עבודות המחקר דיווח בפרסום זה נתמך על ידי הלאומית המכון כללי רפואי למדעים של מכוני הבריאות הלאומיים תחת פרס מספר R35GM124913 PI4D מאוניברסיטת Purdue תמריץ התוכנית, PVM פנימי תחרותי תוכנית קרנות מחקר בסיסי. התוכן הוא אך ורק באחריות המחברים, ואינם מייצגים בהכרח את הנופים הרשמי של הסוכנים מימון. אנו מודים קואיצ'י Kawakami על Tol2 הבונה, מייקל לין עבור הבונה ASAP1, ולבנות לאונרד Zon ייצוג המקדם ubi דרך Addgene.

דג זברה מוחזקים במתקן בעל חיים שאושרו על-ידי AAALAC, כל הניסויים בוצעו לפי הפרוטוקולים אושרה על ידי טיפול בעלי חיים פרדו שימוש הוועדה (PACUC).
1. Tol2 Transposon פלסמיד לבנות הכנה
הערה: Tol2, transposon שנתגלה בשנת medaka דגים, נרחב שימש ב8,9קהילת המחקר דג זברה. כבר בהצלחה לאמץ את שער ספציפי לאתר רקומבינציה מערכת מבוססת-שיבוט, המכונה ערכת Tol210. ערכת Tol2 מאפשר דרך נוחה יותר של יצירת ביטוי אישית בונה, בעת גם להגדיל את היעילות של transgenesis. לכן היה החלטה קלה כדי לנצל את היתרון של מערכת זו, וליצור בכל מקום ASAP1 ביטוי דג זברה קו באמצעות מקדם המאומת אוביקוויטין לנהוג ASAP111.
<ol><li>יצירת מבנה התיכון כניסה ASAP1: pDONR221-ASAP1<ol>
<li>רוכשים הבונה חיישן ASAP1 מתח מקודדים גנטית, pcDNA3.1/פורו-חטיבתי-ASAP1 (פלסמיד #52519), מ- Addgene. כדי להגביר את האזור קידוד ASAP1, להגדיר PCR באמצעות את אישית תחל (attB1-ASAP1F ו- attB2-ASAP1R) תמר מוקף עם רצפים attB בקצה 5' של תחל (איור 1). Phusion DNA פולימראז נבחרתי שלה יעילות גבוהה, תנאי ה-PCR אופטימציה בהתבסס על פרוטוקול שפורסמו בעבר12.</li>
		<li>טען את המוצרים PCR µL 50 % 1 טה ג'ל באמצעות פיפטה רגיל עם טיפים µL 200, ולבצע אלקטרופורזה-160 V במיכל אופקי ג'ל למשך כ- 30 דקות.</li>
		<li>בדוק את הג'ל תחת transilluminator UV (353 nm), לסלק את הלהקה הרצוי באמצעות אזמל/להב תחת transilluminator UV שפורסמו בעבר13,14ו להכניס המכיל ג'ל לדנ microcentrifuge mL 1.5 נקי שפופרת.</li>
		<li>לבצע טיהור ג'ל עבור המוצרים ASAP1 PCR. לשחזר את ה-DNA הג'ל נכרת שימוש מסחרי DNA ג'ל ערכת טיהור בעקבות ההוראה של היצרן, elute את ה-DNA לתוך 20 µL של מים. קח 1 µL כמדגם, מודדים את ריכוז הדנ א באמצעות ספקטרופוטומטרים. זורמים ההוראות תוכנה באמצעות מים כמו בקרה הריק15.</li>
		<li>קח 100 ננוגרם של לטהר המוצר PCR ומערבבים אותו עם 150 ng של פלסמיד pDONR221 ב- 10 µL של טה מאגר (10 מ מ טריס, 1 מ מ EDTA pH 8.0)16. להוסיף 2 µL של BP Clonase השני לתוך התגובה, דגירה התגובה בטמפרטורת החדר למשך הלילה.</li>
		<li>ביום השני, להוסיף 1 µL של proteinase K לתוך התגובה, דגירה התגובה ב 37 מעלות צלזיוס למשך 30 דקות.</li>
		<li>לבצע טרנספורמציה. להעביר את התגובה ומערבבים אותו עם µL 50 של Top10 המוסמכת e. coli תאים, דגירה התאים על קרח למשך 30 דקות. אז, העברת הצינור התגובה לתוך אמבט מים 42 ° C עבור מינימלית 1 מיד להסיר את הצינור, דגירה על קרח למשך 2 דקות. בשלב הבא, לשים את הצינור לתוך מטרף 37 ° C, דגירה זה מאובטח.</li>
		<li>תוציאי את הצינור, צלחת התאים לצלחת kanamycin ליברות. בשלב הבא, דגירה את הצלחת בן לילה (16-18 h) ב 37 º C.</li>
		<li>לבחור אחת, מופרדים היטב מושבות, לחסן אותם לתוך צינורות תרבות תא 14 מ עם 3 מ ל LB בינוני. תרבות אותם בן לילה ב 37 מעלות צלזיוס ב שייקר עם מהירות סיבוב של 250 סל"ד (סיבוב לדקה).</li>
		<li>לבצע miniprep באמצעות ערכת miniprep מסחרי בעקבות ידנית את ההוראה17.</li>
		<li>רצף פלסמידים 3-4 עם סנגר רצף לזהות pDONR221 חיובי-ASAP1 שיבוטים באמצעות תחל רצף M13F ו- M13R.</li>
	</ol>
</li>
	<li>יצירת הבונה Tol2 עבור microinjection: pDestTol2 -ubi-ASAP1<ol>
<li>לבחור שהרצף לאמת pDONR221-ASAP1 שיבוט ולמדוד את ריכוז הדנ א באמצעות קהל מעריצים ספקטרופוטומטרים ההוראה תוכנה באמצעות מים כפי ריק לשלוט15.</li>
		<li>קח 100 µg של pDONR221-ASAP1, ולערבב עם 100 µg של Tol2 ערכת 5-end פלסמיד (pENTR5'_ubi, Addgene #27320), 100 µg של p3E-תיקים עשויים (ערכת Tol2 #302) ו- 150 µg של pDestTol2pA2 (Tol2 ערכת #394). להתאים את הנפח הכולל כדי 8 µL באמצעות מאגר TE (10 מ מ טריס, 1 מ"מ EDTA, pH 8.0) ב- microcentrifuge 1.5 מ ל צינור ומערבבים היטב על ידי מערבולת קצרה של s 2-5. לאחר מכן, להוסיף 2 µL LR Clonase השנייה פלוס, דגירה התגובה בטמפרטורת החדר למשך הלילה.</li>
		<li>ביום השני, להוסיף 1 µL של proteinase K לתוך התגובה באמצעות פיפטה 10 µL, דגירה התגובה ב 37 מעלות צלזיוס למשך 30 דקות.</li>
		<li>לבצע טרנספורמציה ולזהות שיבוטים חיובי כפי שתואר לעיל (צעדים 1.1.7-11).</li>
		<li>מדד ריכוז ה-DNA רצף לאמת שיבוט pDestTol2-ubi-ASAP1 (איור 1B) באמצעות ספקטרופוטומטרים15. בדרך כלל הריכוז הוא סביב 200ng/µL.</li>
	</ol>
</li>
</ol>2. מכינים Tol2 Transposase mRNA והפתרון הזרקה
<ol><li>רצף של e. coli גליצרול מלאי של פלסמיד pCS2FA-transposase (Tol2 ערכת #396) על צלחת ליברות (עם 100 אמפיצילין µg/mL) באמצעות לולאה חיסון מעוקר. דגירה בן לילה את הצלחת ב 37 מעלות צלזיוס בתוך אינקובטור. למחרת, לבחור שמושבה בודדת, לחסן אותו לתוך 3 מ"ל של ליברות (אמפיצילין µg 100/mL) באמצעות טיפ פיפטה של 10 µL מעוקר. תרבות זה בין לילה ב 37 מעלות צלזיוס ב שייקר עם מהירות סיבוב של 250 סל"ד.</li>
	<li>מבצע miniprep התרבות החיידק באמצעות ערכת miniprep מסחרי בעקבות ההדרכה שלה. Elute דנ א פלסמיד לתוך 30-50 µL טה מאגר על ידי צנטריפוגה דקה-14,000 סל ד, מודדים את ריכוז הדנ א שלה עם ספקטרופוטומטרים.</li>
	<li>Linearize µg 1-2 של פלסמיד עם לא אני endonuclease ולטהר ה-DNA עם ה-DNA בעקבות ההדרכה שלה אחרי לא ערכת ניקוי מערכת העיכול. Elute ה-DNA לתוך 5 µL של מים על ידי צריך שתוציאו ב 14,000 rpm במשך דקה אחת. ריכוז הצפוי הוא על 200-300 ng/µL.</li>
	<li>לבצע תמלול במבחנה עם לא אני לליניארית pCS2FA-transposase בתור תבנית ה-DNA באמצעות ערכת שעתוק SP6 מסחרי.</li>
	<li>לאחר סיום התגובה, לטהר transposase Tol2 mRNA באמצעות ניקוי RNA מסחרי קיט ההוראות של היצרן. לבסוף elute mRNA לתוך מים ללא RNAase µL 20, מודדים את ריכוז ה-RNA בספקטרופוטומטר. ריכוז הצפוי הוא על 1-3 µg / µL. דוגמאות שניתן לאחסן במקפיא-80 ° C במידת הצורך.</li>
	<li>להכין את הפתרון microinjection על ידי ערבוב 20 ng/µL pDestTol2 -ubi-transposase ASAP1, Tol2 ה-mRNA (100 ng/µL) צינור microcentrifuge על ידי pipetting. כדי למנוע השפלה חומצת גרעין הנגרמת על ידי מפשיר חוזרות ונשנות, refreezing, aliquot µL 6 למחזור ואחסן אותו במקפיא-80 ° C לשימוש עתידי.</li>
</ol>3. microinjection
<ol><li>להגדיר 4-6 טנקים רבייה לפחות 2 זכרים ו 2 נקבות אחר הצהריים לפני ההזרקה. הדגים האלה לא חייבים להיות מוזן בשעות אחר הצהריים. שלב זה להפחית את כמות הפסולת דגים ולחסוך זמן כדי לנקות אותם בבוקר שלמחרת, תוך שהיא מסייעת גם לגרום לתגובה הרבייה.</li>
	<li>למחרת בבוקר, להסיר את הפתרון הזרקת מוכן (pDestTol2 -ubi-ASAP1 לבנות, Tol2 mRNA) מהמקפיא-80 ° C, ומניחים אותו על קרח.</li>
	<li>. עצור את המחיצות הדג גידול טנקים ולאפשר את הדגים להזדווג. באופן כללי, דג טהור מטיל ביצים בתוך 20-30 דקות לאחר הוצאת על המפריד. אם לא, להמתין עוד 1-2 שעות. דגים מסוימים יכולים לא להטיל ביצים בכלל. במקרה זה, חזור על הניסוי הזה לאוסף העובר דגים.</li>
	<li>תוך כדי המתנה, ודא כי קיימים המוכנים הקצה נשבר בזווית יצירת קצה שקוע עם מלקחיים, או על ידי שבירת על מגב המשימה העדינה מחטים.<ol>
<li>. תמשכי מחטים נימי זכוכית פולר micropipette באמצעות הפרמטרים הבאים: חום 545; משוך 60; מהירות 80; זמן 250; הלחץ 500. תשבור את המחט עם מלקחיים מתחת טווח לנתיחה (עם העין-קטע סרגל עבור הערכה קוטר) על-ידי החזקת המלקחיים על זווית כ 45 °. מחט הרצוי קטרים יכולים להיות משתנה בהתאם להגדרות microinjector, אבל קוטר קטן הוא מועדף להפחתת תמותת העובר.</li>
	</ol>
</li>
	<li>ברגע הדג יש הטילו ביצים, לאסוף אותם ב 10-ס מ קוטר צלחת פטרי ולהביא אותם על הטווח לנתיחה. הסר כל העוברים לא נורמלי, דגים פסולת.</li>
	<li>Pipet העוברים מופרית לתוך הזריקה מוכנה 3% agarose עובש. הסרת עודפי מים כדי לשמור על העוברים במקום.</li>
	<li>ברגע כל השורות מלאים עם עוברים קיימא, לסדר אותם כך כל התאים פונים לאותו הכיוון לעבר המחט, וזה בערך בזווית של 45° אופקית. פעולה זו תגרום הזרקת קל יותר מאוחר יותר.</li>
	<li>כשאתה לובש כפפות, להשתמש pipet 20 µL הטעינה עצה 5 µL של הבונה מוכן ולהסיר הצינורית על קרח.</li>
	<li>הכנס בקפידה את הטיפ בקצה האחורי של צינור קפילרי שבור כל הדרך עד איפה זה מתחיל כדי מוזג הברים, גם לקבל הכימית קרוב הטיפ. אם יש עדיין בועות אוויר, לנער את המחט, מקפיד לא לשבור את הטיפ.</li>
	<li>את המחט ישר לתוך למחזיק המחט microinjection והדק בזהירות עד המחט נשאר במקום. להתאים את הזווית כדי בערך 45°.</li>
	<li>ברגע המחט הוא מוכן, מצורף, הפעל למיכל לחץ מיקרוסקופ וגז. מסחרית CO2 טנקים טובים בדרך כלל למטרה זו. האחסון ההזרקה מותאם על ידי הלחץ החזקה, הוצאה: משוער psi 0.5 להחזקת ו- 30 psi לניתוק. הקפד לבדוק כי הפתרון יוצא בעת לחיצה על הדוושה.</li>
	<li>באמצעות מיקרומטר על הבמה עם טיפה של שמן מינרלי, להתאים את עוצמת הקול ואת הזרימה של הפתרון מיקרומטר ~ 150 קוטר (על 2 nL). ודא כי הלחץ גב יאפשר כמות קטנה לטפטף החוצה של המחט. אם אין לחץ מספיק אחורי, נימיות תגרום נוזל מזין את המחט ולהשמיד את ה-mRNA.</li>
	<li>ברגע שהמחט מכויל, מתחילים הזרקת הבונה לתוך התא הבודד של העוברים מופרית. הערה: פעולה זו מעבירה כמות גדולה של תרגול, סבלנות, עידון, עקב קרום התא קשה לחדור. חשוב להחדיר את הפתרון לתוך התא, לא החלמון, ליצירת דג זברה מהונדס. זה שונה מורפולינו הזרקה. זה לא משנה באיזה צד המחט חודרים לתא ככל הבונה נכנס לתא. Transgenesis יהיה שיעור נמוך מאוד של הצלחה אם מוזרק לתוך החלמון במקום התא. הזרקת תא בודד שלב חשוב גם, או דגים כמירה סומאטית ייווצר. פעולה זו תקטין את הסיכוי transgene נכנס אל תאי הנבט.</li>
	<li>השתמש הקצה של החריץ ג'ל כדי לספק גיבוי כל הזמן העובר במקום ומאפשרת את המחט להפעיל לחץ מבלי להזיז את העובר. לאחר קצה המחט בתא בודד, לחץ על דוושת לשחרר את הכמות הרצויה של פתרון. חזור על תהליך זה עבור כל אחד מהעוברים.</li>
	<li>לאחר השלמת, העברת העוברים מוזרק לתוך תבשיל שכותרתו בהדחה מתוך החריץ agarose עם מערכת מים, פיפטה העברה של mL 3.4 חד פעמיות. אחסן את העוברים חממה 28.5 ° C כדי לתת להם לפתח. בדוק שוב במהלך היום הסרת עוברי דגים מתים ולהחליף מים עם 0.1% מתילן כחול במים דגים.</li>
	<li>כ- 6-8 שעות לאחר ההזרקה, קח 10 הפרט מוזרק דגים עוברי והכן DNA גנומי אותם באמצעות שיטה קטלנית18.</li>
	<li>למחרת בבוקר, להשתמש במיקרוסקופ לנתיחה עם מקור אור זריחה למיין את העוברים מציג GFP ברקמות שאינן-חלמון. אלה העוברים דגים צריך להכיל הבונה מוזרק.</li>
	<li>לבצע Tol2 assay בלו כדי לבדוק את פעילות transposon כפי שתואר לעיל19. אם נכרת פלסמיד יכול להתגלות, לשמור את מוזרק דגים עוברי ולגדל אותם. אם אין פלסמיד נכרת יכול להתגלות, חזור על סינתזת Tol2 mRNA את תהליך microinjection עד להשגת התוצאות החיוביות של Tol2 בלו וזמינותו.</li>
</ol>4. הקמת ASAP1 הטרנסגניים דגים, Tg (ubi: ASAP1)
<ol><li>מגדל את הדגים מוזרק (F0 הדור) לבגרות כמתואר קודם לכן הספר של דג זברה20. זה בדרך כלל לוקח כ 4 חודשים.</li>
	<li>קח יחיד של מבוגרים F0 דגים, לחצות אותו יחיד מול מין wildtype דגים. לאסוף דגים העוברים לאחר הרבייה בהמשך היום. שמור העוברים דגים שנאספו בחממה 28.5 ° C דגים מים עם 0.1% מתילן כחול.</li>
	<li>ביום השלישי, לבדוק את העוברים דגים מתחת למיקרוסקופ לנתיחה פלורסנט עם מסנן ה-GFP. למיין את עוברי דגים ירוק, אם יש כאלה, ולגדל אותם לבגרות כמו F1 ייצור הטרנסגניים דג, Tg (ubi: ASAP1). הערה: יחס Mendelian לא צפויה שכן רוב הדגים0 F הורים כימרות גנטית בחיידקים-קו.</li>
	<li>צלב למבוגרים-דג יחיד של F1 , עם דגים wildtype ולאסוף עוברי דגים. למיין את עוברי דגים ירוק ולגדל אותם לבגרות כמו דג דור2 F. הערה: עוברי דגים-ירוק וירוק צריך להיות קרוב ל- 1:1 אם יש transgene יחיד.</li>
	<li>כדי להציג שינויים פוטנציאל חשמלי בגידול כמו גידולים ממאירים במערכת העצבים ההיקפית נדן (MPNST), לחצות את הדור2 F Tg (ubi: ASAP1) דגים עם rpl35hi258/wt דגים. זה ידוע כי גלוי גידולים להתחיל למצוא בן 6-8 חודש מבוגרים21,22.</li>
</ol>5. הדמיה
<ol><li>תמונת דג זברה עוברי, לקחת מספר F2 הדור המייסד דגים, חוצים אותם עם דגים wildtype בזוגות בודדים. לאסוף דגים עוברי בשלבים התפתחותיים שונים הרצוי בהתאם דג זברה היערכות מדריך23.</li>
	<li>בשלבים המוקדמים של עוברי דגים, לקלף, להסיר chorions של העוברים בזהירות באמצעות זוג מלקחיים תחת טווח לנתיחה ב 10-ס מ קוטר צלחת פטרי עם דגים מערכת מים.</li>
	<li>העברת כמה עוברי דגים על זכוכית והקעורות עם 3% methylcellulose באמצעות פיפטה העברה חד פעמיות של 3.4 מ. התאם את העוברים למיקום הרצוי כדי להציג את הפעילות GFP הסלולר באמצעות מחט מתחת טווח לנתיחה פלורסנט.</li>
	<li>לשלבים נע של עוברי דגים (שגילן עולה על הבמה somite 12), להשתמש מסילייט tricaine 0.05% כדי עזים ומתנגד העוברים דגים לפני העברת שקופיות. בקצרה, עוברי דגים היו צמחו לתוך מסילייט tricaine 0.05% במים דגים עד שהפסיקו שחייה ואיזון הגוף אובדן. בנוסף, להוסיף טיפה של 0.05% מסילייט tricaine עם methylcellulose בשקופית.</li>
	<li>עבור פחות מ-12 somite שלב עוברי דגים, להשתמש במיקרוסקופ מתחם epi-זריחה עם המצלמה תואם, תוכנה עבור הדמיה. שגילן עולה על 12 somite הבמה דגים עוברי, להשתמש במיקרוסקופ לנתיחה קרינה פלואורסצנטית.</li>
	<li>תמונה מתח התא הגידול, תחילה לזהות את הדג עם גידולים MPNST. לאחר מכן, עזים ומתנגד הדג עם מסילייט tricaine 0.05%. עבור הדמיה הר שלמה, מכניסים את הדגים 10-ס מ קוטר צלחת פטרי. כדי להציג את הפעילות החשמלית של תאי הגידול, ייתכן ניסויים דגים גידולים החוצה לאחר כל הר הדמיה.</li>
</ol>

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

המחברים אין לחשוף.

למרות הפעילות חשמל רמת הסלולר ורקמות במהלך התפתחות מחלות אנושיות התגלו לפני זמן רב, אין ויוו חשמל השינויים הדינמיים ותפקידיהם ביולוגי נותרו עדיין אינו מודע לקיומם. אחד האתגרים הגדולים הוא להמחיש ולכמת את השינויים חשמל. תיקון קלאמפ טכנולוגיה פריצת דרך עבור מעקב אחר תאים בודדים, אך את ...

ביו מתייחס אנדוגני איתות חשמלי מתווך על ידי תעלות יונים ומשאבות ממוקם על קרום התא1. חילופי יוניים על פני הממברנה התאית, והשינויים בשילוב חשמל פוטנציאלית ועדכניים, חיוניים עבור איתות תהליכים של טמפרמנט תאים עצביים ושרירי. בנוסף, ביו ומעברי יון יש מגוון רחב של תפקודים ביולוגיים חשובים אחרים כולל אחסון אנרגיה, ביוסינטזה של המטבוליט תחבורה. איתות הביו-חשמליות התגלה גם כרגולטור של היווצרות תבנית עובריים, כגון צירים הגוף, מחזור התא, תא בידול1. לפיכך, חיוני להבנת מחלות מולדות אנושיים רבים הנובעים התקנה שגויה של סוג זה של איתות. למרות מלחציים תיקון כבר בשימוש נרחב עבור הקלטה תאים בודדים, הוא עדיין רחוק מלהיות אידיאלי בו זמנית פיקוח על תאים מרובים במהלך התפתחות עובריים בתוך vivo. יתר על כן, מולקולות קטנות רגיש מתח אינם גם אידיאלי עבור יישומים ויוו שלהם specificities, רגישויות וכתוצאה רעילות.
היצירה של מגוון רחב של גנטית מקודד מתח פלורסנט אינדיקטורים (GEVIs) מציע מנגנון חדש כדי להתגבר על בעיה זו, והיא מאפשרת יישום קל ללמוד התפתחות עובריים, למרות שהם נועדו במקור עבור ניטור עצבית תאים2,3. אחד GEVIs זמין כעת הוא האצת חיישן של פוטנציאל פעולה 1 (ASAP1)4. הוא מורכב ללולאה חוץ-תאי של תחום חישה מתח של מתח פוספטאז רגיש, חלבון פלואורסצנטי ירוק permuted באופן מעגלי. לכן, ASAP1 מאפשר הדמיה של שינויים סלולריים פוטנציאל חשמלי (קיטוב: ירוק בהיר; דפולריזציה: ירוק כהה). ASAP1 יש 2 מילי-שניות על לסירוגין קינטיקה, ולא ניתן לעקוב אחר שינוי פוטנציאליים subthreshold4. לכן, כלי גנטי זה מאפשר רמה חדשה של יעילות ניטור בזמן אמת הקינטיות בתאים חיים. הבנה נוספת של התפקידים של ביו בתחום הפיתוח עובריים למחלות רבות, כגון סרטן, שופכים אור חדש על המנגנון הבסיסי, אשר הוא קריטי עבור מחלת טיפול ומניעה.
דג זברה הוכחו במודל בעלי חיים רב עוצמה ללמוד ביולוגיה התפתחותית ו האדם מחלות כולל סרטן5,6. הם חולקים גנים orthologous 70% עם בני אדם, ויש להם ביולוגיה חוליות דומות7. דג זברה מספקים טיפול קל יחסית, בגודל גדול מצמד של ביצים, גנטיקה צייתן, transgenesis קל ופיתוח שקופים חיצוני עובריים, ההופכים אותם מערכת מעולה עבור ויוו הדמיה5,6. עם מקור גדול של דגים מוטנטים קווים כבר נוכח, גנום מלא ברצף, דג זברה תספק מגוון מוגבל יחסית של תגלית מדעית.
כדי לחקור את ויוו בזמן אמת הפעילות החשמלית של תאים, עלינו לנצל של דג זברה מודל המערכת ASAP1. בנייר זה, אנו מתארים כיצד לשלב את החיישן מתח פלורסנט ASAP1 הגנום דג זברה באמצעות Tol2 transposon transgenesis, ותנסו לדמיין את הפעילות החשמלית הסלולר במהלך התפתחות, תנועה זחל דגים, ובבתי גידול בשידור חי .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

ביו, איתות חשמלי אנדוגני מתווך על ידי תעלות יונים, משאבות ממוקם על קרום התא, משחק תפקידים חשובים באיתות תהליכים של תאים עצביים ושרירי טמפרמנט של תהליכים ביולוגיים רבים אחרים, כגון עובריים המתבנת התפתחותית. עם זאת, יש צורך ויוו פעילות חשמלית מהפיקוח מופרה חוליות. ההתקדמות של מקודדים גנטית פלורסנט מחוני מתח (GEVIs) הפכו אותה ניתן לספק פתרון עבור האתגר הזה. כאן, אנו נתאר כיצד ליצור דג מחוון הטרנסגניים מתח באמצעות מחוון ויצר מתח, ASAP1 (האצת חיישן של פוטנציאל פעולה 1), כדוגמה. ערכת Tol2, מקדם דג זברה בכל מקום, ubi, נבחרו במחקר זה. נסביר גם את התהליכים של שיבוט בייעודי לאתר שער Tol2 דג זברה מבוסס-transposon transgenesis, את תהליך ההדמיה בשלב מוקדם דגים עוברי ודגים גידולים באמצעות מיקרוסקופ פלורסנטי רגיל. באמצעות קו דגים, מצאנו כי ישנם שינויים מתח חשמלי הסלולר במהלך דג זברה מופרה והתנועה זחל דגים. יתר על כן, זה היה ציין כי כמה דג זברה ממאיר במערכת העצבים ההיקפית נדן גידולים, הגידול התאים היו בדרך כלל מקוטב בהשוואה ל נורמלי הרקמות הסובבות.

בזריקה מוצלחת, יותר מ 50% מוזרק דגים עוברי יציג מידה מסוימת של זריחה ירוק בתאים סומטיים ולא רובם יהיה חיובי על-ידי Tol2 transposon בלו assay (איור 2). אחרי 2-4 דורות של יותר לחצות עם דגים wildtype (עד הדג פלורסנט מגיעים 50%, היחס Mendelian הצפוי), הדג הטרנסגניים שימשו הניסוי הדמיה כ?...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

ויזואליזציה של הפעילות החשמלית הסלולר עוברי מוקדם דג זברה, גידולים

כאן, אנו מראים את התהליך של יצירת קו דג זברה כתב מתח חשמלי הסלולר להמחיש את התפתחות, תנועה, דגים גידול תאים ויוו.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

8.7K Views.  Purdue University. כאן, אנו מראים את התהליך של יצירת קו דג זברה כתב מתח חשמלי הסלולר להמחיש את התפתחות, תנועה, דגים גידול תאים ויוו.

Video: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological systems. In FDAP experiments, the clearance of proteins within living organisms can be measured. A protein of interest is tagged with a photoconvertible fluorescent protein, expressed in vivo and photoconverted, and the decrease in the photoconverted signal over time is monitored. The data is then fitted with an appropriate clearance model to determine the protein half-life. Importantly, the clearance kinetics of protein populations in different compartments of the organism can be examined separately by applying compartmental masks. This approach has been used to determine the intra- and extracellular half-lives of secreted signaling proteins during zebrafish development. Here, we describe a protocol for FDAP experiments in zebrafish embryos. It should be possible to use FDAP to determine the clearance kinetics of any taggable protein in any optically accessible organism.

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Protein levels in cells and tissues are often tightly regulated by the balance of protein production and clearance. Using Fluorescence Decay After Photoconversion (FDAP), the clearance kinetics of proteins can be experimentally measured in vivo.

מדידת יציבות חלבון בחיים עוברי דג הזברה שימוש הקרינה רדיואקטיבית לאחר photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Mechanical Vessel Injury in Zebrafish Embryos

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes. External development and optical transparency make these embryos especially amenable to microscopy, and numerous transgenic lines that label specific cell types with fluorescent proteins are available, making the zebrafish embryo an ideal system for visualizing the interaction of vascular, hematopoietic, and other cell types during injury and repair in vivo. Forward and reverse genetics in zebrafish are well developed, and pharmacological manipulation is possible. We describe a mechanical vascular injury model using micromanipulation techniques that exploits several of these features to study responses to vascular injury including hemostasis and blood vessel repair. Using a combination of video and timelapse microscopy, we demonstrate that this method of vascular injury results in measurable and reproducible responses during hemostasis and wound repair. This method provides a system for studying vascular injury and repair in detail in a whole animal model.

This article describes a method for creating a mechanical vessel injury in zebrafish embryos. This injury model provides a platform for studying hemostasis, injury-related inflammation, and wound healing in an organism ideally suited for real-time microscopy.

פגיעה כלי מכאנית בעוברי דג הזברה

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo development due to their similar developmental process. Although genetic factors are known to affect early embryonic development, the discovery of such factors has been a serious challenge. Microarray technology allows quantitative measurement and gene expression profiling of transcript levels on a genome-wide basis. One of the main decisions that have to be made when planning a microarray experiment is whether to use a one- or two-color approach. Two-color design increases technical replication, minimizes variability, improves sensitivity and accuracy as well as allows having loop designs, defining the common reference samples. Although microarray is a powerful biological tool, there are potential pitfalls that can attenuate its power. Hence, in this technical paper we demonstrate an optimized protocol for RNA extraction, amplification, labeling, hybridization of the labeled amplified RNA to the array, array scanning and data analysis using the two-color analysis strategy.

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Microarray technology allows quantitative measurement and gene expression profiling of transcripts on a genome-wide basis. Therefore, this protocol provides an optimized technical procedure in a two-color custom made bovine array using Day 7 bovine embryos to demonstrate the feasibility of using low amount of total RNA.

Transcriptome Profiling של<em&gt; In-Vivo</em&gt; עוברי אדם שור הופק באמצעות פלטפורמת microarray שני צבעים

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

בידוד ואפיון של תאים בודדים מעוברים דג הזברה

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

Biosensing מוטורית נוירון פוטנציאל ממברנה עוברי דג הזברה חיים

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

אינדוקציה של היפוקסיה צפרדע חיה דג הזברה עוברי

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to numerous cell types throughout the body. Understanding the biology of the neural crest has been limited, reflecting a lack of genetically tractable models that can be studied in vivo and in real-time. Zebrafish is a particularly important developmental model for studying migratory cell populations, such as the neural crest. To examine neural crest migration into the developing eye, a combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time videos of the developing eye in transgenic zebrafish embryos, namely Tg(sox10:EGFP) and Tg(foxd3:GFP), as sox10 and foxd3 have been shown in numerous animal models to regulate early neural crest differentiation and likely represent markers for neural crest cells. Multi-photon time-lapse imaging was used to discern the behavior and migratory patterns of two neural crest cell populations contributing to early eye development. This protocol provides information for generating time-lapse videos during zebrafish neural crest migration, as an example, and can be further applied to visualize the early development of many structures in the zebrafish and other model organisms.

A combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time imaging of neural crest migration in Tg(sox10:EGFP) and Tg(foxd3:GFP) zebrafish embryos.

פוטון רב זמן לשגות הדמיה כדי להמחיש את התפתחות בזמן אמת: ויזואליזציה של העברת תאי הרכס העצבי עוברי דג זברה

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

להמחיש את צומת ואת צלחת Notochordal Gastrulating עוברי העכבר באמצעות מיקרוסקופ אלקטרונים סריקה כל הר Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. Although many immunohistochemistry protocols have been optimized for mammalian tissue and tissue sections, these protocols often require modification and optimization for non-mammalian model organisms. Zebrafish are increasingly used as a model system in basic, biomedical, and translational research to investigate the molecular, genetic, and cell biological mechanisms of developmental processes. Zebrafish offer many advantages as a model system but also require modified techniques for optimal protein detection. Here, we provide our protocol for whole-mount fluorescence immunohistochemistry in zebrafish embryos and larvae. This protocol additionally describes several different mounting strategies that can be employed and an overview of the advantages and disadvantages each strategy provides. We also describe modifications to this protocol to allow detection of chromogenic substrates in whole mount tissue and fluorescence detection in sectioned larval tissue. This protocol is broadly applicable to the study of many developmental stages and embryonic structures.

Here, we present a protocol for fluorescent antibody-mediated detection of proteins in whole preparations of zebrafish embryos and larvae.

כל הר אימונוהיסטוכימיה בזיבפיש עוברים וזחלים

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

הכנת ספריות RNA קטנות לצורך רצף של עוברי עכבר מוקדם

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...