgut, and led to the death of cockroaches. In conclusion, the formulation and utilization of dsRNA lipoplexes, which protect dsRNA against nucleases, could be a practical use of RNAi for insect pest control in the future.

This manuscript demonstrates the depletion of gene expression in the midgut of the German cockroach through oral ingestion of double-stranded RNA encapsulated in liposomes.

RNA interference (RNAi) has been widely applied for uncovering the biological functions of numerous genes, and has been envisaged as a pest control tool ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) ...

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus. 
This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5&#8242;-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 &#181;g/mL) in the soaking buffer for 24 h in the dark at 25 &#176;C.
The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of ...

Advancing RNAi Techniques in Trichogramma dendrolimi for Gene Function Analysis

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura

The egg parasitoids, Trichogramma spp, are recognized as efficient biological control agents against various lepidopteran pests in agriculture and forests. The immature stages of Trichogramma offspring develop within the host egg, exhibiting remarkable diminutiveness (approximately 0.5 mm in adult length). RNA-interference (RNAi) methodology has emerged as a crucial tool for elucidating gene functions in numerous organisms. However, manipulating RNAi in certain small parasitoid species, such as Trichogramma, has generally posed significant challenges. In this study, we present an efficient RNAi method in Trichogramma denrolimi. The outlined procedure encompasses the acquisition and isolation of individual T. dendrolimi specimens from host eggs, the design and synthesis of double-stranded RNA (dsRNA), the in vitro transplantation and cultivation of T. dendrolimi pupae, the micro-injection of dsRNA, and the subsequent assessment of target gene knockdown through RT-qPCR analysis. This study furnishes a comprehensive, visually detailed procedure for conducting RNAi experiments in T. dendrolimi, thereby enabling researchers to investigate the gene regulation in this species. Furthermore, this methodology is adaptable for RNAi studies or micro-injections in other Trichogramma species with minor adjustments, rendering it a valuable reference for conducting RNAi experiments in other endoparasitic species.

Author Spotlight: Investigating Wolbachia-Induced Thelytokous Parthenogenesis and Genetic Toolkit Development Through RNA Interference

The manipulation of RNA interference (RNAi) presents a formidable challenge in many parasitoid species with diminutive size, such as Trichogramma wasps. This study delineated an efficient RNAi method in Trichogramma denrolimi. The present methodology provides a robust model for investigating gene regulation in Trichogramma wasps.

Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects

Summary

Explore More Videos

Chapters in this video

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

RNA Interference in Aquatic Beetles as a Powerful Tool for Manipulating Gene Expression at Specific Developmental Time Points

RNAi-mediated Double Gene Knockdown and Gustatory Perception Measurement in Honey Bees (Apis mellifera)

RNAi Interference by dsRNA Injection into Drosophila Embryos

Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae

RNAi Trigger Delivery into Anopheles gambiae Pupae

Practical Use of RNA Interference: Oral Delivery of Double-stranded RNA in Liposome Carriers for Cockroaches

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

RNA Interference in the Egg Parasitoid, Trichogramma dendrolimi Matsumura