이 간행물에 보고 된 연구 작업에 의해 국립 연구소의 일반 의료 과학 수상 번호 R35GM124913, 퍼듀 대학 PI4D 인센티브 프로그램, 그리고 PVM 내부 경쟁에서 국립 보건원의 지원 기초 연구 자금 프로그램입니다. 내용은 전적으로 저자의 책임 이며 반드시 자금 에이전트의 공식 의견을 대표 하지 않는다. 우리 Tol2 구문, ASAP1 구문에 대 한 마이클 린 고이치 가와카미를 감사 하 고 레너드 Zon ubi 발기인에 대 한 Addgene를 통해 생성.

Zebrafish는 AAALAC 승인 동물 시설에 보관 되어있습니다 그리고 모든 실험 프로토콜 퍼듀 동물 관리 및 사용 위원회 (PACUC)에 의해 승인에 따라 실시 했다.
1. Tol2 Transposon 플라스 미드 구조 준비
참고: Tol2, 메 다카 물고기에서 발견 되었다 transposon zebrafish 연구 커뮤니티8,9사용 널리 있다. 그것은 되었습니다 성공적으로 게이트웨이 사이트 재결합 기반 복제 시스템에 채택 및 Tol2 키트10로 알려진. Tol2 키트는 또한 transgenesis의 효율성을 증가 하는 동안 사용자 지정된 식 구문을 만드는의 더 편리한 방법에 대 한 수 있습니다. 따라서,이 시스템을 활용 하 고 검증된 유비퀴틴 발기인 ASAP111를 사용 하 여 유비 쿼터 스 ASAP1 식 제 브라 라인 만들기 쉬운 결정 이었다.
<ol><li>중간 항목 ASAP1 구조를 만들기: pDONR221 ASAP1<ol>
<li>Addgene에서 pcDNA3.1/순수 하지 않아-CAG-ASAP1 (플라스 미드 #52519), 유전으로 인코딩된 전압 센서 ASAP1 구조를 취득 합니다. ASAP1 코딩 영역 증폭 PCR 뇌관 (그림 1)의 5' 끝에 attB 시퀀스 형벌 사용자 지정된 뇌관 (attB1-ASAP1F와 attB2-ASAP1R)를 사용 하 여 설정 합니다. Phusion DNA 중 합 효소의 높은 효율을 위해 선택 되었다 그리고 PCR 조건12이전 게시 된 프로토콜 따라 최적화 된 했다.</li>
		<li>태 젤 200 µ L 팁, 일반 피 펫을 사용 하 여 1%로 50 µ L PCR 제품을 로드 하 고 약 30 분 동안 가로 젤 탱크에 160 V에서 전기 영동을 수행.</li>
		<li>UV transilluminator에서 젤 확인 (353 nm), UV transilluminator 아래 블레이드/메스를 사용 하 여 이전에 게시13,14, 원하는 밴드 소비 세 그리고 깨끗 한 1.5 mL microcentrifuge로 DNA 포함 하 젤 샘플을 넣어 튜브입니다.</li>
		<li>ASAP1 PCR 제품 젤 정화를 수행 합니다. 제조업체의 지시에 따라 상업 DNA 젤 정화 키트를 사용 하 여 삭제 젤에서 DNA를 복구 하 고 물 20 µ L로 DNA을 elute. 샘플으로 1 µ L를가지고 고는 분 광 광도 계를 사용 하 여 DNA 농도 측정. 빈 컨트롤15로 물을 사용 하 여 소프트웨어 지침 흐름.</li>
		<li>받아 100 ng의 PCR 제품을 정화 하 고 150 믹스 테의 10 µ L 플라스 미드 pDONR221의 ng 버퍼 (10 mM Tris, 1 mM EDTA pH 8.0)16. 반응으로 혈압 Clonase II의 2 µ L을 추가 하 고 품 어 하룻밤 실 온에서 반응.</li>
		<li>둘째 날에는 반응으로 가수분해 K의 1 µ L을 추가 하 고 품 어 30 분 동안 37 ° C에서 반응.</li>
		<li>변환을 수행 합니다. 반응 전송 및 Top10 유능한 대장균 세포 및 품 어 30 분 동안 얼음에 셀의 50 µ L 함께 섞는다. 다음 전송 1 분에 42 ° C 물 목욕으로 반응 관은 즉시 튜브를 제거 하 고 2 분 동안 얼음에 품 어. 다음, 튜브 37 ° C 통에 넣고 1 시간을 위해 그것을 품 어.</li>
		<li>튜브를 꺼내와 대 파운드 플레이트에 셀 접시. 다음, 접시 하룻밤 (16-18 h) 37 ° c.에 품 어</li>
		<li>단일과 잘 분리 된 식민지를 선택 하 고 14 mL 셀 문화 튜브 파운드 매체의 3 mL에 접종. 하룻밤 250 rpm (분당 회전)의 회전 속도 함께 통에 37 ° C에서 문화 그들.</li>
		<li>Miniprep의 명령 수동17다음 상업 miniprep 키트를 사용 하 여 수행 합니다.</li>
		<li>3-4 플라스 미드를 시퀀스 생어 시퀀싱 식별 긍정적인 pDONR221-ASAP1 M13F 및 M13R 시퀀싱 뇌관을 사용 하 여 복제.</li>
	</ol>
</li>
	<li>Microinjection에 대 한 Tol2 구조를 만들기: pDestTol2-유비-ASAP1<ol>
<li>시퀀싱 확인 pDONR221 ASAP1 복제 및 측정의 DNA 농도 분 광 광도 계 다음 빈 제어15물을 사용 하 여 소프트웨어 명령을 사용 하 여 선택 합니다.</li>
		<li>PDONR221-ASAP1의 100 µ g을 100 µ g Tol2 키트 5-엔드 플라스 미드의 혼합 (pENTR5'_ubi, Addgene #27320), 100 µ g (Tol2 키트 #302) p3E-polyA의 및 pDestTol2pA2의 150 µ g (Tol2 키트 #394). 8 µ L 총 볼륨 조정 튜브 1.5 mL microcentrifuge TE 버퍼 (10 mM Tris, 1 mM EDTA, pH 8.0)를 사용 하 고 2-5 s 간단한 소용돌이 의해 잘 혼합. 그런 다음 LR Clonase 2 플러스, 2 µ L을 추가 하 고 품 어 하룻밤 실 온에서 반응.</li>
		<li>두 번째 날, 10 µ L 피 펫을 사용 하 여 반응에 가수분해 K의 1 µ L을 추가 하 고 품 어 30 분 동안 37 ° C에서 반응.</li>
		<li>변환을 수행 하 고 (단계 1.1.7-11) 위에서 설명한 대로 긍정적인 클론을 식별 합니다.</li>
		<li>시퀀싱의 DNA 농도 측정 pDestTol2-유비-ASAP1 복제 (그림 1B)15분 광 광도 계 사용 하 여 확인 합니다. 일반적으로 농도 200ng / µ L입니다.</li>
	</ol>
</li>
</ol>2. Tol2 Transposase mRNA와 주입 솔루션 준비
<ol><li>행진 대장균 글리세롤 주식에 있는 파운드 판 (100 µ g/mL 암 피 실린) pCS2FA transposase 플라스 미드 (Tol2 키트 #396)의 멸 균된 접종 루프를 사용 하 여. 인큐베이터에서 37 ° C에서 접시를 밤새 품 어. 다음 날, 단일 식민지를 선택 하 고 멸 균된 10 µ L 피 펫 팁을 사용 하 여 그것의 파운드 (100 µ g/mL 암 피 실린) 3 mL에 접종. 하룻밤 250 rpm의 회전 속도 함께 통에 37 ° C에서 문화.</li>
	<li>그것의 사용 설명서에 따라 상업 miniprep 키트를 사용 하 여 대장균 문화에 miniprep를 수행 합니다. 1 분 14000 rpm에서 원심 분리기로 TE 버퍼의 30-50 µ L에 플라스 미드 DNA elute 그리고 DNA 농도 분 광 광도 측정.</li>
	<li>내가 가진 플라스 미드의 1-2 µ g endonuclease 선형화 하 고 정화 청소 키트 후 하지의 사용 설명서를 다음 DNA와 DNA 소화. 14000 rpm에서 1 분간 centrifuging 여 물 5 µ L로 DNA를 elute. 에 대 한 예상된 농도 200-300 ng / µ L.</li>
	<li>녹음 방송 생체 외에서 수행 하지 나 상업 SP6 전송 키트를 사용 하 여 DNA 템플렛으로 pCS2FA transposase를 선형화.</li>
	<li>반응이 완료 되 면 Tol2 transposase mRNA 상업적인 RNA 청소를 사용 하 여 제조업체의 지침에 따라 장비를 정화. 마지막으로, 20 µ L RNAase 무료 물으로 mRNA elute 고는 분 광 광도 계에 RNA 농도 측정 한다. 에 대 한 예상된 농도 1-3 µ g / µ L. 견본-80 ° C 냉동 실에 저장할 수 있습니다 필요한 경우.</li>
	<li>20 ng / µ L pDestTol2-유비를 혼합 하 여 microinjection 솔루션 준비-ASAP1 및 Tol2 transposase mRNA (100 ng / µ L) pipetting으로 microcentrifuge 관에서. 반복 해빙과 튜브 당 거, aliquot 6 µ L로 인 한 핵 산 저하를 방지 하려면 나중에 사용-80 ° C 냉동 고에 보관.</li>
</ol>3입니다. microinjection
<ol><li>주입 하기 전에 오후 4-6 번 식 탱크 2 남성 및 2 명의 여성을 설정 합니다. 이 물고기는 오후에 먹여야 하지 해야 합니다. 이 단계 물고기 낭비의 양을 줄일 하 고 다음날 아침 또한 번 식 응답을 유도 하는 동시에 밖으로 그들을 청소 하는 시간을 절약할 것 이다.</li>
	<li>다음 아침, 제거 준비 주입 솔루션 (pDestTol2-유비-ASAP1 구문 및 Tol2 mRNA)-80 ° C 냉동 고에서 얼음에 놓습니다.</li>
	<li>물고기 사육 탱크에에서 디바이 더를 당겨 하 고 물고기 친구를 허용 합니다. 일반적으로, 생선 알을 꺼내 구분선 후 20-30 분 이내. 그렇지 않은 경우 1-2 시간 이상 기다립니다. 일부 물고기 계란을 전혀 놓지 않을 수 있습니다. 이 경우에, 물고기 배아 컬렉션에 대 한이 실험을 반복 합니다.</li>
	<li>기다리는 동안, 거기에 바늘 팁 겸 자, 또는 섬세 한 작업와이 퍼에 침입 하 여 3d 가장자리를 만드는 각도에 깨진 준비 있는지 확인 합니다.<ol>
<li>다음 매개 변수를 사용 하 여 micropipette 끌어당기는 사람에 유리 모 세관에서 바늘을 당겨: 545;가 열 풀 60; 속도 80; 시간 250; 압력 500입니다. 각도 약 45 °에는 집게를 잡고 집게 (직경 추정에 대 한 눈 조각 통치자)와 절 개 범위 아래와 바늘을 휴식. 원하는 바늘 직경 microinjector 설정에 따라 변수가 될 수 있습니다 하지만 작은 직경은 태아 사망률 감소에 대 한 선호.</li>
	</ol>
</li>
	<li>일단 물고기는 계란, 10 cm 직경 페 트리 접시에에서 그들을 수집 하 고 절 개 범위에 그들을. 모든 비정상적인 배아를 제거 하 고 폐기물을 물고기.</li>
	<li>피펫으로 준비 3 %agarose 주입으로 수정 된 배아 금형. 장소에 배아를 유지할 수 있도록 초과 물을 제거 합니다.</li>
	<li>일단 모든 행 가능한 배아 가득 정렬 있도록 모든 단일 셀 약 45 ° 각도 수평으로 바늘을 향해 같은 방향으로 얼굴. 이것을 쉽게 주입 훨씬 나중.</li>
	<li>장갑을 끼고, 동안 20 µ L 로드 피펫으로 사용 팁과 얼음에 튜브에서 준비 된 구문 5 µ L를 제거.</li>
	<li>신중 하 게 그것은 팁에 가까운 시를 얻을로 꼭지를 시작 하는 위치에 있는 모든 방법이 깨진된 모 세관 튜브의 백 엔드에 팁을 삽입 합니다. 경우 여전히 공기 방울, 바늘, 팁을 아프게 하지를 흔들.</li>
	<li>Microinjection 바늘 홀더 연속으로 바늘을 삽입 하 고 바늘 자리에 유지 될 때까지 신중 하 게 강화. 약 45 ° 각도 조정 합니다.</li>
	<li>일단 바늘 준비 하 고 연결, 현미경 및 가스 압력 탱크를 켭니다. 상업 CO2 탱크는이 목적을 위해 일반적으로 좋다. 지주 및 방출 압력에 의해 분사 볼륨 조정: 대략 0.5 psi 지주 및 방출에 대 한 30 psi. 솔루션 때 페달을 누르면 밖으로 나오는 것을 확인 해야 합니다.</li>
	<li>~ 150 µ m 직경에서 솔루션의 흐름과 볼륨 조정 미네랄 오일의 방울으로 무대 마이크로미터를 사용 하 여 (약 2 nL). 백 프레셔 바늘의 똑 작은 금액을 드릴 것입니다 확인 하십시오. 충분히 다시 압력 없는 경우 모 세관 작용 액체 바늘을 입력 하는 mRNA를 파괴 하면 됩니다.</li>
	<li>일단 바늘 보정, 수정 된 배아의 단일 셀에는 구조 주입 시작. 참고:이 연습, 인 내, 그리고 기교, 피어스 하드 되 세포 막 때문에 많은 양의 걸립니다. 그것은 셀, 아니라 노 른 자, 유전자 변형 zebrafish를 생성 하기 위한 솔루션을 주입 하는 것이 중요입니다. 이 morpholino 주입에 다릅니다. 그것은 어느 쪽 바늘 입력 셀 구성 셀에가 하는 만큼 중요 하지 않습니다. 노 른 자는 셀에 주입 하는 경우는 transgenesis 성공의 매우 낮은 속도 할 것 이다. 단일 셀 단계 주입은 또한 중요 하다, 또는 체세포 키메라 물고기를 만들 것입니다. 이 세균 세포에 들어가는 transgene의 가능성을 줄일 것 이다.</li>
	<li>젤 노치의 가장자리를 사용 하 여 제공 하는 장소에서 태아를 유지 및 태아를 이동 하지 않고 압력을 적용 하 니 백업. 일단 바늘의 팁 단일 셀에 원하는 양의 솔루션 출시 페달을 누릅니다. 배아의 모든에 대해이 프로세스를 반복 합니다.</li>
	<li>완료 되 면, 물고기 시스템 물과 일회용 3.4 mL 전송 피 펫 agarose 노치에서 그들을 rinsing 하 여 레이블이 지정 된 그릇에 주입 된 배아를 전송. 그들이 개발 하는 28.5 ° C 인큐베이터에 배아를 저장 합니다. 죽은 물고기 배아를 제거 하는 하루 동안 다시 확인 하 고 0.1% 메 틸 렌 블루 물고기 물에서 물을 바꿉니다.</li>
	<li>주입 후 약 6-8 시간 걸릴 10 개인 주입 배아 물고기 고18인가요 메서드 사용 하 여 그들에서 게놈 DNA를 준비 합니다.</li>
	<li>다음 아침, 비 노 른 자 조직에 GFP를 보여주는 배아 밖으로 정렬 하려면 형광 광원으로 해 부 현미경을 사용 합니다. 이러한 물고기 배아 삽입 된 구문을 포함 해야 합니다.</li>
	<li>Tol2 소비 분석 결과 확인 앞에서 설명한19transposon 활동을 수행 합니다. 삭제 플라스 미드를 감지할 수 있습니다, 유지는 삽입 된 배아를 물고기와 그들을 인상. 아니 삭제 플라스 미드는 검출 될 수 있다, Tol2 소비 분석 결과의 긍정적인 결과 얻을 때까지 Tol2 mRNA 합성 및 microinjection 프로세스를 반복 합니다.</li>
</ol>4. 유전자 변형 ASAP1 물고기, 안내 설정 (ubi: ASAP1)
<ol><li>앞에서 설명한 zebrafish 책20에서 성인 기에 주입 된 물고기를 (F0 세대)를 올립니다. 이 일반적으로 약 4 개월 걸립니다.</li>
	<li>단일 성인 F0 물고기 고 성별 wildtype 물고기 반대 한 번으로 교차. 나중에 번 식 후 물고기 배아를 수집 합니다. 물고기에서 28.5 ° C 배양 기에서 수집한 물고기 배아 0.1% 메 틸 렌 블루 물 유지.</li>
	<li>제 3의 날에 GFP 필터 형광 해 부 현미경 아래 물고기 배아를 확인 합니다. 있을 경우, 초록 물고기 배아 밖으로 정렬 하 고 F1 세대 유전자 변형 물고기, Tg 성인이 그들을 인상 (ubi: ASAP1). 참고: 이후 부모의 F0 물고기의 대부분은 세균 선 유전자 키메라 Mendelian 비율 예상 하지는.</li>
	<li>크로스 wildtype 물고기와 단일 F1 성인 물고기 고 물고기 배아를 수집 합니다. 초록 물고기 배아 밖으로 정렬 하 고 F2 세대 생선으로 성인 기에 발생. 참고: 녹색과 비 그린 물고기 배아 가까이 있어야 한다 1:1 단일 transgene 인지.</li>
	<li>악성 말 초 신경 칼 집 종양 (MPNST) 같은 종양에서 전기 잠재적인 변화를 보려면 F2 세대 Tg 크로스 (ubi: ASAP1) rpl35hi258/wt 물고기와 물고기. 보이는 종양 6-8 달 오래 된 성인21,22에서 찾을 수 시작을 알려졌다.</li>
</ol>5입니다. 영상
<ol><li>Zebrafish 태아 이미지, 여러 F2 세대 설립자 물고기 고 개별 쌍에서 wildtype 물고기와 그들을 교차 하는 것 하. 준비 가이드23zebrafish에 따르면 다른 원하는 발달 단계에서 물고기 배아를 수집 합니다.</li>
	<li>물고기 배아의 초기 단계에 대 한 껍질 하 고 신중 하 게 집게의 쌍을 사용 하 여 10 cm 직경 물고기 시스템 물으로 페 트리 접시에에서 절 개 범위에서 배아의 chorions를 제거 합니다.</li>
	<li>3.4 mL 처분할 수 있는 이동 피 펫을 사용 하 여 3% 스와 concaved 유리 슬라이드에 몇 가지 물고기 배아를 전송 합니다. 배아는 형광 절 개 범위 아래 바늘을 사용 하 여 셀룰러 GFP 활동을 볼 수 원하는 위치를 조정 합니다.</li>
	<li>물고기의 이동 단계 배아 (12 somite 단계 보다 더 오래 된), 0.05% tricaine mesylate 물고기 배아 슬라이드에 그들을 전송 하기 전에 anesthetize를 사용 합니다. 간단히, 그들은 수영, 손실 신체 균형을 멈출 때까지 물고기 배아 물고기 물에서 0.05% tricaine mesylate에 등장 했다. 또한, 슬라이드에는 스와 0.05% tricaine mesylate 방울을 추가 합니다.</li>
	<li>미만 12 somite 무대 물고기 배아에 대 한 호환 카메라와 소프트웨어 피 형광 화합물 현미경을 사용 하 여 이미징. 12 somite 무대 물고기 배아 보다 오래 된에 대 한 형광 해 부 현미경을 사용 합니다.</li>
	<li>종양 세포 전압 이미지, 먼저 MPNST 종양 물고기를 식별. 그런 다음 anesthetize 0.05% tricaine mesylate와 물고기. 전체 산에 대 한 이미징, 10 cm 직경 페 트리 접시에 생선을 넣어. 종양 세포 전기 활동을 보려면 물고기 종양 수 수 해 부 밖으로 전체 마운트 영상 후.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

저자는 공개 없다.

있지만 세포와 조직 수준의 전기 활동 배아 개발 및 인간 질병 동안 오래 전에 발견 되었다, vivo에서 동적 전기 변화 및 그들의 생물학 역할 여전히 남아 크게 알 수 없는. 주요 과제 중 하나는 시각화 하 고 계량 전기 변화입니다. 단일 셀을 추적 하기 위한 휴식 통해 패치 클램프 기술 이다 하지만 그들은 많은 세포의 구성 되어 있기 때문에 척추 동물 배아의 응용 제한 됩니다. 현재 화학 전?...

전기 이온 채널과1세포 막 있는 펌프에 의해 중재 생 전기 신호를 말합니다. 세포 막과 결합 된 전기 잠재력과 현재 변화, 이온 교환 프로세스 고르기 신경 및 근육 세포의 신호에 대 한 필수적입니다. 또한, 전기 및 이온 기온 변화도 다른 중요 한 생물 학적 기능 에너지 저장, 생 합성, 대사 산물 수송 등의 다양 한이 있다. 생체 전기 신호도 몸 축, 세포 주기, 세포 감 별 법1등 미 발달 패턴 형성의 레 귤 레이 터로 발견 되었다. 따라서, 그것은 이러한 유형의 신호의 미 규제에 기인 하 많은 인간의 선 천 성 질병을 이해 중요 합니다. 패치 클램프 널리 사용 되었습니다 단일 셀 기록, 배아 발달 비보중 여러 셀의 동시 모니터링에 이상적에서 멀리 아직도 이다. 또한, 전압 민감한 작은 분자는 또한 그들의 특이성, 감도, 및 독성 vivo에서 애플리케이션에 적합 하지.
창조의 다양 한 유전자 형광 전압 표시기 (GEVIs) 제공이이 문제를 극복 하기 위해 새로운 메커니즘이 인코딩되고 그들은 원래 신경 모니터링 위한 했다 비록 배아 개발 공부를 쉽게 응용 프로그램에 대 한 허용 2,3세포. 현재 사용할 수 있는 GEVIs 중 하나는 가속 센서의 활동 전위 1 (ASAP1)4입니다. 그것은 전압 과민 한 인산 가수분해 효소와 원형으로 배치 된 녹색 형광 단백질의 전압 감지 도메인의 extracellular 루프의 구성 됩니다. 따라서, ASAP1 세포 전기 잠재적인 변화의 시각화 수 (분극: 밝은 녹색; 도발은: 진한 녹색). ASAP1 속도 론 온 오프 2 ms, 있으며 subthreshold 잠재적인 변경4를 추적할 수 있습니다. 따라서,이 유전 도구 라이브 셀에 실시간 생체 모니터링에 효능의 새로운 수준에 대 한 수 있습니다. 배아 발달에 많은 인간 질병, 암, 등 전기의 역할의 더 이해 것입니다 창 고 기본 메커니즘에 새로운 빛이는 질병 치료 및 예방에 매우 중요.
Zebrafish 강력한 동물 모델 개발 생물학과 암5,6을 포함 하 여 인간의 질병을 입증 되었습니다. 인간, 70 %orthologous 유전자를 공유 하는 그들은 그리고 그들은 유사한 척 추가 있는 생물학7. Zebrafish는 비교적 쉽게 치료, 계란, 온순한 유전학, 쉬운 transgenesis, 그리고 투명 한 외부 배아 발달, 그들에 게 비보에 이미징5,6우수한 시스템의 큰 클러치 크기를 제공 합니다. 이미 존재 하는 돌연변이 물고기 선의 큰 소스와 완전히 시퀀스 게놈, zebrafish는 과학적 발견의 상대적으로 무제한 범위를 제공 합니다.
Vivo에서 실시간 전기 세포의 활동을 조사, 우리 활용 zebrafish 모델 시스템 및 ASAP1. 이 문서에서 우리는 형광 전압 바이오 센서 ASAP1 Tol2 transposon transgenesis를 사용 하 여 zebrafish 게놈으로 통합 하는 방법을 설명 하 고 배아 개발, 물고기 애벌레 움직임, 그리고 라이브 종양에서 세포 전기 활동을 시각화 .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

전기, 내 생 전기적 신호 이온 채널에 의해 중재 및 세포 막에 있는 펌프 고르기 신경 및 근육 세포의 프로세스와 같은 다른 많은 생물 학적 과정, 신호에 중요 한 역할 배아 개발 패턴입니다. 그러나, vivo에서 전기 활동 모니터링 척추 embryogenesis에 대 한 필요가 있다. 인코딩된 유전자 형광 전압 표시기 (GEVIs)의 진보는이 전에 대 한 솔루션을 제공할 수 만들었습니다. 여기, 우리 유전자 변형 전압 표시기 zebrafish 설립된 전압 표시기, ASAP1를 사용 하 여 만드는 방법에 설명 (가속 센서의 활동 전위 1), 예를 들어. Tol2 키트와 유비 쿼터 스 zebrafish 발기인, ubi, 이 연구에서 선정 됐다. 우리는 또한 게이트웨이 사이트 복제, Tol2 transposon 기반 zebrafish transgenesis, 그리고 일반 epifluorescent 현미경을 사용 하 여 초기 단계 물고기 배아와 물고기 종양에 대 한 이미징 프로세스의 프로세스를 설명 합니다. 이 물고기 라인을 사용 하 여, 우리는 제 브라 embryogenesis, 그리고 물고기 애벌레 운동 하는 동안 세포 전기 전압 변화는 발견. 또한, 몇 가지 zebrafish 악성 말 초 신경 칼 집 종양, 셀은 일반적으로 편광 종양 주변 정상 조직에 비해 관찰 되었다.

성공적인 주입, 주입 50% 물고기 배아는 체세포에 녹색 형광의 어느 정도 표시 됩니다 그리고 그들의 대부분은 Tol2 transposon 소비 분석 결과 (그림 2)에 의해 긍정적인 것 보다 더 많은. 후 2-4 세대-wildtype 물고기 (까지 형광 물고기 도달 예상된 Mendelian 비율 50%)와 교차, 유전자 변형 물고기 배아 개발 하는 동안 세포 막 잠재력을 추적 하기 위해 이미징 실?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Zebrafish 초기 배아에 종양 세포 전기 활동의 시각화

여기, 우리가 배아 개발, 운동, 시각화 세포 전기 전압 기자 제 브라 라인을 만드는 과정을 보여 그리고 물고기 종양 vivo에서세포.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

8.7K 조회수.  Purdue University. 여기, 우리가 배아 개발, 운동, 시각화 세포 전기 전압 기자 제 브라 라인을 만드는 과정을 보여 그리고 물고기 종양 vivo에서세포.

비디오: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological systems. In FDAP experiments, the clearance of proteins within living organisms can be measured. A protein of interest is tagged with a photoconvertible fluorescent protein, expressed in vivo and photoconverted, and the decrease in the photoconverted signal over time is monitored. The data is then fitted with an appropriate clearance model to determine the protein half-life. Importantly, the clearance kinetics of protein populations in different compartments of the organism can be examined separately by applying compartmental masks. This approach has been used to determine the intra- and extracellular half-lives of secreted signaling proteins during zebrafish development. Here, we describe a protocol for FDAP experiments in zebrafish embryos. It should be possible to use FDAP to determine the clearance kinetics of any taggable protein in any optically accessible organism.

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Protein levels in cells and tissues are often tightly regulated by the balance of protein production and clearance. Using Fluorescence Decay After Photoconversion (FDAP), the clearance kinetics of proteins can be experimentally measured in vivo.

광 변환 한 후 형광 붕괴를 사용하여 생활 Zebrafish의 태아의 단백질 안정성을 측정 (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

연구

발생학

Mechanical Vessel Injury in Zebrafish Embryos

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes. External development and optical transparency make these embryos especially amenable to microscopy, and numerous transgenic lines that label specific cell types with fluorescent proteins are available, making the zebrafish embryo an ideal system for visualizing the interaction of vascular, hematopoietic, and other cell types during injury and repair in vivo. Forward and reverse genetics in zebrafish are well developed, and pharmacological manipulation is possible. We describe a mechanical vascular injury model using micromanipulation techniques that exploits several of these features to study responses to vascular injury including hemostasis and blood vessel repair. Using a combination of video and timelapse microscopy, we demonstrate that this method of vascular injury results in measurable and reproducible responses during hemostasis and wound repair. This method provides a system for studying vascular injury and repair in detail in a whole animal model.

This article describes a method for creating a mechanical vessel injury in zebrafish embryos. This injury model provides a platform for studying hemostasis, injury-related inflammation, and wound healing in an organism ideally suited for real-time microscopy.

Zebrafish의 태아에서 기계 선박 부상

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo development due to their similar developmental process. Although genetic factors are known to affect early embryonic development, the discovery of such factors has been a serious challenge. Microarray technology allows quantitative measurement and gene expression profiling of transcript levels on a genome-wide basis. One of the main decisions that have to be made when planning a microarray experiment is whether to use a one- or two-color approach. Two-color design increases technical replication, minimizes variability, improves sensitivity and accuracy as well as allows having loop designs, defining the common reference samples. Although microarray is a powerful biological tool, there are potential pitfalls that can attenuate its power. Hence, in this technical paper we demonstrate an optimized protocol for RNA extraction, amplification, labeling, hybridization of the labeled amplified RNA to the array, array scanning and data analysis using the two-color analysis strategy.

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Microarray technology allows quantitative measurement and gene expression profiling of transcripts on a genome-wide basis. Therefore, this protocol provides an optimized technical procedure in a two-color custom made bovine array using Day 7 bovine embryos to demonstrate the feasibility of using low amount of total RNA.

의 사체 프로파일 링<em&gt; 생체</em2 색의 마이크로 어레이 플랫폼을 사용하여&gt; 제작 소 착상 전 배아

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

분리 및 Zebrafish의 배아에서 단일 세포의 특성

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

살아있는 개구리와 Zebrafish 태아의 저산소증 유도

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to numerous cell types throughout the body. Understanding the biology of the neural crest has been limited, reflecting a lack of genetically tractable models that can be studied in vivo and in real-time. Zebrafish is a particularly important developmental model for studying migratory cell populations, such as the neural crest. To examine neural crest migration into the developing eye, a combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time videos of the developing eye in transgenic zebrafish embryos, namely Tg(sox10:EGFP) and Tg(foxd3:GFP), as sox10 and foxd3 have been shown in numerous animal models to regulate early neural crest differentiation and likely represent markers for neural crest cells. Multi-photon time-lapse imaging was used to discern the behavior and migratory patterns of two neural crest cell populations contributing to early eye development. This protocol provides information for generating time-lapse videos during zebrafish neural crest migration, as an example, and can be further applied to visualize the early development of many structures in the zebrafish and other model organisms.

A combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time imaging of neural crest migration in Tg(sox10:EGFP) and Tg(foxd3:GFP) zebrafish embryos.

실시간으로 개발을 시각화 하기 위해 다중 광자 시간 경과 영상: 마이그레이션 Zebrafish 태아 신경 크레스트 셀의 시각화

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

노드 및 스캐닝 전자 현미경 검사 법, 면역 형광 산 전체를 사용 하 여 Gastrulating 마우스 배아에서 Notochordal 접시를 시각화

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. Although many immunohistochemistry protocols have been optimized for mammalian tissue and tissue sections, these protocols often require modification and optimization for non-mammalian model organisms. Zebrafish are increasingly used as a model system in basic, biomedical, and translational research to investigate the molecular, genetic, and cell biological mechanisms of developmental processes. Zebrafish offer many advantages as a model system but also require modified techniques for optimal protein detection. Here, we provide our protocol for whole-mount fluorescence immunohistochemistry in zebrafish embryos and larvae. This protocol additionally describes several different mounting strategies that can be employed and an overview of the advantages and disadvantages each strategy provides. We also describe modifications to this protocol to allow detection of chromogenic substrates in whole mount tissue and fluorescence detection in sectioned larval tissue. This protocol is broadly applicable to the study of many developmental stages and embryonic structures.

Here, we present a protocol for fluorescent antibody-mediated detection of proteins in whole preparations of zebrafish embryos and larvae.

제브라피시 배아와 애벌레의 전체 마운트 면역항암화학

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

초기 마우스 배아에서 시퀀싱을 위한 작은 RNA 라이브러리 의 준비

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...