저자는이 프로토콜의 설립 동안에 그의 우수한 기술 지원에 대 한 1 월 Appel 감사합니다. Rada Iglesias 실험실에서 작업 CMMC 교내에서 지원 자금, DFG 연구 보조금 (RA 2547/1-1, RA 2547/2-1, 그리고 테 1007/3-1), UoC 고급 연구원 그룹 그랜트, 그리고 CECAD 그랜트.

<ol>
	<li>Jenuwein, T., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+the+histone+code.">Translating the histone code.</a> Science. 293 (5532), 1074-1080 (2001).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+and+their+function.">Chromatin modifications and their function.</a> Cell. 128 (4), 693-705 (2007).</li><li>Wang, Z., Schones, D. E., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+epigenomes.">Characterization of human epigenomes.</a> Curr Opin. Genet Dev. 19 (2), 127-134 (2009).</li><li>ENCODE Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S. A., Flynn, R. A., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+chromatin+signature+uncovers+early+developmental+enhancers+in+humans.">A unique chromatin signature uncovers early developmental enhancers in humans.</a> Nature. 470 (7333), 279-283 (2011).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Nat Acad Sci USA. 107 (50), 21931-21936 (2010).</li><li>Benayoun, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K4me3+breadth+is+linked+to+cell+identity+and+transcriptional+consistency.">H3K4me3 breadth is linked to cell identity and transcriptional consistency.</a> Cell. 158 (3), 673-688 (2014).</li><li>Rehimi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenomics-Based+Identification+of+Major+Cell+Identity+Regulators+within+Heterogeneous+Cell+Populations.">Epigenomics-Based Identification of Major Cell Identity Regulators within Heterogeneous Cell Populations.</a> Cell Rep. 17 (11), 3062-3076 (2016).</li><li>Whyte, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Master+transcription+factors+and+mediator+establish+super-enhancers+at+key+cell+identity+genes.">Master transcription factors and mediator establish super-enhancers at key cell identity genes.</a> Cell. 153 (2), 307-319 (2013).</li><li>Valouev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+transcription+factor+binding+sites+based+on+ChIP-Seq+data.">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data.</a> Nat Methods. 5 (9), 829-834 (2008).</li><li>Dahl, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+histone+H3K4me3+domains+in+mouse+oocytes+modulate+maternal-to-zygotic+transition.">Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-zygotic transition.</a> Nature. 537 (7621), 548-552 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nat Biotech. 33 (11), 1165-1172 (2015).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nat Methods. 12 (10), 963-965 (2015).</li><li>Zhang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allelic+reprogramming+of+the+histone+modification+H3K4me3+in+early+mammalian+development.">Allelic reprogramming of the histone modification H3K4me3 in early mammalian development.</a> Nature. 537 (7621), 553-557 (2016).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Dev Dynam. 195 (4), 231-272 (1951).</li><li>Ho, J. W. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+metazoan+chromatin+organization.">Comparative analysis of metazoan chromatin organization.</a> Nature. 512 (7515), 449-452 (2014).</li><li>Calo, E., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+enhancer+chromatin:+what,+how,+and+why?.">Modification of enhancer chromatin: what, how, and why?.</a> Mol Cell. 49 (5), 825-837 (2013).</li><li>Spitz, F., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factors:+from+enhancer+binding+to+developmental+control.">Transcription factors: from enhancer binding to developmental control.</a> Nat Rev Genetics. 13 (9), 613-626 (2012).</li></ol>

저자는 공개 해야 경쟁 금융 관심사를 있지 않습니다.

다른 세포질 문맥4,,518에 척 추가 있는 게놈의 기능적인 주석을 개선 하기 위해 Epigenomic의 히스톤 수정 칩 seq를 사용 하 여 프로 파일링을 사용할 수 있습니다. 이러한 epigenomic 프로필 사용할 수 있습니다, 다른 것 들 중, 증강 요소, (즉, 활성, 준비, 또는 태세), 강화의 규제 상태를 정의 하 고 다른 생물에 주요 셀 정체성 레 귤 레이 터를 정의 식별 하 또는 병 적인 컨텍스트 (예: 광범위 한 H3K4me3 발기인 도메인 및 슈퍼 강화)6,7,,910,11,19. 그러나, 일반적으로 수백만의 세포를 요구 한다, 칩 분석 실험의 제한을 인해 대부분 히스톤 수정 셀 라인 생체 외에서 생성 된 프로필과 셀 수 있는 유형 정렬 비보에 대량 4. 가장 최근에 여러 칩 seq 프로토콜 설명 되었습니다 매우 낮은 세포 수, 세포 유형의 범위 크게 확대와 호환 되는 및 어떤 epigenomic에 프로 파일 될 수 있습니다, 원칙적으로, 조직 생성13 ,14,,1516. 적어도 어떤 경우에 비표준 장비 및 시 약14,,1516를 요구 하는 특정 임시 도서관 준비 방법에 의존 하는이 새로운 칩 seq 프로토콜 각.
여기, 우리가 다른 배아 조직10에서 vivo에서 얻은 중간 셀 숫자 (5 x 104 -5 x 105 셀) 낮은 작동 칩 프로토콜을 설명 합니다. 우리의 칩 분석 실험의 감도 증가, 순차적 셀 등 귀중 한 자료의 진보적인 손실 귀 착될 수 있다 핵 세포 칩, 동안 일반적으로 사용 하는 몇 가지 단계를 제거는 우리. 따라서, 가교, 후 샘플 단일 세포의 용 해 버퍼 처리 됩니다 하 고 이후 샘플 손실을 최소화 하기 위해 sonicated. 중요 한 것은, 우리의 칩 프로토콜 정량 분석, 관심의 선택한 loci의 epigenomic 분석 활성화와 호환 됩니다. 또한, 우리의 칩 프로토콜 표준 칩 seq 라이브러리 준비 방법, 따라서 차세대 시퀀싱 기술에 액세스할 수 있는 대부분의 실험실에 잠재적으로 유용한 것으로 결합할 수 있습니다.
칩 칩 seq 프로토콜 사용할 수 있습니다 뿐만 아니라 히스톤 수정의 바인딩 프로필 조사 뿐만 아니라 다른 중요 한 transcriptional 레 귤 레이 터, 녹음 방송 요인 등 공동 활성 제 (예를 들어, 바인딩 사이트를 밝히기 p 300와 CBP)20. 일반적으로, 칩 (칩 seq) 녹음 방송 요인 및 공동 활성 제는 없는 및 히스톤으로 풍부한, 히스톤 부호 칩 보다는 상당히 더 시작 자료가 필요 합니다. 따라서, 설명된 프로토콜 반드시 대부분 녹음 방송 요인에 대 한 작동 하지 않을 수도 또는 공동 활성 세포를 시작 하는 수 않으면 상당히 증가 (예를 들어, 5 x 105 -5 x 106 셀) 또는 매우 특정 하 고 효율적인 항 체를 사용할 수 있습니다. 그럼에도 불구 하 고, 추가 최적화 및 지속적으로 개선 라이브러리 준비 방법, 우리 예상 제한 된 셀룰러 자료에서 칩 seq 대부분 규제 단백질에 대 한 실현 될 것 이다.
비록 우리의 칩과 칩 seq 프로토콜 광범위 하 게 다양 한 히스톤 수정 및 배아 조직에 대 한 검증 된, 우리가 우리가 고려 높은 품질 epigenomic 프로 파일 생성에 필수적인 몇 가지 중요 한 단계를 강조 하 고 싶습니다. 첫째, 배아 샘플 갓 chromatin 무결성을 손상 하지 않는 조건 하에서 고립 될 필요가 있다. 충분 한 자료 축적 때까지 차가운 조건 또는 플래시 동결 풀링된 샘플 해 수행 포함 됩니다. 또 다른 중요 한 단계는 정확 하 게 높은-품질 칩을 수행 하기 위해 최적화가 필요한 쥡니다. 최적의 쥡니다 조건 자주 따라 달라 조직 유형, 조직, 또는 사용 중인 sonicator의 금액. 마지막으로, 성공적인 칩 궁극적으로 및 관심사의 단백질에 대 한 항 체 칩 호환의 가용성에 의존합니다.

히스톤 포스트 번역 상 수정 녹음 방송, 복제 및 DNA 복구1,2,3를 포함 하 여 다양 한 chromatin 종속 프로세스에 직접 참여 하는. 또한, 다른 히스톤 수정 보여 긍정적인 (예를 들어, H3K4me3 및 H3K27ac) 또는 음수 (예를 들어, H3K9me3 및 H3K27me3) 유전자 발현 상관 관계 광범위 하 게 정의 될 수 있는 활성화 또는 억압 적인 히스톤 표시로 각각2,은3. 따라서, 글로벌 히스톤 수정 지도, epigenomic 지도 라고도 기능적으로 척 추가 있는 게놈4,5주석을 강력 하 고 보편적인 도구로 떠오르고 있다. 예를 들어 원심 규제 시퀀스와 같은 강화를 확인할 수 있습니다에 따라 특정 chromatin 서명의 존재 (예를 들어, 활성 강화: H3K4me1 및 H3K27ac)는 근 위 발기인 지구에서 그들을 구분 (예를 들어, 활성 발기인: H3K4me3)6,,78. 다른 한편으로, 정체성 규정 하는 주요한 세포 기능을 가진 유전자는 일반적으로 넓은 chromatin 도메인 기본 유전자의 transcriptionally 활성 또는 비활성 상태에 따라 H3K4me3 또는 H3K27me3, 각각 표시 된9 발견 ,10. 마찬가지로, 주요 셀 정체성 유전자의 표현을 자주 여러 고 공간적 제어를 클러스터 강화 (즉, 슈퍼 강화), 광범위 한 H3K27ac 표시 된 도메인11로 확인 될 수 있다 보인다.
현재, 히스톤 수정 지도 칩 (칩 microarrays 결합) 같은 이전 방법에 비해 더 적은 소음, 큰 범위, 및 낮은 적은 유물 높은 해상도 제공 하는 칩 seq 기술을 사용 하 여 생성 됩니다. 비용12. 그럼에도 불구 하 고, epigenomic 맵 칩 seq 기술을 사용 하 여 생성의 한계, 주로 관심의 샘플에서 칩을 성공적으로 수행 하는 능력을 연관 있다. 전통적인 칩 프로토콜은 일반적으로 수백만의 세포를 체 외에서 세포를이 방법의 적용 라인 또는 세포는 제한 쉽게 격리 수 vivo에서 (예를 들어, 혈액 세포) 필요 합니다. 지난 몇 년 동안, 여러 수정된 칩 프로토콜 낮은 셀 숫자와 호환 설명된13,14,,1516되었습니다. 그러나, 이러한 프로토콜은 다음-세대 시퀀싱 (즉, 칩 seq)와 결합 하도록 특별히 설계 된 그리고 그들은 일반적으로 임시 라이브러리 준비 방법13,14, 를 사용 하 여 15 , 16.
여기, 우리는 히스톤 수정 프로필 중간에 낮은 셀 숫자 (5 x 104 -5 x 105 셀)를 사용 하 여 조사 하는 데 사용할 수 있는 칩 프로토콜 설명 (즉, 칩 정량) 중 선택한 loci 또는 전역 (즉, 칩 seq) (그림 1). 칩 seq 기술 결합 때 우리의 칩 프로토콜 표준 라이브러리 준비 방법, 따라서 많은 실험실10에 광범위 하 게 액세스할 수 있도록 함께 사용할 수 있습니다. 이 프로토콜은 여러 히스톤 부호를 조사 하기 위해 사용 되었습니다 (예를 들어, H3K4me3, H3K27me3, 및 H3K27ac) 다른 닭 배아 조직 (예를 들어, 척추 신경 관 (SNT), frontonasal 굴지, 및 epiblast)에. 그러나, 우리는 그것은 다른 유기 체는 생물학적 및 임상 관련 샘플만 얻을 수 낮은 금액에 광범위 하 게 적용 해야 예상.

<table>
	<tbody>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BSA powder</td>
			<td>Carl Roth</td>
			<td>3737.3</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Saline buffer (PBS)</td>
			<td>Sigma Aldrich</td>
			<td>D8537</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCL pH8.0</td>
			<td>Sigma Aldrich</td>
			<td>T1503</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Carl Roth</td>
			<td>3957.2</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Carl Roth</td>
			<td>8043.2</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Carl Roth</td>
			<td>3054.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Na-Deoxycholate</td>
			<td>Sigma Aldrich</td>
			<td>D6750-24</td>
			<td></td>
		</tr>
		<tr>
			<td>N-lauroylsarcosine</td>
			<td>Sigma Aldrich</td>
			<td>61743-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Applichem</td>
			<td>A3724,0250</td>
			<td></td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Carl Roth</td>
			<td>3739.2</td>
			<td></td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Sigma Aldrich</td>
			<td>I3021-100ml</td>
			<td></td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Carl Roth</td>
			<td>1833</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G/magnetic beads</td>
			<td>Invitrogen</td>
			<td>1004D</td>
			<td></td>
		</tr>
		<tr>
			<td>37% Formaldehyde</td>
			<td>Sigma Aldrich</td>
			<td>252549-1L</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RNase</td>
			<td>Peqlab</td>
			<td>12-RA-03</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Sigma Aldrich</td>
			<td>46.35 E</td>
			<td></td>
		</tr>
		<tr>
			<td>Na-butyrate</td>
			<td>Sigma Aldrich</td>
			<td>SLB2659V</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase inhibitor</td>
			<td>Roche</td>
			<td>5892791001</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBRgreen Mix</td>
			<td>biozym</td>
			<td>617004</td>
			<td></td>
		</tr>
		<tr>
			<td>dH2O</td>
			<td>Sigma Aldrich</td>
			<td>W4502</td>
			<td></td>
		</tr>
		<tr>
			<td>1Kb ladder</td>
			<td>Thermofisher</td>
			<td>SM1333</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma Alrich</td>
			<td>03756-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Invitrogen</td>
			<td>16500-500</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X)</td>
			<td>Gibco</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Octylphenol Ethoxylate (Triton X 100)</td>
			<td>Roth</td>
			<td>3051.4</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (Dulbecco&#180;s Modified Eagle Medium)</td>
			<td>Gibco</td>
			<td>31331-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel loading tips Multiflex</td>
			<td>A.Hartenstein</td>
			<td>GS21</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Plates</td>
			<td>Sarstedt</td>
			<td>721,985,202</td>
			<td></td>
		</tr>
		<tr>
			<td>384 well</td>
			<td>Sarstedt</td>
			<td>721,985,202</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 mL tubes</td>
			<td>Sarstedt</td>
			<td>72,706</td>
			<td></td>
		</tr>
		<tr>
			<td>100-1000&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,762,211</td>
			<td></td>
		</tr>
		<tr>
			<td>2-20&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,760,213</td>
			<td></td>
		</tr>
		<tr>
			<td>2-200&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,760,211</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5-10&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>701,116,210</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K27me3 antibody</td>
			<td>Active Motif</td>
			<td>39155</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K27ac antibody</td>
			<td>Active Motif</td>
			<td>39133</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K4me3 antibody</td>
			<td>Active Motif</td>
			<td>39159</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K4me2 antibody</td>
			<td>Active Motif</td>
			<td>39141</td>
			<td></td>
		</tr>
		<tr>
			<td>End Repair Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Paramagnetic beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Resuspension buffer</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>A-Tailing Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA Adapter Indexes</td>
			<td>Illumina</td>
			<td>RS-122-2101</td>
			<td></td>
		</tr>
		<tr>
			<td>Stop Ligation Buffer</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Primer Cocktail</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Enhanced PCR Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA ladder</td>
			<td>Agilent</td>
			<td>5067-5582</td>
			<td></td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>Agilent</td>
			<td>19086</td>
			<td></td>
		</tr>
		<tr>
			<td>Sample Buffer</td>
			<td>Agilent</td>
			<td>5067-5582</td>
			<td></td>
		</tr>
		<tr>
			<td>Library Quantification Kit</td>
			<td>Kapa Biosystems</td>
			<td>KK4835 &#8211; 07960204001</td>
			<td></td>
		</tr>
		<tr>
			<td>Fertile chicken white eggs</td>
			<td>LSL Rhein Main</td>
			<td>KN: 15968</td>
			<td></td>
		</tr>
		<tr>
			<td>Needle (Neoject)</td>
			<td>A.Hartenstein</td>
			<td>10001</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe (Ecoject 10ml)</td>
			<td>Dispomed witt oHG</td>
			<td>21010</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Hermle</td>
			<td>Z 216 MK</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermoshaker</td>
			<td>ITABIS</td>
			<td>MKR13</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Active Motive</td>
			<td>EpiShear probe sonicator</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Diagenode</td>
			<td>Bioruptor Plus</td>
			<td></td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td></td>
		</tr>
		<tr>
			<td>Variable volume (5&#8211;1,000 &#956;l) pipettes</td>
			<td>Eppendorf</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Timer</td>
			<td>Sigma</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic holder</td>
			<td>Thermo Fisher</td>
			<td>DynaMag-2 12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Table spinner</td>
			<td>Heathrow Scientific</td>
			<td>Sprout</td>
			<td></td>
		</tr>
		<tr>
			<td>Mixer</td>
			<td>LMS</td>
			<td>VTX 3000L</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Cycler</td>
			<td>Roche</td>
			<td>Light Cycler; Serial Nr.5662</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Cycler</td>
			<td>Applied Biosystems</td>
			<td>Gene Amp PCR System 9700</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA and RNA quality control system</td>
			<td>Agilent</td>
			<td>Agilent 4200 TapeStation System</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>Dumont</td>
			<td>5-Inox-H</td>
			<td></td>
		</tr>
		<tr>
			<td>Perforated spoon</td>
			<td>World precision instruments</td>
			<td>501997</td>
			<td></td>
		</tr>
	</tbody>
</table>

chromatin immunoprecipitation (chip) protocol for low-abundance embryonic samples

Chromatin immunoprecipitation (칩) post-translationally 수정된 히스톤, 히스톤 변형, 녹음 방송 요인, 또는 주어진된 장소에서 또는 게놈 넓은 규모로 chromatin 수정 효소의 지역화를 매핑하기 위한 널리 사용 기법입니다. 다음-세대 시퀀싱 (즉, 칩 Seq) 칩 분석 실험의 조합 세계적으로 유전자 규제 네트워크를 폭로 하 고 특히 비 코딩 규제 시퀀스의 유전자의 기능 주석 개선 하기 강력한 접근 이다. 칩 프로토콜은 일반적으로 많은 양의 세포 소재, 따라서 희귀 세포 유형 또는 작은 조직 생 검 조사 하는 것이 방법의 적용 제외 필요 합니다. 칩 분석 결과 얻어질 수 있는 일반적으로 생체 내에서 초기 척추 embryogenesis 동안 생물 학적 물질의 양을와 호환을 위해 여기 있는 단계 수를 완료 하는 데 필요한 간단한 칩 프로토콜 설명 합니다 분석 결과 샘플 손실을 최소화 하기 위해 감소 했다. 이 칩 프로토콜은 다양 한 배아 닭고기와 성인 마우스 조직 낮은 중간 셀 숫자 (5 x 104 -5 x 105 셀)를 사용 하 여 다른 히스톤 수정 조사를 성공적으로 사용 되었습니다. 중요 한 것은,이 프로토콜은 표준 라이브러리 준비 방법을 사용 하 여 칩 seq 기술과 호환, 관련성이 높은 배아 조직에 지도 글로벌 epigenomic 제공.

우리의 칩 프로토콜의 성능을 설명 하기 위해 수행 하는 칩 seq 실험 HH19 닭 배아에서 풀링된 SNT 섹션을 사용 하 여, HH22의 상 악 굴지 닭 배아, 그리고 무대 HH3 닭 배아의 바인딩 프로필을 조사 하 다양 한 히스톤 수정 (즉, H3K4me2, H3K27ac, H3K4me3, 및 H3K27me3). 일단 칩 DNAs 가져온 쥡니다 효율 해당 입력된 DNAs (그림 3)의 agarose 젤 전기 이동 법에 의해 평가 되었습니다. 다음, 칩 및 입력된 DNAs 사용 되었다 칩 정량 분석을 위해 측정 수 바운드 또는 언바운드 조사 히스톤 수정 (그림 4A)에 의해 예상 loci에서 풍부 하. 그림 4A, H3K27me3 및 H3K4me3 농축에 나와 있는 예제에서 HH19 SNT 섹션에서 레벨 SOX17 및 SOX2, 비활성 및 활성이 SNT에 각각은 2 개의 유전자의 발기인 지구 주위 칩 정량에 의해 평가 되었다. 예상 했던 대로, SOX2 발기인 강하게 표시 되었다 H3K27me3, 아니라 H3K4me3에 의해 SOX17 발기인 반대 패턴 (그림 4A) 보였다 동안. 몇 가지 loci를 평가 하 여 다운스트림 칩 seq 분석에 대 한 많은 DNA 자료를 잃지 않고 칩의 품질을 예측 가능 하다. 일단 칩의 품질 확인 했다 칩 seq 라이브러리 준비 되었고 시퀀스. 대표 loci 각 조사 닭 배아 조직에 대 한 표시 됩니다: (i) PAX7 (그림 4B); 주위 SNT HH19 여자 태아에서 H3K27me3 및 H3K4me3에 대 한 프로필 (ii) SNAI1 (그림 4C); 주위 HH22 닭 배아의 상 악 굴지에 H3K4me2 및 H3K27ac에 대 한 프로필 그리고 (iii) HH3 단계 닭 배아 TBX3/TBX5 소재 시 (그림 4D) 주위에 H3K27me3에 대 한 프로 파일. 이러한 칩 seq 실험은 명확 하 게 우리의 칩 프로토콜 배아 조직의 광범위에 생물학 물자의 제한 된 양의에서 epigenomic 프로 파일을 생성 하기 위해 사용할 수 있습니다 설명 합니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56186/56186fig1.jpg"> 
그림 1: 낮은 풍부 배아 샘플 닭 배아에서 분리 된 칩 프로토콜의 개요 개요. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56186/56186fig2.jpg"> 
그림 2: SNT 기정 프로토콜의 개요 브리핑. 가로 SNT 세그먼트는 HH19 닭 태아의 상 완 수준에서 차단 된다. 트립 신 치료 후 비 신경 조직은 기계적으로 집게를 사용 하 여 제거 됩니다. 아니, notochord; SNT, 척추 신경 관; 그래서, somite. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56186/56186fig3.jpg"> 
그림 3: 최적의 쥡니다의 예. 닭 SNT HH19 샘플 30 s에는 sonicator를 사용 하 여 "높은" 진폭에서 45 s OFF 펄스 11 사이클 sonicated 했다. crosslinks을 반대 했다 고 순화 된 DNA는 1.5 %agarose 젤에 해결 되었습니다. 최적의 조각 크기 11 주기, 200-500 bp.에서 배열 후 관찰 <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56186/56186fig4.jpg"> 
그림 4: 칩 정량 또는 칩이 칩 분석의 대표 예제 (A) H3K27me3 (왼쪽)와 H3K4me3 (오른쪽) 레벨 표시 영역에서 HH19 병아리 태아에서 분리 된 s n T 섹션을 사용 하 여 수행 하는 칩 정량 분석에 의해 측정 되었다. SOX2 발기인 지역 SNT에 적극적 이며 따라서 H3K27me3; 아니라 H3K4me3에 의해 표시 SOX17 발기인 지역 SNT에 적극적 이며 H3K27me3 H3K4me3;에 따라서 농축입니다. Chr6 Neg 닭고기 염색체 6에에서 intergenic 지역 나타내고 부정적인 제어로 제공. 오차 막대는 3 기술 복제에서 표준 편차를 나타냅니다. (B) 칩 seq (자홍색으로 H3K27me3, H3K4me3, 파란색에서 및 빨간색에서 입력) HH14 SNTs 병아리 태아에서 프로필 PAX7 로커 스 주위에 표시 됩니다. (C) 칩 seq (H3K4me2 주황색에서, 녹색, H3K27ac 및 빨간색에서 입력) HH22 병아리 태아의 상 악 굴지에서 프로필 SNAI1 소재 시 주위에 표시 됩니다. (D) 칩 seq HH3 병아리 태아에서 (자홍색으로 H3K27me3) 및 빨간색에서 입력 프로 파일 TBX3/TBX5 소재 시 주위에 표시 됩니다. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56186/56186fig5.jpg"> 
그림 5: 자동 RNA 품질 관리 시스템을 사용 하 여 칩 seq 라이브러리 유효성 검사의 예. 동일한 칩 seq 라이브러리 (A) 전에 자동된 RNA 품질 관리 시스템으로 분석 되었다 (B) 뇌관 이합체 정리 후. 뇌관 이합체는 약한 ~ 135 bp 밴드 (A)에서 볼 수 있습니다. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>단계</td>
			<td>문제</td>
			<td>가능한 이유</td>
			<td>솔루션</td>
		</tr>
		<tr>
			<td>1,2,3,4 5와 11</td>
			<td>칩-정량 및 칩 seq에 따라 잡음 비율 낮은 칩 신호</td>
			<td>조직의 품질 손상.</td>
			<td>마이크로-해 차가운 조건;에서 수행 그렇지 않으면 chromatin 무결성 노출 될 수 있습니다.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>가교 된 샘플의 원심 분리 후 샘플 손실입니다.</td>
			<td>10-20% 혈 청 또는 반복 원심 분리 단계 DMEM 매체를 사용 하 고 10 분을 시간을 증가.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>가교 기간입니다.</td>
			<td>가교 시간을 최적화 합니다. 증가 가교 번 공동 활성 할 바인딩되지 DNA에 직접 공동 repressors 등 특정 단백질의 검출을 용이 하 게 수 있습니다.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>PBS에서 여러 세척으로 샘플 손실입니다.</td>
			<td>세척;의 수 감소 1500 x g에서 원심 분리 단계를 반복할 수 있습니다.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>너무 오랫동안 또는 너무 짧은 DNA 크기에 따른 차선 쥡니다.</td>
			<td>시간 과정 실험 쥡니다 조건 최적화를 수행 합니다. 200에서 500에 이르기까지 최적의 조각 크기 혈압</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>항 체 칩에 적합 하지 않은입니다.</td>
			<td>내 인 성 단백질에 대 한 서로 다른 항 체 또는 한 것 표현된 단백질 (예: 깃발, HA)에 추가 하는 태그에 대 한 항 체를 사용 합니다.</td>
		</tr>
		<tr>
			<td>12</td>
			<td>낮은 또는 정량, 아무 신호도 입력 DNA에 대 한</td>
			<td>차선의 뇌관</td>
			<td>뇌관 효율성 및 특이성; 새로운 뇌관 디자인.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>DNA의 부족 한 금액</td>
			<td>충분 하지 않은 시작 소재입니다. 정량 Pcr 반응 마다 사용 하는 DNA의 양을 증가.</td>
		</tr>
	</tbody>
</table>
-페이지 = "1" >표 1: 문제 해결 프로토콜에 관련 된 다양 한 단계에 대 한 가이드.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>뇌관</td>
			<td>시퀀스</td>
		</tr>
		<tr>
			<td>SOX2 F</td>
			<td>CCTTGCTGGGAGTACGACAT</td>
		</tr>
		<tr>
			<td>SOX2-R</td>
			<td>GCCCTGCAGTACAACTCCAT</td>
		</tr>
		<tr>
			<td>SOX17-F</td>
			<td>CCCTGAACTGTCATGTGTGG</td>
		</tr>
		<tr>
			<td>SOX17-R</td>
			<td>CAAACAGTTGCCTTTGAGCA</td>
		</tr>
		<tr>
			<td>Chr6-neg-F</td>
			<td>CCGTCAATCTCTGCTTGTGA</td>
		</tr>
		<tr>
			<td>Chr6-neg-R</td>
			<td>TGGAATCTGCTTGTCACTGC</td>
		</tr>
	</tbody>
</table>
표 2: 칩-정량 pcr 뇌관 시퀀스.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Preincubation</td>
		</tr>
		<tr>
			<td>온도</td>
			<td colspan="2">시간</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">5 분</td>
		</tr>
		<tr>
			<td colspan="3">증폭</td>
		</tr>
		<tr>
			<td>온도</td>
			<td colspan="2">시간</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td>10 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 ° C</td>
			<td>10 s</td>
			<td>45</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td>10 s</td>
			<td>사이클</td>
		</tr>
		<tr>
			<td colspan="3">녹는 곡선</td>
		</tr>
		<tr>
			<td>온도</td>
			<td colspan="2">시간</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td>65 ° C</td>
			<td colspan="2">1 분</td>
		</tr>
		<tr>
			<td colspan="3">냉각</td>
		</tr>
		<tr>
			<td>40 ° C</td>
			<td colspan="2">30 s</td>
		</tr>
	</tbody>
</table>
표 3: 칩-정량 pcr PCR 조건.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">초기 변성</td>
		</tr>
		<tr>
			<td>온도</td>
			<td colspan="2">시간</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">3 분</td>
		</tr>
		<tr>
			<td colspan="3">증폭</td>
		</tr>
		<tr>
			<td>온도</td>
			<td colspan="2">시간</td>
		</tr>
		<tr>
			<td>98 ° C</td>
			<td>20 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 ° C</td>
			<td>15 s</td>
			<td>15</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td>30 s</td>
			<td>사이클</td>
		</tr>
		<tr>
			<td colspan="3">마지막 확장</td>
		</tr>
		<tr>
			<td>온도</td>
			<td colspan="2">시간</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td colspan="3">냉각</td>
		</tr>
		<tr>
			<td>4 ° C</td>
			<td colspan="2">보류</td>
		</tr>
	</tbody>
</table>
표 4: 칩 seq 라이브러리 준비 하는 동안 DNA 파편의 확대를 위한 PCR 조건.

Watch this Scientific Journal Video about Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples at JoVE.com

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

여기, 우리는 chromatin immunoprecipitation (칩) 및 칩 seq 라이브러리 준비 프로토콜 낮은 풍부한 닭 배아 샘플에서 글로벌 epigenomic 프로 파일 생성을 설명 합니다.

낮은 풍부 배아 샘플 chromatin Immunoprecipitation (칩) 프로토콜

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

chromatin-immunoprecipitation-chip-protocol-for-low-abundance

Nanyang Technological University

Research

JoVE Journal

Genetics

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

15.6K 조회수.  University of Cologne. 여기, 우리는 chromatin immunoprecipitation (칩) 및 칩 seq 라이브러리 준비 프로토콜 낮은 풍부한 닭 배아 샘플에서 글로벌 epigenomic 프로 파일 생성을 설명 합니다.

비디오: Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

바인딩 속성 수정 복합물 Chromatin의 대량 Chromatin의 분석에 대 한 순차적 소금 기사

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

연구

유전학

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Chromatin Immunoprecipitation을 이용한 c-KIT 리간드 프로모터 분석

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

마우스 T- 세포주에서 Chromatin Immunoprecipitation (ChIP)

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

네이티브 Chromatin Immunoprecipitation Nucleosome 밀도 분석을 위한 라이브러리를 시퀀싱의 세대

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.

Chromatin Immunoprecipitation ChIP of Histone Modifications from Saccharomyces cerevisiae

Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.

히스톤 수정 Saccharomyces cerevisiae 에서 chromatin Immunoprecipitation (칩)

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Chromatin Immunoprecipitation of Murine Brown Adipose Tissue

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of a wide range of transcription factors (TFs) and cofactors mediating transcriptional activation or repression via changes in chromatin structure. Chromatin immunoprecipitation (ChIP) is a useful molecular biology approach for mapping histone modifications and profiling transcription factors/cofactors binding to DNA, thus providing a snapshot of the dynamic nuclear changes occurring during different biological processes.
To study transcriptional regulation in adipose tissue, samples derived from in vitro cell cultures of immortalized or primary cell lines are often favored in ChIP assays because of the abundance of starting material and reduced biological variability. However, these models represent a limited snapshot of the actual chromatin state in living organisms. Thus, there is a critical need for optimized protocols to perform ChIP on adipose tissue samples derived from animal models.
Here we describe a protocol for efficient ChIP-seq of both histone modifications and non-histone proteins in brown adipose tissue (BAT) isolated from a mouse. The protocol is optimized for investigating genome-wide localization of proteins of interest and epigenetic markers in the BAT, which is a morphologically and physiologically distinct tissue amongst fat depots.

Here we describe a protocol for efficient chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) of brown adipose tissue (BAT) isolated from a mouse. This protocol is suitable for both mapping histone modifications and investigating genome-wide localization of non-histone proteins of interest in vivo.

Murine 갈색 지방이 많은 직물의 염색 질 Immunoprecipitation

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

포유류 세포에서 미세 Coccal 뉴클레아제사용 염색질 면역침전 분석

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

A Method to Study de novo Formation of Chromatin Domains

The organization and structure of chromatin domains are unique to individual cell lineages. Their misregulation might lead to a loss in cellular identity and/or disease. Despite tremendous efforts, our understanding of the formation and propagation of chromatin domains is still limited. Chromatin domains have been studied under steady-state conditions, which are not conducive to following the initial events during their establishment. Here, we present a method to inducibly reconstruct chromatin domains and follow their re-formation as a function of time. Although, first applied to the case of PRC2-mediated repressive chromatin domain formation, it could be easily adapted to other chromatin domains. The modification of and/or the combination of this method with genomics and imaging technologies will provide invaluable tools to study the establishment of chromatin domains in great detail. We believe that this method will revolutionize our understanding of how chromatin domains form and interact with each other.

A Method to Study de novo Formation of Chromatin Domains

This method is designed to follow formation of PRC2-mediated chromatin domains in cell lines, and the method can be adapted to many other systems.

크로마틴 도메인의 드 노보 형성을 연구하는 방법

The organization and structure of chromatin domains are unique to individual cell lineages. Their misregulation might lead to a loss in cellular identity ...

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription factors, histone modifications, and other DNA-associated proteins. ChIP-seq data can also be used to find differential binding of transcription factors in different environmental conditions or cell types. Initially, ChIP was performed through hybridization on a microarray (ChIP-chip); however, ChIP-seq has become the preferred method through technological advancements, decreasing financial barriers to sequencing, and massive amounts of high-quality data output. Techniques of performing ChIP-seq with bacterial biofilms, a major source of persistent and chronic infections, are described in this protocol. ChIP-seq is performed on Salmonella enterica serovar Typhimurium biofilm and planktonic cells, targeting the master biofilm regulator, CsgD, to determine differential binding in the two cell types. Here, we demonstrate the appropriate amount of biofilm to harvest, normalizing to a planktonic control sample, homogenizing biofilm for cross-linker access, and performing routine ChIP-seq steps to obtain high quality sequencing results.

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a method used to establish interactions between transcription factors and the genomic sequences they control. This protocol outlines techniques for performing ChIP-seq with bacterial biofilms, using Salmonella enterica serovar Typhimurium bacterial biofilm as an example.

크로마틴 면역침전 및 고처리량 시퀀싱(ChIP-seq)을 이용한 살모넬라 바이오필름의 CsgD 규제 목표 발견

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...