이 작품의 자금에서 제공 됩니다 일부 권한을 부여 하 여 NSF 식물 게놈 연구 (IOS-1127155).

참고: 그림 1 배열 CGH 프로토콜에 대 한 5 단계를 보여 줍니다. 그들은: 1); 식물 재료의 준비 2) 격리의 고품질 DNA 샘플; 3) 레이블 및 정화의 DNA 샘플; 4) 교 잡, 세척, 그리고 검색의 전체 게놈 배열; 그리고 5) CGH 데이터 분석. M. truncatula 전체 게놈 타일링 어레이 50000 개 이상의 유전자 나 게놈 (참조 자료의 테이블)에 유전자 모델을 대상으로 하는 971,041 독특한 올리고 프로브의 총 포함 되어 있습니다. 고유의 프로브 간격 약 모든 150의 기본적인 쌍 (bp) exonic 지역 및 261에 M. truncatula 게놈의 intronic 지역에서 bp.
 1. 식물 재료의 준비 <ol><li>Scarify 야생 타입 (WT; M. truncatula cv Jemalong A17)와 8 분에 대 한 집중된 한 황산을 가진 FN6191 돌연변이 씨앗 (재료의 표 참조). 제거 하 고 액체 폐기물 컨테이너에 황산 삭제.</li>
	<li>린스 씨앗 압력가 이온을 제거 된 물으로 세 번.</li>
	<li>표면 소독 씨앗 10 분에 대 한 20% 표 백제 솔루션</li>
	<li>린스 씨앗 압력가 이온을 제거 된 물으로 세 번.</li>
	<li>3 일 동안 4 ° C에 저장 씨앗. Vernalization, 후 전송 및 성장 챔버와 16/8 h에에서 1 주일 명암 주기 및 150 µE/m 2 /s 빛 강도 대 한 토양에 씨앗을 발 아.</li>
	<li>1 갤런 냄비에 묘 종을 이식 하 고 16 h/8 h 명암 주기, 3 ~ 4 주에 대 한 150 µE/m 2 /s 빛 강도 가진 온실에서 성장. DNA 분리에 대 한 식물에서 젊은 잎 샘플을 수집.</li>
</ol> 2. 높은 품질 DNA 샘플의 절연 <ol><li>단일 공장에서 젊은 잎 조직 1 g 하 고 액체 질소에 즉시 동결.</li>
	<li>박격포와 유 봉 미세 분말을 액체 질소에서 냉동된 잎 조직이 갈기.</li>
	<li>DNA 분리와 게놈 DNA 분리 키트 (재료의 표 참조).</li>
	<li>Resuspend 정화 DNA 샘플 압력가 이중 이온된 H 2 O의 50 µ L (ddH 2 O) 또는 TE 버퍼 (10 mM Tris HCl, 1 mM EDTA, pH 7.0) x 1.</li>
	<li>측정 DNA 농도 분 광 광도 계와 (재료의 표 참조).</li>
	<li>평가 260 nm/280 nm와 DNA 샘플의 260 nm/230 nm 비율. 
	참고: 고품질 DNA 샘플 260 nm/280 nm 비율 있어야 &#8805; 1.8와 260 nm/230 nm 비율 &#8805; 2.0.</li>
	<li>추가 agarose 젤 1%에서 그들을 실행 하 여 DNA 샘플 평가. 
	참고: 고품질 DNA 샘플 높은 분자 무게 있고 RNA에 의해 오염 되지 해야 합니다. 이상적으로, DNA 샘플의 최종 농도 ~ 150 ng / µ L 되어야 합니다.</li>
</ol> 3. DNA 라벨 및 정화 <ol><li>ddH 2 O 500 µ L 원심 분리기 튜브에서 20 µ L의 최종 볼륨을 희석 1 µ g의 genomic DNA 샘플.</li>
	<li>임의의 뇌관의 추가 5 µ L (재료의 표 참조) 관.</li>
	<li>소용돌이 짧게 튜브로 품 어 10 분에 98 ° C에서 DNA를 변성 하 thermocycler</li>
	<li>thermocycler에서 튜브를가지고 고 5 분에 대 한 진정 얼음 물에 바로 넣어</li>
	<li>표 1과 같이 믹스 준비 2 라벨.</li>
	<li>믹스 1과 2 참조 DNA와 DNA 샘플에 라벨의 추가 25 µ L 튜브, 각각.</li>
	<li>세 번 pipetting으로 라벨 믹스와 DNA를 혼합 하 고 튜브를 짧게 회전.</li>
	<li>그리고 20 분 엑 소 Klenow 효소 비활성화 65 ° C에서 37 ° C 2 h에서 품 어 하 thermocycler로 튜브를 넣어 (재료의 표 참조).</li>
	<li>테 버퍼 각 튜브를 x 1의 추가 430 µ L.</li>
	<li>내용을 혼합 하 고 튜브를 짧게 회전.</li>
	<li>전송 솔루션 2 mL 컬렉션 정화 열에 관에서 관 (재료의 표 참조).</li>
	<li>분리기 14000 x g 10 분에 대 한 정화 열</li>
	<li>솔루션을 통해 패스 삭제.</li>
	<li>추가 480 x 각 열으로 TE 버퍼 1 µ L.</li>
	<li>분리기 14000 x g 10 분에 다시 열</li>
	<li>통과 솔루션 삭제.</li>
	<li>새 원심 분리기 튜브에 열에의 하단 부분에 남아 있는 레이블이 DNA 샘플을 전송.</li>
	<li>는 피 펫을 사용 하 여 레이블이 지정 된 DNA 샘플의 볼륨을 측정 하 고 x TE 버퍼 1 80 µ L를 최종 볼륨을가지고.</li>
	<li>는 분 광 광도 계를 사용 하 여 레이블이 DNA 샘플의 농도 측정 (재료의 표 참조).</li>
	<li>레이블된 샘플 DNA의 동일한 금액을 혼합 하 고 DNA를 참조 테 버퍼 x 1와 160 µ L를 최종 볼륨을가지고.</li>
	<li>교 잡 버퍼, 인간 침대 1 DNA의 50 µ L 10 × aCGH 차단 에이전트의 50 µ L x 2 µ L 추가 256 (재료의 표 참조) 3 번 pipetting으로 잘 섞는다.</li>
	<li>짧게 튜브를 회전 하 고 10 분에 98 ° C에 품 어 하 thermocycler에 넣어</li>
	<li>20 분 동안 37 ° C에서 튜브를 품 어</li>
</ol> 4. 교 잡, 세척, 그리고 게놈 배열의 검색 <ol><li>미리 따뜻한 교 잡 시작 하기 전에 67 ° C 이상 4 h 교 잡 오븐.</li>
	<li>교 잡 챔버의 기지에 가스 켓 슬라이드 배치.</li>
	<li>가스 켓 슬라이드에 단계 3.23에서 교 잡 솔루션의 부하 490 µ L.</li>
	<li>개자리속 truncatula 게놈 microarray 칩 교 잡 챔버를 가스 켓 슬라이드 커버.</li>
	<li>교 잡 챔버 커버에 넣고 클램프와 챔버를 단단히 조입니다.</li>
	<li>조립된 교 잡 실 교 잡 오븐에 넣고 40-48 h. 67 ° C에서 품 어</li>
	<li>설거지 준비 3 슬라이드: 나 실 온에서 보관 하는 두 버퍼를 세척 하는 250 mL와 버퍼 II 세척 한 37에서 보관 ° c.</li>
	<li>항아리 세척 준비 2 슬라이드: 70 mL 이기와 70 mL 안정화와 건조 솔루션 하나, 모두 유지 실내 온도에서 증기 두건에서 (재료의 표 참조).</li>
	<li>교 잡 챔버 오븐에서 제거 하 고 챔버 클램프 및 덮개 제거.</li>
	<li>Microarray 칩 및 가스 켓 나 워시 버퍼와 슬라이드 세척 접시를 슬라이드와 커버 슬라이드에서 칩을 분리 이동.</li>
	<li>두 번째 슬라이드 세척 하는 microarray 칩 이동 나 워시 버퍼와 접시와 부드럽게 순환 5 분에 대 한 실 온에서 자기 저 어 접시에 볶음 바 솔루션</li>
	<li>전송에 microarray 칩을 미리 데워 세척 버퍼 II와 접시 세척 세 번째 슬라이드 1 분 37 ° C에서 자기 저 어 접시에 볶음 bar로 부드럽게 씻어</li>
	<li>Microarray 칩 세척 증기 두건에서 이기와 단지 슬라이드를 전송과 30 씻고 s.</li>
	<li>Microarray 칩 슬라이드 안정화와 함께 항아리를 세척 하 고 건조 솔루션에 전송 하 고 30 씻어 s.</li>
	<li>칩 밖으로 천천히 하 고 1 분에 대 한 그것을 건조합니다</li>
	<li>검색 microarray 칩 스캐너를 사용 하 여 참조 테이블의 자료 2 µ m 해상도. 여러 개의 이미지를 저장 하 고 전체 검사를 슬라이드에 대 한 매개 변수를 설정 합니다. 채널 1과 2 이익 100% 설정 하 고 자동 이득 취소.</li>
</ol> 5. CGH 데이터 분석 <ol><li>추출 Cy3와 Cy5 형광 검색 소프트웨어를 사용 하 여 배열에서 각 프로브에 대 한 농도 (재료의 표 참조).</li>
	<li>세분화 분석 샘플 DNA 사이의 참조 DNA 복사 번호 유사 (CNVs)를 감지 하는 소프트웨어의 사용. CNVs를 결정 하기 위한 세그먼트 의미 로그 2 샘플/참조 비율 ± 2.5 표준 편차의 임계값을 사용 하 여.</li>
	<li>신호 매핑 소프트웨어를 사용 하 여 전체 게놈에서 로그 2 샘플/참조 비율의 분포를 검사 (재료의 표 참조).</li>
</ol>

<ol>
	<li>Tang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+genome+release+(version+Mt4.0)+for+the+model+legume+Medicago+truncatula.">An improved genome release (version Mt4.0) for the model legume Medicago truncatula.</a> BMC Genomics. 15, 312 (2014).</li><li>Young, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Medicago+genome+provides+insight+into+the+evolution+of+rhizobial+symbioses.">The Medicago genome provides insight into the evolution of rhizobial symbioses.</a> Nature. 480 (7378), 520-524 (2011).</li><li>Wang, H., Li, G., Chen, R., da Silva, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+neutron+bombardment+(FNB)+induced+deletion+mutagenesis+for+forward+and+reverse+genetic+studies+in+plants.">Fast neutron bombardment (FNB) induced deletion mutagenesis for forward and reverse genetic studies in plants.</a> Floriculture, Ornamental and Plant Biotechnology: Advances and Topical Issues. , 629-639 (2006).</li><li>Rogers, C., Wen, J., Chen, R., Oldroyd, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deletion-based+reverse+genetics+in+Medicago+truncatula.">Deletion-based reverse genetics in Medicago truncatula.</a> Plant Physiol. 151 (3), 1077-1086 (2009).</li><li>Alonso, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Five+components+of+the+ethylene-response+pathway+identified+in+a+screen+for+weak+ethylene-insensitive+mutants+in+Arabidopsis.">Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis.</a> Proc Natl Acad Sci U S A. 100 (5), 2992-2997 (2003).</li><li>Silverstone, A. L., Ciampaglio, C. N., Sun, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Arabidopsis+RGA+gene+encodes+a+transcriptional+regulator+repressing+the+gibberellin+signal+transduction+pathway.">The Arabidopsis RGA gene encodes a transcriptional regulator repressing the gibberellin signal transduction pathway.</a> Plant Cell. 10 (2), 155-169 (1998).</li><li>Li, X., Lassner, M., Zhang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deleteagene:+a+fast+neutron+deletion+mutagenesis-based+gene+knockout+system+for+plants.">Deleteagene: a fast neutron deletion mutagenesis-based gene knockout system for plants.</a> Comp Funct Genomics. 3 (2), 158-160 (2002).</li><li>Bolon, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phenotypic+and+genomic+analyses+of+a+fast+neutron+mutant+population+resource+in+soybean.">Phenotypic and genomic analyses of a fast neutron mutant population resource in soybean.</a> Plant Physiol. 156 (1), 240-253 (2011).</li><li>Men, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+Neutron+Mutagenesis+of+Soybean+(Glycine+soja+L.)+Produces+a+Supernodulating+Mutant+Containing+a+Large+Deletion+in+Linkage+Group+H.">Fast Neutron Mutagenesis of Soybean (Glycine soja L.) Produces a Supernodulating Mutant Containing a Large Deletion in Linkage Group H.</a> Genome Letters. 1 (3), 147-155 (2002).</li><li>Hoffmann, D., Jiang, Q., Men, A., Kinkema, M., Gresshoff, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nodulation+deficiency+caused+by+fast+neutron+mutagenesis+of+the+model+legume+Lotus+japonicus.">Nodulation deficiency caused by fast neutron mutagenesis of the model legume Lotus japonicus.</a> J Plant Physiol. 164 (4), 460-469 (2007).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fast+neutron+deletion+mutagenesis-based+reverse+genetics+system+for+plants.">A fast neutron deletion mutagenesis-based reverse genetics system for plants.</a> Plant J. 27 (3), 235-242 (2001).</li><li>Bourcy, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Medicago+truncatula+DNF2+is+a+PI-PLC-XD-containing+protein+required+for+bacteroid+persistence+and+prevention+of+nodule+early+senescence+and+defense-like+reactions.">Medicago truncatula DNF2 is a PI-PLC-XD-containing protein required for bacteroid persistence and prevention of nodule early senescence and defense-like reactions.</a> New phytol. 197 (4), 1250-1261 (2013).</li><li>Chen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+dissected+leaf+morphology+by+a+Cys(2)His(2)+zinc+finger+transcription+factor+in+the+model+legume+Medicago+truncatula.">Control of dissected leaf morphology by a Cys(2)His(2) zinc finger transcription factor in the model legume Medicago truncatula.</a> Proc Natl Acad Sci U S A. 107 (23), 10754-10759 (2010).</li><li>Ge, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increasing+seed+size+and+quality+by+manipulating+BIG+SEEDS1+in+legume+species.">Increasing seed size and quality by manipulating BIG SEEDS1 in legume species.</a> Proc Natl Acad Sci U S A. 113 (44), 12414-12419 (2016).</li><li>Kalo, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nodulation+signaling+in+legumes+requires+NSP2,+a+member+of+the+GRAS+family+of+transcriptional+regulators.">Nodulation signaling in legumes requires NSP2, a member of the GRAS family of transcriptional regulators.</a> Science. 308 (5729), 1786-1789 (2005).</li><li>Oldroyd, G. E., Long, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+nodulation-signaling+pathway+2,+a+gene+of+Medicago+truncatula+involved+in+Nod+actor+signaling.">Identification and characterization of nodulation-signaling pathway 2, a gene of Medicago truncatula involved in Nod actor signaling.</a> Plant Physiol. 131 (3), 1027-1032 (2003).</li><li>Peng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+compound+leaf+development+in+Medicago+truncatula+by+fused+compound+leaf1,+a+class+M+KNOX+gene.">Regulation of compound leaf development in Medicago truncatula by fused compound leaf1, a class M KNOX gene.</a> Plant Cell. 23 (11), 3929-3943 (2011).</li><li>Tsujimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+TOBAMOVIRUS+MULTIPLICATION+(TOM)+2+locus+encodes+a+transmembrane+protein+that+interacts+with+TOM1.">Arabidopsis TOBAMOVIRUS MULTIPLICATION (TOM) 2 locus encodes a transmembrane protein that interacts with TOM1.</a> EMBO J. 22 (2), 335-343 (2003).</li><li>Wang, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nodule-specific+protein+secretory+pathway+required+for+nitrogen-fixing+symbiosis.">A nodule-specific protein secretory pathway required for nitrogen-fixing symbiosis.</a> Science. 327 (5969), 1126-1129 (2010).</li><li>Bejjani, B. A., Shaffer, L. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+array-based+comparative+genomic+hybridization+to+clinical+diagnostics.">Application of array-based comparative genomic hybridization to clinical diagnostics.</a> J Mol Diagn. 8 (5), 528-533 (2006).</li><li>Emerson, J. J., Cardoso-Moreira, M., Borevitz, J. O., Long, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+selection+shapes+genome-wide+patterns+of+copy-number+polymorphism+in+Drosophila+melanogaster.">Natural selection shapes genome-wide patterns of copy-number polymorphism in Drosophila melanogaster.</a> Science. 320 (5883), 1629-1631 (2008).</li><li>Gong, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microarray-based+rapid+cloning+of+an+ion+accumulation+deletion+mutant+in+Arabidopsis+thaliana.">Microarray-based rapid cloning of an ion accumulation deletion mutant in Arabidopsis thaliana.</a> Proc Natl Acad Sci U S A. 101 (43), 15404-15409 (2004).</li><li>Guryev, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+and+functional+impact+of+DNA+copy+number+variation+in+the+rat.">Distribution and functional impact of DNA copy number variation in the rat.</a> Nat Genet. 40 (5), 538-545 (2008).</li><li>Haun, W. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+composition+and+origins+of+genomic+variation+among+individuals+of+the+soybean+reference+cultivar+Williams+82.">The composition and origins of genomic variation among individuals of the soybean reference cultivar Williams 82.</a> Plant Physiol. 155 (2), 645-655 (2011).</li><li>Infante, J. J., Dombek, K. M., Rebordinos, L., Cantoral, J. M., Young, E. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+amplifications+caused+by+chromosomal+rearrangements+play+a+major+role+in+the+adaptive+evolution+of+natural+yeast.">Genome-wide amplifications caused by chromosomal rearrangements play a major role in the adaptive evolution of natural yeast.</a> Genetics. 165 (4), 1745-1759 (2003).</li><li>Jones, M. R., Maydan, J. S., Flibotte, S., Moerman, D. G., Baillie, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oligonucleotide+Array+Comparative+Genomic+Hybridization+(oaCGH)+based+characterization+of+genetic+deficiencies+as+an+aid+to+gene+mapping+in+Caenorhabditis+elegans.">Oligonucleotide Array Comparative Genomic Hybridization (oaCGH) based characterization of genetic deficiencies as an aid to gene mapping in Caenorhabditis elegans.</a> BMC Genomics. 8, 402 (2007).</li><li>Lakshmi, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+genomic+representational+oligonucleotide+microarray+analysis:+detection+of+copy+number+variations+in+normal+and+tumor+specimens.">Mouse genomic representational oligonucleotide microarray analysis: detection of copy number variations in normal and tumor specimens.</a> Proc Natl Acad Sci U S A. 103 (30), 11234-11239 (2006).</li><li>Mitra, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Ca2+/calmodulin-dependent+protein+kinase+required+for+symbiotic+nodule+development:+Gene+identification+by+transcript-based+cloning.">A Ca2+/calmodulin-dependent protein kinase required for symbiotic nodule development: Gene identification by transcript-based cloning.</a> Proc Natl Acad Sci U S A. 101 (13), 4701-4705 (2004).</li><li>Rios, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+hemizygous+deletions+in+citrus+using+array-comparative+genomic+hybridization+and+microsynteny+comparisons+with+the+poplar+genome.">Characterization of hemizygous deletions in citrus using array-comparative genomic hybridization and microsynteny comparisons with the poplar genome.</a> BMC Genomics. 9, 381 (2008).</li><li>Skvortsov, D., Abdueva, D., Stitzer, M. E., Finkel, S. E., Tavare, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+expression+arrays+for+copy+number+detection:+an+example+from+E.+coli.">Using expression arrays for copy number detection: an example from E. coli.</a> BMC Bioinformatics. 8, 203 (2007).</li><li>Werner, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+trait+locus+mapping+and+DNA+array+hybridization+identify+an+FLM+deletion+as+a+cause+for+natural+flowering-time+variation.">Quantitative trait locus mapping and DNA array hybridization identify an FLM deletion as a cause for natural flowering-time variation.</a> Proc Natl Acad Sci U S A. 102 (7), 2460-2465 (2005).</li><li>Xi, J., Chen, Y., Nakashima, J., Wang, S. M., Chen, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Medicago+truncatula+esn1+defines+a+genetic+locus+involved+in+nodule+senescence+and+symbiotic+nitrogen+fixation.">Medicago truncatula esn1 defines a genetic locus involved in nodule senescence and symbiotic nitrogen fixation.</a> Mol Plant Microbe Interact. 26 (8), 893-902 (2013).</li><li>Schnabel, E., Journet, E. P., de Carvalho-Niebel, F., Duc, G., Frugoli, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Medicago+truncatula+SUNN+gene+encodes+a+CLV1-like+leucine-rich+repeat+receptor+kinase+that+regulates+nodule+number+and+root+length.">The Medicago truncatula SUNN gene encodes a CLV1-like leucine-rich repeat receptor kinase that regulates nodule number and root length.</a> Plant Mol Biol. 58 (6), 809-822 (2005).</li><li>Horvath, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+the+nodule-specific+cysteine+rich+peptide,+NCR169,+abolishes+symbiotic+nitrogen+fixation+in+the+Medicago+truncatula+dnf7+mutant.">Loss of the nodule-specific cysteine rich peptide, NCR169, abolishes symbiotic nitrogen fixation in the Medicago truncatula dnf7 mutant.</a> Proc Natl Acad Sci U S A. 112 (49), 15232-15237 (2015).</li><li>Kim, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+antimicrobial+peptide+essential+for+bacterial+survival+in+the+nitrogen-fixing+symbiosis.">An antimicrobial peptide essential for bacterial survival in the nitrogen-fixing symbiosis.</a> Proc Natl Acad Sci U S A. 112 (49), 15238-15243 (2015).</li><li>. Medicago truncatula Mutant Database Available from: <a target="_blank" href="https://medicago-mutant.noble.org/mutant/FNB.php">https://medicago-mutant.noble.org/mutant/FNB.php</a> (2017)</li><li>Burton, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SNP+genotyping+with+the+next+generation+of+CGH+microarray.">SNP genotyping with the next generation of CGH microarray.</a> MLO Med Lab Obs. 45 (7), (2013).</li></ol>

저자 아무 경쟁 금융 관심사를 선언합니다.

어레이 기반 CGH 플랫폼 검색 및 빠른 중성자 사격 (FNB)의 특성에 대 한 개발 했습니다-cv. M. truncatula Jemalong A17에에서 돌연변이 유도. 배열 CGH 메서드 유전자 돌연변이 검출에서 사용을 보여 우리는 돌연변이 FN6191 S. meliloti Sm1021와함께 접종 때 야생 유형 식물, 달리 하이퍼 nodulation 형 전시의 aCGH 분석을 수행. 세분화 분석을 위해 세그먼트 로그2 비율의 의미는 세그먼트 내의 프로브 있었다면 그 주어진된 배열 비교에 대 한 낮은 임계값 상한 임계값 보다 크거나 중요 한 간주 되었다. 각 비교에 대 한 상한값은 모든 데이터 포인트의 95 번째 백분위 수의 로그2 비율 값을 결정 했다. 각 비교에 대 한 낮은 임계값은 모든 데이터 포인트245 백분위 수의 로그2 비율 값을 결정 했다.
우리의 분석은 보여주었다 상당한 복사 번호 변경 2.5에 의해 평균 정규화 된 로그2 비율 평균 보다 더 큰 세그먼트를 검색 하 여 결정 될 수 있다 SD (중복) 2.5에 의해 평균 보다는 더 적은 또는 SD (삭제). 우리 SUNN 유전자33포괄 염색체 4, 22 kb의 예상된 크기와 삭제 지역 감지 CGH 분석을 바탕으로. 시퀀싱 결과 확인 삭제 크기 26.67 kb M. truncatula 게놈 릴리스 v 3.5를 기반으로 했다. 그것은 SUNN M. truncatula33에 결 절 수를 제어 하는 CLV1 같은 신 부유한 반복 수용 체 니 인코딩 표시 되었습니다. 우리의 CGH 결과 FN6191 새로운 SUNN 대립 유전자는 것이 좋습니다. 이러한 결과 바탕으로, 우리 권유 CGH 메서드 phenotypic 결합 및 유전자 분석 FNB 삭제 돌연변이에 후보 유전자를 빠르게 식별 하 성공적으로 사용 될 수 있습니다. 지난 몇 년 동안 우리는 식별 및 M. truncatula34,35유전자 기능 연구에 대 한 수많은 FNB 돌연변이에서이 플랫폼을 이용 했다. 우리 복사 번호 유사 (CNVs) FNB 돌연변이 라인36와 관련 된 데이터베이스를 생성 했습니다. 이 데이터베이스에서 삭제 된 시퀀스 100의 CGH 분석에서 공생 nodulation 돌연변이 M. truncatula 게놈에 매핑된 확인. 폭발 서버 돌연변이 컬렉션에서 삭제 된 시퀀스에 대 한 검색을 촉진 하기 위해 설정 되었습니다. 개발 및 삭제 데이터베이스의 확장 M. truncatula FNB 돌연변이 리소스를 사용 하 여 기능 유전체학 연구에 대 한 매우 귀중 한 것입니다.
ACGH 프로토콜은 5 가지 주요 단계가 있습니다. 모든 단계는 중요 하 고 실행 되어야 한다 신중 하 게 설명한 대로, 다음은 특히 중요 한: (1) DNA 샘플 타락 하지 해야 하 고 준비 단계; RNA에 의해 오염 되지 해야 (2) 테스트 및 참조 DNA 샘플은 레이블된 샘플 같은 고품질;의 동등 하 게 잘 준비 해야 (3) 레이블이 DNA 샘플 빛의 높은 강도 및 오존;의 높은 수준에 노출 되어서는 안됩니다. 그리고 (4) 세척 단계 동안 37 ° C에 세척 버퍼 II를 유지 하는 것이 중요 합니다.
현재 M. truncatula 게놈 배열의 범위 exonic 지역에는 적은 intronic 지역에 그리고 모든 intergenic 지역에서. 이 지역에 병 변은 돌연변이 고기에 대 한 중요 한 경우 후자의 영역에서 범위를 개선할 수 있습니다. 다른 한편으로, 현재 프로브 디자인 작은 돌연변이 단 하나 뉴클레오티드 동 질 다 상 (Snp)에 더 적은 힘이 있다. 이 제한은 CGH + SNP microarray 디자인37을 사용 하 여 극복할 수 있습니다. 전반적으로, 게놈 배열 기반 비교 genomic 교 잡 (aCGH) 플랫폼 복사 번호와 M. truncatula FNB 돌연변이 구조 변화 분석을 위한 강력한 도구입니다.

콩 (Fabaceae) 콩 (최대 글리신), 알 팔 파 (개자리속 sativa) 등 많은 경제적으로 중요 한 종 가진 꽃 식물의 3 번째로 큰 가족입니다. 콩과 식물 질소 담합 토양 박테리아, 일반적으로 Rhizobia 있는 대기 이질소 호스트 식물에 의해 사용 하기 위해 암모니아로 감소 된다 뿌리 혹을 개발 하 라는 작용할 수 있습니다. 이와 같이, 콩과 식물 작물의 재배는 질소 비료의 작은 입력 요구 하 고 따라서 지속 가능한 농업에 기여. 콩과 식물 작물 생산 나뭇잎과 씨앗 높은 단백질 콘텐츠, 우수한 사료 및 곡물 작물으로 봉사. 그러나, 재배 콩과 식물 종에는 일반적으로 복잡 한 게놈 구조, 성가신 콩과 식물-특정 프로세스에 핵심 역할을 하는 유전자의 기능 연구를 만드는 있다. 개자리속 truncatula 널리 채택 되었습니다 콩과 식물 연구에 대 한 모델 종으로 주로 하기 때문에 (1)는 상대적으로 작은 단일 게놈 크기 (550 ~ Mbp); 2 중 게놈 (2) 식물 유전자 기능 연구; 대 한 안정적으로 변형 될 수 있다 그리고 (3)은 밀접 하 게 관련 된 알 팔 파 (M. sativa로 구나), 사료의 여왕 및 변환 연구에 대 한 다른 많은 경제적으로 중요 한 작물. 최근, 게놈 시퀀스 M. truncatula cv의 Jemalong A17 발표1,2되었습니다. 게놈 주석 50000 개 이상의 예측된 유전자 나 게놈에 있는 유전자 모델을 보여 줍니다. M. truncatula 에 유전자의 대부분의 기능을 확인 하려면 게놈은 어려운 작업입니다. 유전자의 기능 연구를 촉진 하기 위해1 라인의 범위에서 돌연변이의 포괄적인 컬렉션 생성 된 빠른 중성자 사격 (FNB) mutagenesis M. truncatula 이력서에 사용 하 여 Jemalong A173 4. 빠른 중성자, 고 에너지 이온화 돌연 애기5,6, 쌀 (Oryza sativa)7, 토마토 (푸른 풀밭을 포함 하 여 많은 식물 종에 돌연변이 생성에 사용 되었습니다. lycopersicum), 콩 (글리신 soja; 최대 G.)8,9, 보 리 (Hordeum vulgare), 그리고 로터스 나무10. FNB mutagenesis에서 파생 된 변이의 큰 부분 DNA 삭제 메가 기본적인 쌍9,11몇 가지 기본적인 쌍 크기에서 범위는 한다. 많은 표현 형 관련 유전자 성공적으로 되었습니다 식별 및 특징4,12,13,,1415,16, 17 , 18 , 19. 이전, 지도 기반 접근 시간이 소모 하 고 분자 수준에서 특징을 돌연변이의 수를 제한에 의존 FNB 돌연변이에서 기본 유전자의 분자 클로닝. 최근에, 몇 가지 무료 방법을 사본 기반 메서드를 포함 하 여, 게놈 DNA 복사 번호 유사 검색, 및 전체 게놈 시퀀싱, 배열 기반 비교 genomic 교 잡 (CGH) 기와 고용 촉진 하는 동물과 식물20,21,22,23,,2425을 포함 한 다양 한 유기 체에서 삭제 돌연변이의 특성 26,,2728,29,30,31.
M. truncatula는 전체 게놈 배열 기반 비교 genomic 교 잡 (CGH)에서 FNB 돌연변이의 특성화를 촉진 하기 위하여 플랫폼 개발 되어과 검증. 동물 시스템에 보고, CGH 배열 기반 플랫폼 M. truncatula FNB 돌연변이에 전체 게놈 수준에서 복사 번호 유사 (CNVs)의 탐지를 허용 한다. 또한, 병 변 PCR에 의해 확인 될 수 있습니다 및 삭제 테두리 시퀀싱에 의해 확인 될 수 있다. 전반적으로, 배열 CGH 플랫폼 M. truncatula FNB 돌연변이에 병 변 식별에 효율적이 고 효과적인 도구입니다. 여기, 배열 CGH 절차 및 PCR 특성화 M. truncatula FNB 돌연변이에 삭제 테두리의 그림은.
다음 프로토콜 복사 번호의 전체 게놈 배열 기반 비교 genomic 교 잡 (CGH) 분석 수행에 관심이 있는 연구자에 대 한 실험 단계 및 시 약, 장비 및 분석 도구에 대 한 정보 제공 유사 식물에서. 예를 들어, 개자리속 truncatula FN6191 돌연변이 삭제 지역과 후보 유전자 돌연변이 고기와 관련 된 식별 하 사용 되었다. M. truncatula FN6191 돌연변이, 빠른 중성자 사격 유도 삭제 돌연변이 컬렉션32 에서 원래 고립 된 토양 접종 후 하이퍼 nodulation 표현 형을 전시 하는 ( 테이블의 자료참조) 박테리아, 야생 유형 식물 달리 Sihorhizobium meliloti Sm1021

<table>
	<tbody>
		<tr>
			<td>Medicago truncatula genome array, 1 x 1 M</td>
			<td>Agilent</td>
			<td>G4123A</td>
			<td></td>
		</tr>
		<tr>
			<td>Medicago truncatula FN6191 (mutant)</td>
			<td>In house</td>
			<td>FN6191</td>
			<td></td>
		</tr>
		<tr>
			<td>Medicago truncatula Jemalong A17 (reference)</td>
			<td>In house</td>
			<td>A17</td>
			<td></td>
		</tr>
		<tr>
			<td>Sulfuric acid</td>
			<td>Sigma-Aldrich</td>
			<td>320501</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Plant Mini Kit</td>
			<td>Qiagen</td>
			<td>69104</td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>1000D</td>
			<td></td>
		</tr>
		<tr>
			<td>SureTag DNA Labeling Kit</td>
			<td>Agilent</td>
			<td>5190-3400</td>
			<td></td>
		</tr>
		<tr>
			<td>Random primer</td>
			<td>Agilent</td>
			<td>5190-3399</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetonitrile</td>
			<td>Sigma-Aldrich</td>
			<td>271004-1L</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>MJ research</td>
			<td>PTC-200</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Labnet international Inc</td>
			<td>Spectrafuge 24D</td>
			<td></td>
		</tr>
		<tr>
			<td>Stabilization and Drying Solution</td>
			<td>Agilent</td>
			<td>5185-5979</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligo aCGH/ChIP-on-chip Hybridization Kit</td>
			<td>Agilent</td>
			<td>5188-5380</td>
			<td></td>
		</tr>
		<tr>
			<td>Hybridization Chamber gasket slides</td>
			<td>Agilent</td>
			<td>G2505</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Cot-1 DNA</td>
			<td>Agilent</td>
			<td>5190-3393</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligo aCGH/ChIP-on-chip Wash Buffer 1 and 2</td>
			<td>Agilent</td>
			<td>5188-5221</td>
			<td></td>
		</tr>
		<tr>
			<td>Hybridization Chamber, stainless</td>
			<td>Agilent</td>
			<td>G2534A</td>
			<td></td>
		</tr>
		<tr>
			<td>Hybridization oven</td>
			<td>Agilent</td>
			<td>G2545A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purification Columns</td>
			<td>Agilent</td>
			<td>5190-3391</td>
			<td></td>
		</tr>
		<tr>
			<td>Laser scanner</td>
			<td>Roche</td>
			<td>MS200</td>
			<td></td>
		</tr>
		<tr>
			<td>NimbleScan 2.6</td>
			<td>Roche Nimblegen</td>
			<td>5225035001</td>
			<td></td>
		</tr>
		<tr>
			<td>Signal Map 1.9</td>
			<td>Roche Nimblegen</td>
			<td>Signalmap1.9</td>
			<td></td>
		</tr>
	</tbody>
</table>

an array-based comparative genomic hybridization platform for efficient detection of copy number variations in fast neutron-induced medicago truncatula mutants

돌연변이 유전자 기능 연구에 대 한 귀중 한 유전 자원 이다. 돌연변이 컬렉션을 생성 하려면 세 가지 유형의 mutagens 활용할 수 있습니다, T DNA 또는 transposon 등 생물, 에틸 methanesulfonate (EMS), 같은 화학 또는 이온화 방사선 같은 물리를 포함 하 여. 돌연변이 관찰의 유형에 돌연 사용에 따라 다릅니다. 이온화 방사선 유발 돌연변이, 돌연변이 또는 삭제, 복제, 또는 재배치 포함. T-DNA 또는 transposon-기반 mutagenesis는 변환에 취약 종으로 제한, 화학 또는 물리적 mutagenesis 종의 광범위 한 범위에 적용할 수 있습니다. 그러나, 전통적으로 화학 또는 물리적 mutagenesis에서 파생 하는 돌연변이의 특성 지도 기반 복제 방식을, 노동 집중과 시간이 소모 되는 사용 합니다. 자, 우리 감지 하 여 효율적으로 복사 번호 유사 (CNVs) 돌연변이에 빠른 중성자 사격 (FNB) mutagenesis에서 파생 된 특성 고밀도 게놈 배열 기반 비교 genomic 교 잡 (aCGH) 플랫폼을 적용할 수 있음을 보여합니다 개자리속 truncatula, 콩과 식물 종입니다. 전체 게놈 시퀀스 분석 50000 개 이상의 유전자 나 유전자 모델 M. truncatula에서 보여줍니다. M. truncatula 에서 현재, FNB 유발 돌연변이에서 150000 이상 m 1 라인을 대표 하는 게놈에 있는 유전자의 기능 연구에 대 한 귀중 한 유전 자원에서 파생 됩니다. 여기에 설명 된 aCGH 플랫폼 FNB 유발 돌연변이 M. truncatula에 특성화를 위한 효율적인 도구입니다.

그림 2 는 전체 게놈에서 돌연변이 WT 신호 대의 표준화 된 로그2 비율의 분포를 보여준다. CGH 데이터의 분석 공개 대략적인 전체 SUNN 유전자33 와 몇 가지 다른 염색체 4에 22 kb 삭제 주석 FN6191 돌연변이 (그림 2, 그림 3)에서 유전자. 후보자 삭제 된 지역 평균 정규화 된 로그2 비율 미만-2.5 (보충 표 1) 73 연속 프로브 배열에 의해 덮여 있었다. 삭제 테두리의 검사 제안이 돌연변이에 상 상속 삭제 좌표 22,313,168 및 22,334,934 염색체 4 (그림 3) 사이 위치한 프로브에 의해 형벌 이다. 확인 하려면 삭제 테두리, PCR 뇌관 약 1500을 수 있도록 설계 됐다 혈압 떨어져 예측된 삭제 테두리 (FN6191-DB-f: GCTAGCAAGGGTCTGCGCAAGTT; FN6191-DB-R: GTATCGAGAAGGTCTTATAGCAGC) PCR 증폭이이 뇌관 및 다음 매개 변수와 함께 수행 되었다: 94 ° C, 5 분; 94 ° C, 45 s, 55 ° C, 30 s, 72 ° C, 1.5 분; 35 사이클; 72 ° C, 10 분 그리고 10 ° C 무기한. 예상 했던 대로, 약 1.5 kb의 PCR 제품 FN6191 돌연변이, 하지만 하지 WT (그림 4A)에서 성공적으로 증폭 되었다. M. truncatula 게놈 릴리스 v 3.5를 바탕으로, FN 6191에서 삭제의 크기 26.67 kb (그림 4B) 것으로 추정 했다. CGH 결과 FN6191 돌연변이 게놈 (그림 2)에 다른 비정상적인 세그먼트가 있는지 보여주었다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56470/56470fig1.jpg"> 
그림 1: 워크플로 M. truncatula 돌연변이의 배열 비교 genomic 교 잡 (aCGH) 분석의. 식물 재료의 (A) 준비: M. truncatula 야생 타입 (Jemalong A17)와 FN6191 돌연변이 했다 재배 3 ~ 4 주에 대 한 온실에. 높은 품질 genomic DNA의 (B) 격리: 단일 식물에서 젊은 잎의 1 그램 게놈 DNA를 분리 하는 데 사용 되었다. DNA 품질은 분 광 광도 계 및 젤 전기 이동 법을 사용 하 여 결정 했다. (C) DNA 라벨 고 정화. 참조 및 실험 샘플의 게놈 DNAs Cyanine 3 (Cy3)와 Cy5 사용 하 여 DNA 라벨 키트 및 정화 정화 열을 사용 하 여 표시 했다. (D) 교 잡, 세척, 및 1 x 1 M M. truncatula 배열 CGH의 스캔. (E) CGH 분석: 로그인-2.5 보다 작거나 실험/참조 신호2 비율 또는 2.5 보다 크거나 각각 putative 삭제 및 중복로 간주 됩니다. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56470/56470fig2.jpg"> 
그림 2: 배열 기반 M. truncatula 하이퍼 nodulation 돌연변이 FN6191에 복사 번호 유사 비교 genomic 교 잡 분석. 로그의 모든 8 개의 염색체에 프로브2 돌연변이/야생 타입 비율입니다. 염색체 4에 연속 73-조사 지역의 돌연변이 (화살표)에 삭제 된 영역으로 확인 되었다. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56470/56470fig3.jpg"> 
그림 3입니다. M. truncatula FN6191 돌연변이에서 삭제 된 영역의 식별. 근접 뷰 지역의 염색체 4에 있는 73 microarray 프로브 크게 전시 로그2 돌연변이/야생 타입 비율, 감소 되 고 6 SUNN (Medtr4g070970)를 포함 하 여 유전자를 매핑. 화살표 삭제 테두리의 PCR 확대를 위한 뇌관의 방향과 위치를 나타냅니다. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56470/56470fig4.jpg"> 
그림 4: 삭제 확인 M. truncatula FN6191 돌연변이에서 접경 한다. 삭제 테두리의 (A) PCR 증폭: 1.5 kb 제품 측면에 서는 삭제 테두리 (레인 1; 뇌관을 사용 하 여 FN6191 돌연변이에서 증폭 되었다 Mu)입니다. 뇌관의 동일한 집합 PCR (레인 2; 크기 제한 때문에 WT (M. truncatula Jemalong A17)에서 어떤 제품을 증폭 하지 않았다 Wt)입니다. 레인 M, 1 kb 사다리입니다. (B) FN6191 돌연변이 삭제 접합의 시퀀스입니다. 화살표 삭제 접합을 나타냅니다. (C) 삭제 테두리 (화살표)는 염색체 4에 좌표 22309163와 22335836에 위치 하는 것을 보여주었다 시퀀싱 결과. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/56470fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>믹스 1 라벨</td>
			<td>반응 당 x 샘플 # (μ)</td>
			<td>믹스 2 라벨</td>
			<td>반응 당 x 참조 # (μ)</td>
		</tr>
		<tr>
			<td>ddH2O</td>
			<td>6.0 x</td>
			<td>ddH2O</td>
			<td>6.0 x</td>
		</tr>
		<tr>
			<td>5 x 버퍼</td>
			<td>10.0 x</td>
			<td>5 x 버퍼</td>
			<td>10.0 x</td>
		</tr>
		<tr>
			<td>10 x dNTPs</td>
			<td>5.0 x</td>
			<td>10 x dNTPs</td>
			<td>5.0 x</td>
		</tr>
		<tr>
			<td>Cyanine 5</td>
			<td>3.0 x</td>
			<td>Cyanine 3</td>
			<td>3.0 x</td>
		</tr>
		<tr>
			<td>엑 소 Klenow</td>
			<td>1.0 x</td>
			<td>엑 소 Klenow</td>
			<td>1.0 x</td>
		</tr>
		<tr>
			<td>총</td>
			<td>25 x</td>
			<td>총</td>
			<td>25 x</td>
		</tr>
	</tbody>
</table>
표 1: 라벨 믹스.
추가 표 1: 프로브 시퀀스 M. truncatula FN6191 돌연변이 삭제. 
<a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56470/Supplemental_Table1.xlsx">이 파일을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutant

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

이 프로토콜에 복사 번호 유사의 전체 게놈 배열 기반 비교 genomic 교 잡 (CGH) 분석 수행에 관심이 있는 연구자에 대 한 실험 단계 및 시 약, 장비, 및 분석 도구에 대 한 정보 제공 식물입니다.

어레이 기반 비교 Genomic 교 잡 플랫폼 효율적인 탐지의 복사 번호 유사 빠른 중성자 유도 개자리속 truncatula 돌연변이에 대 한

Mutants are invaluable genetic resources for gene function studies. To generate mutant collections, three types of mutagens can be utilized, including ...

an-array-based-comparative-genomic-hybridization-platform-for

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Genetics

An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

Unit 2

Genomes and Evolution

SCIENTISTS IN ACTION

7.7K 조회수.  Noble Research Institute. 이 프로토콜에 복사 번호 유사의 전체 게놈 배열 기반 비교 genomic 교 잡 (CGH) 분석 수행에 관심이 있는 연구자에 대 한 실험 단계 및 시 약, 장비, 및 분석 도구에 대 한 정보 제공 식물입니다.

비디오: An Array-based Comparative Genomic Hybridization Platform for Efficient Detection of Copy Number Variations in Fast Neutron-induced Medicago truncatula Mutants

The Visual Colorimetric Detection of Multi-nucleotide Polymorphisms on a Pneumatic Droplet Manipulation Platform

A simple and visual method to detect multi-nucleotide polymorphism (MNP) was performed on a pneumatic droplet manipulation platform on an open surface. This approach to colorimetric DNA detection was based on the hybridization-mediated growth of gold nanoparticle probes (AuNP probes). The growth size and configuration of the AuNP are dominated by the number of DNA samples hybridized with the probes. Based on the specific size- and shape-dependent optical properties of the nanoparticles, the number of mismatches in a sample DNA fragment to the probes is able to be discriminated. The tests were conducted via droplets containing reagents and DNA samples respectively, and were transported and mixed on the pneumatic platform with the controlled pneumatic suction of the flexible PDMS-based superhydrophobic membrane. Droplets can be delivered simultaneously and precisely on an open-surface on the proposed pneumatic platform that is highly biocompatible with no side effect of DNA samples inside the droplets. Combining the two proposed methods, the multi-nucleotide polymorphism can be detected at sight on the pneumatic droplet manipulation platform; no additional instrument is required. The procedure from installing the droplets on the platform to the final result takes less than 5 min, much less than with existing methods. Moreover, this combined MNP detection approach requires a sample volume of only 10 &#181;l in each operation, which is remarkably less than that of a macro system.

This work presents a simple and visual method to detect multi-nucleotide polymorphisms on a pneumatic droplet manipulation platform. With the proposed method, the entire experiment, including droplet manipulation and detection of multi-nucleotide polymorphisms, can be performed near 23 &#176;C without the aid of advanced instruments.

공기 방울 조작 플랫폼에서 멀티 염기 다형성의 비주얼 색도계 감지

A simple and visual method to detect multi-nucleotide polymorphism (MNP) was performed on a pneumatic droplet manipulation platform on an open surface. ...

연구

유전학

Leveraging CyVerse Resources for De Novo Comparative Transcriptomics of Underserved (Non-model) Organisms

This workflow allows novice researchers to leverage advanced computational resources such as cloud computing to carry out pairwise comparative transcriptomics. It also serves as a primer for biologists to develop data scientist computational skills, e.g. executing bash commands, visualization and management of large data sets. All command line code and further explanations of each command or step can be found on the wiki (<a href="https://wiki.cyverse.org/wiki/x/dgGtAQ">https://wiki.cyverse.org/wiki/x/dgGtAQ</a>). The Discovery Environment and Atmosphere platforms are connected together through the CyVerse Data Store. As such, once the initial raw sequencing data has been uploaded there is no more need to transfer large data files over an Internet connection, minimizing the amount of time needed to conduct analyses. This protocol is designed to analyze only two experimental treatments or conditions. Differential gene expression analysis is conducted through pairwise comparisons, and will not be suitable to test multiple factors. This workflow is also designed to be manual rather than automated. Each step must be executed and investigated by the user, yielding a better understanding of data and analytical outputs, and therefore better results for the user. Once complete, this protocol will yield de novo assembled transcriptome(s) for underserved (non-model) organisms without the need to map to previously assembled reference genomes (which are usually not available in underserved organism). These de novo transcriptomes are further used in pairwise differential gene expression analysis to investigate genes differing between two experimental conditions. Differentially expressed genes are then functionally annotated to understand the genetic response organisms have to experimental conditions. In total, the data derived from this protocol is used to test hypotheses about biological responses of underserved organisms.

Leveraging CyVerse Resources for De Novo Comparative Transcriptomics of Underserved Non-model Organisms

This protocol outlines a comparative de novo transcriptome assembly and annotation workflow for novice bioinformaticians. The workflow is available for free entirely through CyVerse and connected by the Data Store. Command line and graphical user interfaces are used, but all code needed is available to copy and paste.

CyVerse 리소스 활용<em&gt; 드 노보</em&gt; 비포장 (비 모델) 생물의 비교 전이학

This workflow allows novice researchers to leverage advanced computational resources such as cloud computing to carry out pairwise comparative ...

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

단일 셀 시퀀싱을 사용하여 복사 번호 수선의 검출

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Detection of Inter-chromosomal Stable Aberrations by Multiple Fluorescence In Situ Hybridization (mFISH) and Spectral Karyotyping (SKY) in Irradiated Mice

Ionizing radiation (IR) induces numerous stable and unstable chromosomal aberrations. Unstable aberrations, where chromosome morphology is substantially compromised, can easily be identified by conventional chromosome staining techniques. However, detection of stable aberrations, which involve exchange or translocation of genetic materials without considerable modification in the chromosome morphology, requires sophisticated chromosome painting techniques that rely on in situ hybridization of fluorescently labeled DNA probes, a chromosome painting technique popularly known as fluorescence in situ hybridization (FISH). FISH probes can be specific for whole chromosome/s or precise sub-region on chromosome/s. The method not only allows visualization of stable aberrations, but it can also allow detection of the chromosome/s or specific DNA sequence/s involved in a particular aberration formation. A variety of chromosome painting techniques are available in cytogenetics; here two highly sensitive methods, multiple fluorescence in situ hybridization (mFISH) and spectral karyotyping (SKY), are discussed to identify inter-chromosomal stable aberrations that form in the bone marrow cells of mice after exposure to total body irradiation. Although both techniques rely on fluorescent labeled DNA probes, the method of detection and the process of image acquisition of the fluorescent signals are different. These two techniques have been used in various research areas, such as radiation biology, cancer cytogenetics, retrospective radiation biodosimetry, clinical cytogenetics, evolutionary cytogenetics, and comparative cytogenetics.

Detection of Inter-chromosomal Stable Aberrations by Multiple Fluorescence In Situ Hybridization mFISH and Spectral Karyotyping SKY in Irradiated Mice

The present protocol describes the usefulness of multiple fluorescence in situ hybridization (mFISH) and spectral karyotyping (SKY) in identifying inter-chromosomal stable aberrations in the bone marrow cells of mice after exposure to total body irradiation.

여러 형광에 의한 간 염색체 안정 수차의 검출<em&gt; 현장에서</em&gt; 하이브리드 (mFISH) 및 방사선 조사 마우스의 스펙트럼 핵형 분석 (SKY)

Ionizing radiation (IR) induces numerous stable and unstable chromosomal aberrations. Unstable aberrations, where chromosome morphology is substantially ...

A Fast Silver Staining Protocol Enabling Simple and Efficient Detection of SSR Markers using a Non-denaturing Polyacrylamide Gel

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver staining is a widely used method for the detection of SSR markers in a polyacrylamide gel. However, conventional protocols for silver staining are technically demanding and time-consuming. Like many other biological laboratory techniques, silver staining protocols have been steadily optimized to improve detection efficiency. Here, we report a simplified silver staining method that significantly reduces reagent costs and enhances the detection resolution and picture clarity. The new method requires two major steps (impregnation and development) and three reagents (silver nitrate, sodium hydroxide, and formaldehyde), and only 7 min of processing for a non-denaturing polyacrylamide gel. Compared to previously reported protocols, this new method is easier, quicker and uses fewer chemical reagents for SSR detection. Therefore, this simple, low-cost, and effective silver staining protocol will benefit genetic mapping and marker-assisted breeding by a quick generation of SSR marker data.

Here, we report a simple and low-cost silver staining protocol which requires only three reagents and 7 min of processing, and is suitable for fast generation of high-quality SSR data in the genetic analysis.

빠른 실버 얼룩 프로토콜 사용 간단 하 고 효율적인 탐지의 SSR 마커는 비 변성 시키기 Polyacrylamide 젤을 사용 하 여

Simple Sequence Repeat (SSR) is one of the most effective markers used in plant and animal genetic research and molecular breeding programs. Silver ...

Generating Transgenic Plants with Single-copy Insertions Using BIBAC-GW Binary Vector

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the transgene, as multi-copy integrations are often subjected to gene silencing. The Gateway-compatible binary vector based on bacterial artificial chromosomes (pBIBAC-GW), like other pBIBAC derivatives, allows the insertion of single-copy transgenes with high efficiency. As an improvement to the original pBIBAC, a Gateway cassette has been cloned into pBIBAC-GW, so that the sequences of interest can now be easily incorporated into the vector transfer DNA (T-DNA) by Gateway cloning. Commonly, the transformation with pBIBAC-GW results in an efficiency of 0.2&#8211;0.5%, whereby half of the transgenics carry an intact single-copy integration of the T-DNA. The pBIBAC-GW vectors are available with resistance to Glufosinate-ammonium or DsRed fluorescence in seed coats for selection in plants, and with resistance to kanamycin as a selection in bacteria. Here, a series of protocols is presented that guide the reader through the process of generating transgenic plants using pBIBAC-GW: starting from recombining the sequences of interest into the pBIBAC-GW vector of choice, to plant transformation with Agrobacterium, selection of the transgenics, and testing the plants for intactness and copy number of the inserts using DNA blotting. Attention is given to designing a DNA blotting strategy to recognize single- and multi-copy integrations at single and multiple loci.

Using a pBIBAC-GW binary vector makes generating transgenic plants with intact single-copy insertions, an easy process. Here, a series of protocols is presented that guide the reader through the process of generating transgenic Arabidopsis plants, and testing the plants for intactness and copy number of the inserts.

BIBAC-GW 이진 벡터를 사용 하 여 단일 복사본 삽입을 가진 유전자 변형 식물 생성

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been co-opted as a powerful tool for precise eukaryotic genome engineering. Here, we present a rapid and simple method using chimeric single guide RNAs (sgRNA) and CRISPR-Cas9 Ribonucleoproteins (RNPs) for the efficient and precise generation of genomic point mutations in C. elegans. We describe a pipeline for sgRNA target selection, homology-directed repair (HDR) template design, CRISPR-Cas9-RNP complexing and delivery, and a genotyping strategy that enables the robust and rapid identification of correctly edited animals. Our approach not only permits the facile generation and identification of desired genomic point mutant animals, but also facilitates the detection of other complex indel alleles in approximately 4 - 5 days with high efficiency and a reduced screening workload.

A Rapid and Facile Pipeline for Generating Genomic Point Mutants in C. elegans Using CRISPR/Cas9 Ribonucleoproteins

Here, we present a method to engineer the genome of C. elegans using CRISPR-Cas9 ribonucleoproteins and homology dependent repair templates.

빠른 고 손쉬운 파이프라인 C. 선 충 을 사용 하 여 CRISPR/Cas9 Ribonucleoproteins에서 게놈 포인트 돌연변이 생성에 대 한

The clustered regularly interspersed palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) prokaryotic adaptive immune defense system has been ...

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

제자리에 전체 산 교 잡에 의해 틱 용기에 Microbiota의 시각화

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the differentiation of hiPSCs derived from a patient with the triplication of the alpha-synuclein gene (SNCA) locus into Parkinson&#8217;s disease (PD)-relevant dopaminergic neuronal populations. Accumulating evidence has shown that high levels of SNCA are causative for the development of PD. Recognizing the unmet need to establish novel therapeutic approaches for PD, especially those targeting the regulation of SNCA expression, we recently developed a CRISPR/dCas9-DNA-methylation-based system to epigenetically modulate SNCA transcription by enriching methylation levels at the SNCA intron 1 regulatory region. To deliver the system, consisting of a dead (deactivated) version of Cas9 (dCas9) fused with the catalytic domain of the DNA methyltransferase enzyme 3A (DNMT3A), a lentiviral vector is used. This system is applied to cells with the triplication of the SNCA locus and reduces the SNCA-mRNA and protein levels by about 30% through the targeted DNA methylation of SNCA intron 1. The fine-tuned downregulation of the SNCA levels rescues disease-related cellular phenotypes. In the current protocol, we aim to describe a step-by-step procedure for differentiating hiPSCs into neural progenitor cells (NPCs) and the establishment and validation of pyrosequencing assays for the evaluation of the methylation profile in the SNCA intron 1. To outline in more detail the lentivirus-CRISPR/dCas9 system used in these experiments, this protocol describes how to produce, purify, and concentrate lentiviral vectors and to highlight their suitability for epigenome- and genome-editing applications using hiPSCs and NPCs. The protocol is easily adaptable and can be used to produce high titer lentiviruses for in vitro and in vivo applications.

Targeted DNA epigenome editing represents a powerful therapeutic approach. This protocol describes the production, purification, and concentration of all-in-one lentiviral vectors harboring the CRISPR-dCas9-DNMT3A transgene for epigenome-editing applications in human induced pluripotent stem cell (hiPSC)-derived neurons.

인간으로 Epigenome 편집 도구의 효율적인 배달 lentiviral 벡터 플랫폼 유도 만능 줄기 세포 유래 질병 모델

The use of hiPSC-derived cells represents a valuable approach to study human neurodegenerative diseases. Here, we describe an optimized protocol for the ...

어레이 기반 비교 Genomic 교 잡 플랫폼 효율적인 탐지의 복사 번호 유사 빠른 중성자 유도 개자리속 truncatula 돌연변이에 대 한

요약

더 많은 비디오 탐색

이 비디오의 챕터