Die Autoren danken Jan Appel für seine hervorragende technische Unterstützung bei der Schaffung dieses Protokolls. Die Arbeit im Labor Rada-Iglesias stützt sich auf CMMC intramuralen Finanzierung, DFG Research Grants (RA 2547/1-1, RA 2547/2-1 und TE 1007/3-1), Gruppe der UoC fortgeschrittene Forscher Grant und CECAD Grant.

<ol>
	<li>Jenuwein, T., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translating+the+histone+code.">Translating the histone code.</a> Science. 293 (5532), 1074-1080 (2001).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifications+and+their+function.">Chromatin modifications and their function.</a> Cell. 128 (4), 693-705 (2007).</li><li>Wang, Z., Schones, D. E., Zhao, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+epigenomes.">Characterization of human epigenomes.</a> Curr Opin. Genet Dev. 19 (2), 127-134 (2009).</li><li>ENCODE Project Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+encyclopedia+of+DNA+elements+in+the+human+genome.">An integrated encyclopedia of DNA elements in the human genome.</a> Nature. 489 (7414), 57-74 (2012).</li><li>Roadmap Epigenomics Consortium. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+111+reference+human+epigenomes.">Integrative analysis of 111 reference human epigenomes.</a> Nature. 518 (7539), 317-330 (2015).</li><li>Heintzman, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+modifications+at+human+enhancers+reflect+global+cell-type-specific+gene+expression.">Histone modifications at human enhancers reflect global cell-type-specific gene expression.</a> Nature. 459 (7243), 108-112 (2009).</li><li>Rada-Iglesias, A., Bajpai, R., Swigut, T., Brugmann, S. A., Flynn, R. A., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+unique+chromatin+signature+uncovers+early+developmental+enhancers+in+humans.">A unique chromatin signature uncovers early developmental enhancers in humans.</a> Nature. 470 (7333), 279-283 (2011).</li><li>Creyghton, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+H3K27ac+separates+active+from+poised+enhancers+and+predicts+developmental+state.">Histone H3K27ac separates active from poised enhancers and predicts developmental state.</a> Proc Nat Acad Sci USA. 107 (50), 21931-21936 (2010).</li><li>Benayoun, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K4me3+breadth+is+linked+to+cell+identity+and+transcriptional+consistency.">H3K4me3 breadth is linked to cell identity and transcriptional consistency.</a> Cell. 158 (3), 673-688 (2014).</li><li>Rehimi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenomics-Based+Identification+of+Major+Cell+Identity+Regulators+within+Heterogeneous+Cell+Populations.">Epigenomics-Based Identification of Major Cell Identity Regulators within Heterogeneous Cell Populations.</a> Cell Rep. 17 (11), 3062-3076 (2016).</li><li>Whyte, W. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Master+transcription+factors+and+mediator+establish+super-enhancers+at+key+cell+identity+genes.">Master transcription factors and mediator establish super-enhancers at key cell identity genes.</a> Cell. 153 (2), 307-319 (2013).</li><li>Valouev, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+transcription+factor+binding+sites+based+on+ChIP-Seq+data.">Genome-wide analysis of transcription factor binding sites based on ChIP-Seq data.</a> Nat Methods. 5 (9), 829-834 (2008).</li><li>Dahl, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+histone+H3K4me3+domains+in+mouse+oocytes+modulate+maternal-to-zygotic+transition.">Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-zygotic transition.</a> Nature. 537 (7621), 548-552 (2016).</li><li>Rotem, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+ChIP-seq+reveals+cell+subpopulations+defined+by+chromatin+state.">Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state.</a> Nat Biotech. 33 (11), 1165-1172 (2015).</li><li>Schmidl, C., Rendeiro, A. F., Sheffield, N. C., Bock, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPmentation:+fast,+robust,+low-input+ChIP-seq+for+histones+and+transcription+factors.">ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors.</a> Nat Methods. 12 (10), 963-965 (2015).</li><li>Zhang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allelic+reprogramming+of+the+histone+modification+H3K4me3+in+early+mammalian+development.">Allelic reprogramming of the histone modification H3K4me3 in early mammalian development.</a> Nature. 537 (7621), 553-557 (2016).</li><li>Hamburger, V., Hamilton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+series+of+normal+stages+in+the+development+of+the+chick+embryo.">A series of normal stages in the development of the chick embryo.</a> Dev Dynam. 195 (4), 231-272 (1951).</li><li>Ho, J. W. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+metazoan+chromatin+organization.">Comparative analysis of metazoan chromatin organization.</a> Nature. 512 (7515), 449-452 (2014).</li><li>Calo, E., Wysocka, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+enhancer+chromatin:+what,+how,+and+why?.">Modification of enhancer chromatin: what, how, and why?.</a> Mol Cell. 49 (5), 825-837 (2013).</li><li>Spitz, F., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factors:+from+enhancer+binding+to+developmental+control.">Transcription factors: from enhancer binding to developmental control.</a> Nat Rev Genetics. 13 (9), 613-626 (2012).</li></ol>

Die Autoren müssen keine finanzielle Interessenkonflikte offen gelegt werden.

Epigenomischen Profilierung der Histon-Modifikation mit ChIP-Seq kann verwendet werden, zur Verbesserung der funktionellen Annotations vertebrate Genom in verschiedenen zellulären Kontexten4,5,18. Diese epigenomischen-Profile eingesetzt werden, unter anderem um zu identifizieren, Enhancer-Elemente, um die rechtliche Definition des Enhancer (d. h. aktiv, grundiert, oder bereit) und großen Zelle Identität Regulierungsbehörden in verschiedenen biologischen zu definieren oder pathologischen zusammenhängen (z. B. breite H3K4me3 Promotor Domains und Super-Enhancer)6,7,9,10,11,19. Jedoch aufgrund der inhärenten Beschränkungen des ChIP-Tests, die Millionen von Zellen in der Regel erfordert, sortiert die meisten Histon-Modifikation Profile in in-vitro- Zell-Linien generiert wurden und Zelltypen, die sein können in Vivo in großen Mengen 4. zuletzt mehrere ChIP-Seq-Protokolle sind beschrieben worden, die kompatibel mit extrem niedrigen Zellzahlen, so dramatisch erweitern das Spektrum an Zelltypen und Gewebe in die epigenomischen Profile, im Prinzip kann generiert13 ,14,15,16. Dieser neue ChIP-Seq-Protokolle jedes Vertrauen auf bestimmte ad-hoc- Bibliothek Vorbereitung Methoden, die, zumindest in einigen Fällen Wunschausrüstung und/oder Reagenzien14,15,16.
Hier beschreiben wir eine ChIP-Protokoll, die funktioniert mit niedrigen bis mittleren Zellzahlen (5 x 104 - 5 x 105 Zellen) in Vivo aus verschiedenen embryonalen Geweben10gewonnen. Um die Empfindlichkeit von unseren ChIP-Assays zu erhöhen, haben wir mehrere Schritte, die üblicherweise bei ChIP, wie sequenzielle Zelle und nukleare lyse, was zu einem fortschreitenden Verlust des wertvollen Materials führen kann eliminiert. So nach Vernetzung, Proben werden mit einem einzigen Lyse Puffer behandelt und sind anschließend zur Minimierung von Probenverlust beschallt. Wichtig ist, ist unser ChIP-Protokoll kompatibel mit qPCR Analyse, so dass die epigenomischen-Analyse der ausgewählten Loci von Interesse. Darüber hinaus kann unsere ChIP-Protokoll mit standard-ChIP-Seq Bibliothek Zubereitungsmethoden, somit als potenziell nützlich, um die meisten Labors mit Zugang zu Next Generation Sequencing Technologie kombiniert werden.
ChIP und ChIP-Seq-Protokolle können nicht nur die verbindliche Profile von Histon-Modifikationen zu untersuchen, sondern auch um die Bindungsstellen der andere wichtigen transkriptionellen Regulatoren, wie z. B. Transkriptionsfaktoren und Co-Aktivatoren (z. B. aufzudecken verwendet werden P300 und CBP)20. In der Regel erfordern ChIPs (und ChIP-Seq) für Transkriptionsfaktoren und Co-Aktivatoren, die nicht so reichlich wie Histone sind, erheblich mehr Ausgangsmaterial als ChIPs für Histon Mark. So, das beschriebene Protokoll funktioniert möglicherweise nicht unbedingt für die meisten Transkriptionsfaktoren oder Co-Aktivatoren, wenn die Anzahl der Start-Zellen ist deutlich erhöht (z. B. 5 x 105 - 5 x 106 Zellen) und/oder hochspezifisch und effiziente Antikörper sind verfügbar. Dennoch mit weiteren Optimierung und die ständig besser werdenden Bibliothek Zubereitungsmethoden erwarten wir, dass ChIP-Seq von begrenzten Zellmaterial machbar für die meisten regulatorischen Proteinen werden.
Obwohl unsere ChIP und ChIP-Seq-Protokolle für eine Vielzahl von Histon-Modifikationen und embryonalen Gewebe umfassend validiert wurden, möchten wir einige wichtige Schritte zu markieren, die wir zur Erzeugung von qualitativ hochwertigen epigenomischen Profile wesentlich halte. Erstens müssen die embryonalen Proben frisch unter Bedingungen isoliert werden, das Chromatin Integrität nicht beeinträchtigen. Dazu gehören Sezierungen unter kalten Bedingungen oder Blitz-Einfrieren gepoolten Proben durchführen, bis ausreichend Material angesammelt ist. Ein weiterer wichtiger Schritt ist die Beschallung, die präzise optimiert werden, um qualitativ hochwertige ChIPs durchführen muss. Optimale Beschallung Bedingungen variieren je nach Gewebe, häufig die Menge des Gewebes oder der Sonikator verwendet wird. Nicht zuletzt setzt ein erfolgreiche ChIP letztlich auf die Verfügbarkeit von spezifischen und ChIP-kompatiblen Antikörper gegen die Proteine des Interesses.

Post-translationalen Modifikationen der Histone sind verschiedene Chromatin-abhängige Prozesse, einschließlich Transkription, Replikation und DNA-Reparatur1,2,3direkt beteiligt. Darüber hinaus verschiedene Histon Änderungen zeigen positive (z. B. H3K4me3 und H3K27ac) oder negativ (z. B. H3K9me3 und H3K27me3) Korrelationen mit Genexpression und kann im großen und ganzen definiert als aktivierende oder repressive Histon markiert, bzw.2,3. Infolgedessen sind globale Histon Änderung Karten, auch bezeichnet als epigenomischen Karten als mächtiges und universelles Werkzeug funktionell vertebrate Genom4,5Anmerkungen zu entstanden. Z. B. distalen regulatorische Sequenzen wie Enhancer identifiziert werden können abhängig vom Vorhandensein von spezifischen Chromatin Unterschriften (z. B. aktive Enhancer: H3K4me1 und H3K27ac), die von proximalen Promoter-Regionen unterscheiden (z.B. aktive Promotoren: H3K4me3)6,7,8. Auf der anderen Seite befinden sich Gene mit großen Zelle Identität regulatorische Funktionen in der Regel mit breiten Chromatin Domains mit H3K4me3 oder H3K27me3, abhängig vom Status der zugrunde liegenden Gene transcriptionally aktiv oder inaktiv gekennzeichnet bzw.9 ,10. Ebenso scheint der Ausdruck der großen Zelle Identität Gene häufig von mehreren und räumlich gesteuert werden gruppierten Enhancer (d. h. Super-Enhancer), die als breite H3K27ac versehenen Domänen11identifiziert werden können.
Derzeit entstehen Histon Änderung Karten mit ChIP-Seq-Technologie, bietet im Vergleich zu bisherigen Ansätzen wie ChIP-Chip (ChIP mit Microarrays gekoppelt) höheren Auflösung, weniger Artefakte, weniger Lärm, mehr Reichweite und geringer kostet12. Dennoch hat die Generation der epigenomischen-Karten mit ChIP-Seq-Technologie seiner inhärenten Einschränkungen, meist verbunden mit der Fähigkeit, erfolgreich ChIP in den Proben von Interesse zu erfüllen. Traditionellen ChIP Protokolle benötigt in der Regel Millionen von Zellen, welche Grenzen der Anwendbarkeit dieser Methode zur in-vitro- Zelle Zeilen oder Zellen, die isoliert in Vivo (z. B. Blutzellen) problemlos. In den letzten Jahren wurden eine Reihe von modifizierten ChIP-Protokollen kompatibel mit niedrigen Zellzahlen beschrieben13,14,15,16. Aber diese Protokolle sind speziell mit Next Generation Sequencing (z.B. ChIP-Seq) gekoppelt werden, und in der Regel verwenden sie ad-hoc- Bibliothek Vorbereitung Methoden13,14, 15 , 16.
Wir beschrieben hier ein ChIP-Protokoll, das verwendet werden kann, zu untersuchen, Histon-Änderung-Profile mit niedrigen bis mittleren Zellzahlen (5 x 104 - 5 x 105 Zellen) an beiden ausgewählten Loci (z.B. ChIP-qPCR) oder Global (d. h. ChIP-Seq) (Abbildung 1). Wenn ChIP-Seq-Technologie gekoppelt, kann unser ChIP-Protokoll zusammen mit Standardbibliothek Zubereitungsmethoden, wodurch es allgemein zugänglich, viele Labors10verwendet werden. Dieses Protokoll wurde verwendet, um mehrere Histon-Marken untersuchen (z. B. H3K4me3, H3K27me3 und H3K27ac) in verschiedenen Huhn embryonalen Geweben (z. B. spinale Neuralrohr (SNT), frontonasalen Protuberanzen und Epiblast). Allerdings erwarten wir, dass es breit anwendbar auf andere Organismen sein sollte, in denen biologisch bzw. klinisch relevante Proben nur in geringen Mengen erreicht werden können.

<table>
	<tbody>
		<tr>
			<td>Reagent</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BSA powder</td>
			<td>Carl Roth</td>
			<td>3737.3</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Saline buffer (PBS)</td>
			<td>Sigma Aldrich</td>
			<td>D8537</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCL pH8.0</td>
			<td>Sigma Aldrich</td>
			<td>T1503</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Carl Roth</td>
			<td>3957.2</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Carl Roth</td>
			<td>8043.2</td>
			<td></td>
		</tr>
		<tr>
			<td>EGTA</td>
			<td>Carl Roth</td>
			<td>3054.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Na-Deoxycholate</td>
			<td>Sigma Aldrich</td>
			<td>D6750-24</td>
			<td></td>
		</tr>
		<tr>
			<td>N-lauroylsarcosine</td>
			<td>Sigma Aldrich</td>
			<td>61743-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Applichem</td>
			<td>A3724,0250</td>
			<td></td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Carl Roth</td>
			<td>3739.2</td>
			<td></td>
		</tr>
		<tr>
			<td>NP-40</td>
			<td>Sigma Aldrich</td>
			<td>I3021-100ml</td>
			<td></td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Carl Roth</td>
			<td>1833</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein G/magnetic beads</td>
			<td>Invitrogen</td>
			<td>1004D</td>
			<td></td>
		</tr>
		<tr>
			<td>37% Formaldehyde</td>
			<td>Sigma Aldrich</td>
			<td>252549-1L</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>RNase</td>
			<td>Peqlab</td>
			<td>12-RA-03</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Sigma Aldrich</td>
			<td>46.35 E</td>
			<td></td>
		</tr>
		<tr>
			<td>Na-butyrate</td>
			<td>Sigma Aldrich</td>
			<td>SLB2659V</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase inhibitor</td>
			<td>Roche</td>
			<td>5892791001</td>
			<td></td>
		</tr>
		<tr>
			<td>SYBRgreen Mix</td>
			<td>biozym</td>
			<td>617004</td>
			<td></td>
		</tr>
		<tr>
			<td>dH2O</td>
			<td>Sigma Aldrich</td>
			<td>W4502</td>
			<td></td>
		</tr>
		<tr>
			<td>1Kb ladder</td>
			<td>Thermofisher</td>
			<td>SM1333</td>
			<td></td>
		</tr>
		<tr>
			<td>Orange G</td>
			<td>Sigma Alrich</td>
			<td>03756-25</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Invitrogen</td>
			<td>16500-500</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X)</td>
			<td>Gibco</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Octylphenol Ethoxylate (Triton X 100)</td>
			<td>Roth</td>
			<td>3051.4</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (Dulbecco&#180;s Modified Eagle Medium)</td>
			<td>Gibco</td>
			<td>31331-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel loading tips Multiflex</td>
			<td>A.Hartenstein</td>
			<td>GS21</td>
			<td></td>
		</tr>
		<tr>
			<td>qPCR Plates</td>
			<td>Sarstedt</td>
			<td>721,985,202</td>
			<td></td>
		</tr>
		<tr>
			<td>384 well</td>
			<td>Sarstedt</td>
			<td>721,985,202</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 mL tubes</td>
			<td>Sarstedt</td>
			<td>72,706</td>
			<td></td>
		</tr>
		<tr>
			<td>100-1000&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,762,211</td>
			<td></td>
		</tr>
		<tr>
			<td>2-20&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,760,213</td>
			<td></td>
		</tr>
		<tr>
			<td>2-200&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>70,760,211</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5-10&#181;l Filter tips</td>
			<td>Sarstedt</td>
			<td>701,116,210</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K27me3 antibody</td>
			<td>Active Motif</td>
			<td>39155</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K27ac antibody</td>
			<td>Active Motif</td>
			<td>39133</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K4me3 antibody</td>
			<td>Active Motif</td>
			<td>39159</td>
			<td></td>
		</tr>
		<tr>
			<td>H3K4me2 antibody</td>
			<td>Active Motif</td>
			<td>39141</td>
			<td></td>
		</tr>
		<tr>
			<td>End Repair Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Paramagnetic beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Resuspension buffer</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>A-Tailing Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA Adapter Indexes</td>
			<td>Illumina</td>
			<td>RS-122-2101</td>
			<td></td>
		</tr>
		<tr>
			<td>Stop Ligation Buffer</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Primer Cocktail</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Enhanced PCR Mix</td>
			<td>Illumina</td>
			<td>FC-121-4001</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA ladder</td>
			<td>Agilent</td>
			<td>5067-5582</td>
			<td></td>
		</tr>
		<tr>
			<td>Elution Buffer</td>
			<td>Agilent</td>
			<td>19086</td>
			<td></td>
		</tr>
		<tr>
			<td>Sample Buffer</td>
			<td>Agilent</td>
			<td>5067-5582</td>
			<td></td>
		</tr>
		<tr>
			<td>Library Quantification Kit</td>
			<td>Kapa Biosystems</td>
			<td>KK4835 &#8211; 07960204001</td>
			<td></td>
		</tr>
		<tr>
			<td>Fertile chicken white eggs</td>
			<td>LSL Rhein Main</td>
			<td>KN: 15968</td>
			<td></td>
		</tr>
		<tr>
			<td>Needle (Neoject)</td>
			<td>A.Hartenstein</td>
			<td>10001</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe (Ecoject 10ml)</td>
			<td>Dispomed witt oHG</td>
			<td>21010</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Hermle</td>
			<td>Z 216 MK</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermoshaker</td>
			<td>ITABIS</td>
			<td>MKR13</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Active Motive</td>
			<td>EpiShear probe sonicator</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Diagenode</td>
			<td>Bioruptor Plus</td>
			<td></td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Stuart</td>
			<td>SB3</td>
			<td></td>
		</tr>
		<tr>
			<td>Variable volume (5&#8211;1,000 &#956;l) pipettes</td>
			<td>Eppendorf</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Timer</td>
			<td>Sigma</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic holder</td>
			<td>Thermo Fisher</td>
			<td>DynaMag-2 12321D</td>
			<td></td>
		</tr>
		<tr>
			<td>Table spinner</td>
			<td>Heathrow Scientific</td>
			<td>Sprout</td>
			<td></td>
		</tr>
		<tr>
			<td>Mixer</td>
			<td>LMS</td>
			<td>VTX 3000L</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Cycler</td>
			<td>Roche</td>
			<td>Light Cycler; Serial Nr.5662</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Cycler</td>
			<td>Applied Biosystems</td>
			<td>Gene Amp PCR System 9700</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA and RNA quality control system</td>
			<td>Agilent</td>
			<td>Agilent 4200 TapeStation System</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>Dumont</td>
			<td>5-Inox-H</td>
			<td></td>
		</tr>
		<tr>
			<td>Perforated spoon</td>
			<td>World precision instruments</td>
			<td>501997</td>
			<td></td>
		</tr>
	</tbody>
</table>

chromatin immunoprecipitation (chip) protocol for low-abundance embryonic samples

Chromatin Immunopräzipitation (ChIP) ist eine weit verbreitete Technik zur Kartierung der Lokalisierung von posttranslational modifizierte Histone, Histon-Varianten, Transkriptionsfaktoren oder Chromatin-modifizierende Enzyme, die an einen bestimmten Ort oder auf einer genomweiten Skala. Die Kombination von ChIP-Assays mit Next Generation Sequencing (z.B. ChIP-Seq) ist ein leistungsfähiger Ansatz weltweit genregulatorischer Netzwerke aufzudecken und die funktionale Anmerkung von Genomen, insbesondere von nicht-kodierenden regulatorischen Sequenzen zu verbessern. ChIP-Protokolle erfordern normalerweise große Mengen von Zellmaterial, damit die Anwendbarkeit dieser Methode zu untersuchen, seltene Zelltypen oder kleine Gewebebiopsien entgegensteht. Um die ChIP-Assay kompatibel mit der Menge des biologischen Materials vornehmen, die in der Regel in Vivo in der frühen Embryogenese vertebrate gewonnen werden können, beschreiben wir hier eine vereinfachte ChIP-Protokoll, in dem die Anzahl der Schritte erforderlich, um abzuschließen, die Assay wurden reduziert, um die Probenverlust zu minimieren. Dieses ChIP-Protokoll wird erfolgreich eingesetzt, um verschiedene Histon-Modifikationen in verschiedenen embryonalen und adulten Maus Geweben mit niedrigen bis mittleren Zellzahlen (5 x 104 - 5 x 105 Zellen) zu untersuchen. Wichtig ist, dieses Protokolls ist kompatibel mit ChIP-Seq-Technologie mit Standardbibliothek Zubereitungsmethoden, wodurch globale epigenomischen-Karten von hochaktuellen embryonalen Gewebe.

Um die Leistung unserer ChIP-Protokoll zu veranschaulichen, haben wir ChIP-Seq-Experimente mit gepoolten SNT Abschnitte von HH19 Hühnerembryos, maxillaris Protuberanzen HH22 Embryonen, und Bühne-HH3 Hühnerembryos zu untersuchen, die verbindliche Profile von Huhn verschiedenen Histon-Modifikationen (z. B. H3K4me2, H3K27ac, H3K4me3 und H3K27me3). Das gewonnene ChIP DNAs waren wurde die Beschallung Effizienz durch Agarose-Gelelektrophorese der entsprechenden Eingabe DNAs (Abbildung 3) bewertet. Dann, ChIP und Eingabe DNAs für ChIP-qPCR Analyse dienten um die Bereicherungen an Loci voraussichtlich entweder gebunden oder ungebunden durch die untersuchten Histon-Modifikationen (Abb. 4A) zu messen. In dem Beispiel in Abbildung 4A, H3K27me3 und H3K4me3 Bereicherung wurden Ebenen in HH19 SNT Abschnitten von ChIP-qPCR rund um die Promoter-Regionen von SOX17 und SOX2, zwei Gene, die inaktiven und aktiven in der SNT bzw. bewertet. Wie erwartet, war SOX2 Veranstalter stark geprägt durch H3K4me3 aber nicht durch H3K27me3, während der SOX17 Veranstalter das entgegengesetzte Muster (Abb. 4A zeigte). Durch die Auswertung ein paar Loci, ist es möglich, die Qualität des Chips zu schätzen, ohne viel DNA-Material für die nachgelagerten ChIP-Seq-Analyse. Sobald die Qualität der ChIPs bestätigt wurde, wurden ChIP-Seq-Bibliotheken vorbereitet und sequenziert. Repräsentative Loci sind für jede der untersuchten Huhn embryonalen Gewebe dargestellt: (i) Profile für H3K27me3 und H3K4me3 in die SNT HH19 Küken Embryonen um PAX7 (Abbildung 4 b); (Ii) Profile für H3K4me2 und H3K27ac in den Oberkiefer Protuberanzen HH22 Hühnerembryos um SNAI1 (Abbildung 4); und (Iii) Profil für H3K27me3 in Hühnerembryos HH3-Etappe rund um den TBX3/TBX5 Locus (Abbildung 4). Diese ChIP-Seq-Experimente machen deutlich, dass unsere ChIP-Protokoll verwendet werden kann, epigenomischen Profile aus begrenzten Mengen von biologischem Material in einer Vielzahl von embryonalen Gewebe zu generieren.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56186/56186fig1.jpg"> 
Abbildung 1: Schematische Übersicht des ChIP-Protokolls für Low-Fülle embryonalen Proben isoliert von Hühnerembryos. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56186/56186fig2.jpg"> 
Abbildung 2: kurze Übersicht des Protokolls Mikrodissektion SNT. Die transversale SNT-Segment ist brachial Ebene der Embryo HH19 Huhn abgeschnitten. Trypsin Nachbehandlung nicht neuronalem Gewebe mechanisch mit einer Pinzette entfernt. Nicht, Chorda; SNT, spinale Neuralrohr; und ja, Somiten. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56186/56186fig3.jpg"> 
Abbildung 3: Beispiel für optimale Beschallung. Eine Huhn SNT HH19 Probe war für 11 Zyklen, mit 30 s ein und 45 s OFF Impulse auf "hoch" Amplitude mit einem Sonikator beschallt. Die Querverbindungen wurden rückgängig gemacht und die gereinigte DNA wurde auf einem 1,5 % Agarosegel gelöst. Die optimale Fragmentgröße wird beobachtet, nach 11 Zyklen von 200-500 BP. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56186/56186fig4.jpg"> 
Abbildung 4: Vertreter Beispiele für ChIP-Analyse von ChIP-qPCR oder ChIP-seq. (A) H3K27me3 (links) und H3K4me3 (rechts) Ebenen in den angegebenen Regionen waren gemessen an ChIP-qPCR-Analyse mit SNT Abschnitte isoliert von HH19 Küken Embryonen durchgeführt. SOX2 Promotor-Region ist in die SNT tätig und zeichnet sich somit durch H3K4me3 aber nicht durch H3K27me3; SOX17-Promotor-Region ist in die SNT inaktiv und wird daher in H3K27me3 aber nicht in H3K4me3 bereichert; Chr6 Neg ist eine intergenetischer Region in Huhn Chromosom 6 und dient als Negativkontrolle. Fehlerbalken repräsentieren die Standardabweichung von drei technischen repliziert. (B) ChIP-Seq (H3K27me3 in Magenta, H3K4me3 in blau und rot-Eingang) Profile von SNTs HH14 Küken Embryos sind die PAX7 Locus herumgeführt. (C) ChIP-Seq (H3K4me2 in Orange, H3K27ac grün und Eingabe in rot) Profile aus dem Oberkiefer Protuberanzen HH22 Küken Embryonen sind die SNAI1 Locus herumgeführt. (D) ChIP-Seq (H3K27me3 in Magenta) und Eingang in rot Profile aus HH3 Küken Embryonen sind die TBX3/TBX5 Locus herumgeführt. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56186/56186fig5.jpg"> 
Abbildung 5: Beispiel für ChIP-Seq Bibliothek Validierung mithilfe von automatisierten RNA-Qualitätssicherungssystems. Der gleiche ChIP-Seq-Bibliotheken wurden analysiert mit dem automatisierten RNA-Qualitätskontrolle-System vor (A) und nach (B) Grundierung Dimer Bereinigung. Primer-Dimere können als schwach ~ 135 bp Band in (A) gesehen werden. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56186/56186fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Schritte</td>
			<td>Problem</td>
			<td>Mögliche Ursache</td>
			<td>Lösung</td>
		</tr>
		<tr>
			<td>1,2,3,4 5 und 11</td>
			<td>Low-ChIP Signal-Rausch-Verhältnis nach ChIP-qPCR und/oder ChIP-seq</td>
			<td>Gewebe-Qualität beeinträchtigt.</td>
			<td>Durchführen Sie Mikro-Dissektionen bei kaltem Wetter; Ansonsten könnte Chromatin Integrität gefährdet werden.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Probenverlust nach Zentrifugation querverbunden Proben.</td>
			<td>DMEM Medium mit 10-20 % Serum oder wiederholte Zentrifugationsschritt verwenden und Zeit, 10 min zu erhöhen.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Vernetzung von Dauer.</td>
			<td>Optimieren Sie die Vernetzung Zeit. Verstärkte Vernetzung Zeiten erleichtern können die Erkennung von bestimmten Proteinen, wie Co-Aktivatoren und Co Repressoren, die nicht direkt an der DNA binden.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Probenverlust durch mehrere Wäschen mit PBS-Puffer.</td>
			<td>Reduzieren Sie die Anzahl der Wäschen; Zentrifugation Schritte können bei 1.500 x g wiederholt werden.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Suboptimale Beschallung führt entweder zu lang oder zu kurz DNA-Größen.</td>
			<td>Führen Sie eine Zeit Kurs Experiment zur Beschallung Bedingungen zu optimieren. Optimale Fragment Größen von 200 bis 500 bp</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Antikörper für ChIP nicht geeignet.</td>
			<td>Verwenden Sie eine andere Antikörper gegen das körpereigene Protein oder einen Antikörper gegen ein Tag hinzugefügt, um eine exogen exprimierten Proteine (z. B. Fahne, HA).</td>
		</tr>
		<tr>
			<td>12</td>
			<td>Geringe oder keine Signale in qPCR, sogar für die Eingabe DNA</td>
			<td>Suboptimale Primer</td>
			<td>Überprüfen Sie die Grundierung Effizienz und Spezifität; Entwerfen Sie neue Primer.</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td>Unzureichende Menge an DNA</td>
			<td>Nicht genügend Ausgangsmaterial. Erhöhen Sie die Menge an DNA pro qPCR-Reaktion verwendet.</td>
		</tr>
	</tbody>
</table>
-Seite "1" = >Tabelle 1: Handbuch für die verschiedenen Schritte im Protokoll zur Problembehandlung.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequenz</td>
		</tr>
		<tr>
			<td>SOX2-F</td>
			<td>CCTTGCTGGGAGTACGACAT</td>
		</tr>
		<tr>
			<td>SOX2-R</td>
			<td>GCCCTGCAGTACAACTCCAT</td>
		</tr>
		<tr>
			<td>SOX17-F</td>
			<td>CCCTGAACTGTCATGTGTGG</td>
		</tr>
		<tr>
			<td>SOX17-R</td>
			<td>CAAACAGTTGCCTTTGAGCA</td>
		</tr>
		<tr>
			<td>Chr6-Neg-F</td>
			<td>CCGTCAATCTCTGCTTGTGA</td>
		</tr>
		<tr>
			<td>Chr6-Neg-R</td>
			<td>TGGAATCTGCTTGTCACTGC</td>
		</tr>
	</tbody>
</table>
Tabelle 2: Primer-Sequenzen für ChIP-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Vorinkubation</td>
		</tr>
		<tr>
			<td>Temperatur</td>
			<td colspan="2">Zeit</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">5 min</td>
		</tr>
		<tr>
			<td colspan="3">Verstärkung</td>
		</tr>
		<tr>
			<td>Temperatur</td>
			<td colspan="2">Zeit</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td>10 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 ° C</td>
			<td>10 s</td>
			<td>45</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td>10 s</td>
			<td>Zyklen</td>
		</tr>
		<tr>
			<td colspan="3">Schmelzenden Kurve</td>
		</tr>
		<tr>
			<td>Temperatur</td>
			<td colspan="2">Zeit</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td>65 ° C</td>
			<td colspan="2">1 min</td>
		</tr>
		<tr>
			<td colspan="3">Kühlung</td>
		</tr>
		<tr>
			<td>40 ° C</td>
			<td colspan="2">30 s</td>
		</tr>
	</tbody>
</table>
Tabelle 3: PCR-Zustände für ChIP-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Anfängliche Denaturierung</td>
		</tr>
		<tr>
			<td>Temperatur</td>
			<td colspan="2">Zeit</td>
		</tr>
		<tr>
			<td>95 ° C</td>
			<td colspan="2">3 min</td>
		</tr>
		<tr>
			<td colspan="3">Verstärkung</td>
		</tr>
		<tr>
			<td>Temperatur</td>
			<td colspan="2">Zeit</td>
		</tr>
		<tr>
			<td>98 ° C</td>
			<td>20 s</td>
			<td></td>
		</tr>
		<tr>
			<td>60 ° C</td>
			<td>15 s</td>
			<td>15</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td>30 s</td>
			<td>Zyklen</td>
		</tr>
		<tr>
			<td colspan="3">Letzte Erweiterung</td>
		</tr>
		<tr>
			<td>Temperatur</td>
			<td colspan="2">Zeit</td>
		</tr>
		<tr>
			<td>72 ° C</td>
			<td colspan="2">5 s</td>
		</tr>
		<tr>
			<td colspan="3">Kühlung</td>
		</tr>
		<tr>
			<td>4 ° C</td>
			<td colspan="2">halten</td>
		</tr>
	</tbody>
</table>
Tabelle 4: PCR-Bedingungen für die Amplifikation von DNA-Fragmenten bei ChIP-Seq-Bibliothek-Vorbereitung.

Watch this Scientific Journal Video about Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples at JoVE.com

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Hier beschreiben wir eine Chromatin Immunopräzipitation (ChIP) und ChIP-Seq Bibliothek Vorbereitung Protokoll zum globalen epigenomischen Profile aus Low-Fülle Huhn embryonalen Proben zu generieren.

Chromatin Immunopräzipitation (ChIP) Protokoll für Low-Fülle embryonalen Proben

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

chromatin-immunoprecipitation-chip-protocol-for-low-abundance

Nanyang Technological University

Research

JoVE Journal

Genetics

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

15.6K Aufrufe.  University of Cologne. Hier beschreiben wir eine Chromatin Immunopräzipitation (ChIP) und ChIP-Seq Bibliothek Vorbereitung Protokoll zum globalen epigenomischen Profile aus Low-Fülle Huhn embryonalen Proben zu generieren.

Serie: Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

Sequentielle Salz Extraktionen für die Analyse von Bulk-Chromatin bindenden Eigenschaften von Chromatin komplexe ändern

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Forschung

Genetik

Analysis of the c-KIT Ligand Promoter Using Chromatin Immunoprecipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. Therefore, DNA-protein interactions regulate multiple physiological, pathophysiological, and biological functions, such as cell differentiation, cell proliferation, cell cycle control, chromosome stability, epigenetic gene regulation, and cell transformation. In eukaryotic cells, the DNA interacts with histone and nonhistone proteins and is condensed into chromatin. Several technical tools can be used to analyze DNA-protein interactions, such as the Electrophoresis (gel) Mobility Shift Assay (EMSA) and DNase I footprinting. However, these techniques analyze the protein-DNA interaction in vitro, not within the cellular context. Chromatin immunoprecipitation (ChIP) is a technique that captures proteins at their specific DNA binding sites, thereby allowing for the identification of DNA-protein interactions within their chromatin context. It is done by fixation&#160;of the DNA-protein interaction, followed by&#160;immunoprecipitation of the protein of interest. Subsequently, the genomic site that the protein was bound to is characterized. Here, we describe and discuss ChIP and demonstrate its analytical value for the identification of the Transforming Growth Factor-&#946; (TGF-&#946;)-induced binding of the transcription factor SMAD2 to SMAD Binding Elements (SBE) within the promoter region of the tyrosine-protein kinase Kit (c-KIT) receptor ligand Stem Cell Factor (SCF).

DNA-protein interactions are essential for multiple biological processes. During the evaluation of cellular functions, the analysis of DNA-protein interactions is indispensable for understanding gene regulation. Chromatin immunoprecipitation (ChIP) is a powerful tool to analyze such interactions in vivo.

Analyse des c-KIT-Liganden-Promotors unter Verwendung von Chromatin-Immunpräzipitation

Multiple cellular processes, including DNA replication and repair, DNA recombination, and gene expression, require interactions between proteins and DNA. ...

Chromatin Immunoprecipitation (ChIP) in Mouse T-cell Lines

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Chromatin Immunoprecipitation ChIP in Mouse T-cell Lines

This work describes a protocol for chromatin immunoprecipitation (ChIP) using a mature mouse T-cell line. This protocol is suitable to investigate the distribution of specific histone marks at specific promoter sites or genome-wide.

Chromatin-Immunpräzipitation (ChIP) in Maus-T-Zell-Linien

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

Erzeugung von nativen Chromatin Immunopräzipitation Sequenzierung Bibliotheken für Nukleosom Dichteanalyse

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

Chromatin Immunoprecipitation (ChIP) of Histone Modifications from Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes that add or remove these marks in response to signals received by the cell. These PTMS are key contributors to the regulation of processes such as gene expression control and DNA repair. Chromatin immunoprecipitation (chIP) has been an instrumental approach for dissecting the abundance and localization of many histone PTMs throughout the genome in response to diverse perturbations to the cell. Here, a versatile method for performing chIP of post-translationally modified histones from the budding yeast Saccharomyces cerevisiae (S. cerevisiae) is described. This method relies on crosslinking of proteins and DNA using formaldehyde treatment of yeast cultures, generation of yeast lysates by bead beating, solubilization of chromatin fragments by micrococcal nuclease, and immunoprecipitation of histone-DNA complexes. DNA associated with the histone mark of interest is purified and subjected to quantitative PCR analysis to evaluate its enrichment at multiple loci throughout the genome. Representative experiments probing the localization of the histone marks H3K4me2 and H4K16ac in wildtype and mutant yeast are discussed to demonstrate data analysis and interpretation. This method is suitable for a variety of histone PTMs and can be performed with different mutant strains or in the presence of diverse environmental stresses, making it an excellent tool for investigating changes in chromatin dynamics under different conditions.

Chromatin Immunoprecipitation ChIP of Histone Modifications from Saccharomyces cerevisiae

Here, we describe a protocol for chromatin immunoprecipitation of modified histones from the budding yeast Saccharomyces cerevisiae. Immunoprecipitated DNA is subsequently used for quantitative PCR to interrogate the abundance and localization of histone post-translational modifications throughout the genome.

Chromatin Immunopräzipitation (ChIP) Histon-Modifikationen von Saccharomyces cerevisiae

Histone post-translational modifications (PTMs), such as acetylation, methylation and phosphorylation, are dynamically regulated by a series of enzymes ...

CRISPR-Mediated Reorganization of Chromatin Loop Structure

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene expression, but whether looping is responsible for or a result of alterations in gene expression is still unknown. Until recently, how chromatin looping affects the regulation of gene activity and cellular function has been relatively ambiguous, and limitations in existing methods to manipulate these structures prevented in-depth exploration of these interactions. To resolve this uncertainty, we engineered a method for selective and reversible chromatin loop re-organization using CRISPR-dCas9 (CLOuD9). The dynamism of the CLOuD9 system has been demonstrated by successful localization of CLOuD9 constructs to target genomic loci to modulate local chromatin conformation. Importantly, the ability to reverse the induced contact and restore the endogenous chromatin conformation has also been confirmed. Modulation of gene expression with this method establishes the capacity to regulate cellular gene expression and underscores the great potential for applications of this technology in creating stable de novo chromatin loops that markedly affect gene expression in the contexts of cancer and development.

Chromatin looping plays a significant role in gene regulation; however, there have been no technological advances that allow for selective and reversible modification of chromatin loops. Here we describe a powerful system for chromatin loop re-organization using CRISPR-dCas9 (CLOuD9), demonstrated to selectively and reversibly modulate gene expression at targeted loci.

CRISPR-vermittelten Reorganisation der Chromatinstruktur mit Schleife

Recent studies have clearly shown that long-range, three-dimensional chromatin looping interactions play a significant role in the regulation of gene ...

Chromatin Immunoprecipitation of Murine Brown Adipose Tissue

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of a wide range of transcription factors (TFs) and cofactors mediating transcriptional activation or repression via changes in chromatin structure. Chromatin immunoprecipitation (ChIP) is a useful molecular biology approach for mapping histone modifications and profiling transcription factors/cofactors binding to DNA, thus providing a snapshot of the dynamic nuclear changes occurring during different biological processes.
To study transcriptional regulation in adipose tissue, samples derived from in vitro cell cultures of immortalized or primary cell lines are often favored in ChIP assays because of the abundance of starting material and reduced biological variability. However, these models represent a limited snapshot of the actual chromatin state in living organisms. Thus, there is a critical need for optimized protocols to perform ChIP on adipose tissue samples derived from animal models.
Here we describe a protocol for efficient ChIP-seq of both histone modifications and non-histone proteins in brown adipose tissue (BAT) isolated from a mouse. The protocol is optimized for investigating genome-wide localization of proteins of interest and epigenetic markers in the BAT, which is a morphologically and physiologically distinct tissue amongst fat depots.

Here we describe a protocol for efficient chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) of brown adipose tissue (BAT) isolated from a mouse. This protocol is suitable for both mapping histone modifications and investigating genome-wide localization of non-histone proteins of interest in vivo.

Chromatin Immunopräzipitation der murinen braunen Fettgewebe

Most cellular processes are regulated by transcriptional modulation of specific gene programs. Such modulation is achieved through the combined actions of ...

Chromatin Immunoprecipitation Assay Using Micrococcal Nucleases in Mammalian Cells

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene expression. The cellular transcriptional machinery and its chromatin modification proteins coordinate to regulate transcription. To analyze transcriptional regulation at the molecular level, several experimental methods such as electrophoretic mobility shift, transient reporter and chromatin immunoprecipitation (ChIP) assays are available. We describe a modified ChIP assay in detail in this article because of its advantages in directly showing histone modifications and the interactions between proteins and DNA in cells. One of the key steps in a successful ChIP assay is chromatin shearing. Although sonication is commonly used for shearing chromatin, it is difficult to identify reproducible conditions. Instead of shearing chromatin by sonication, we utilized enzymatic digestion with micrococcal nuclease (MNase) to obtain more reproducible results. In this article, we provide a straightforward ChIP assay protocol using MNase.

Chromatin immunoprecipitation (ChIP) is a powerful tool for understanding the molecular mechanisms of gene regulation. However, the method involves difficulties in obtaining reproducible chromatin fragmentation by mechanical shearing. Here, we provide an improved protocol for a ChIP assay using enzymatic digestion.

Chromatin Immunoprecipitation Assay mit Mikrokokken-Nukleasen in Säugetierzellen

To express cellular phenotypes in organisms, living cells execute gene expression accordingly, and transcriptional programs play a central role in gene ...

A Method to Study de novo Formation of Chromatin Domains

The organization and structure of chromatin domains are unique to individual cell lineages. Their misregulation might lead to a loss in cellular identity and/or disease. Despite tremendous efforts, our understanding of the formation and propagation of chromatin domains is still limited. Chromatin domains have been studied under steady-state conditions, which are not conducive to following the initial events during their establishment. Here, we present a method to inducibly reconstruct chromatin domains and follow their re-formation as a function of time. Although, first applied to the case of PRC2-mediated repressive chromatin domain formation, it could be easily adapted to other chromatin domains. The modification of and/or the combination of this method with genomics and imaging technologies will provide invaluable tools to study the establishment of chromatin domains in great detail. We believe that this method will revolutionize our understanding of how chromatin domains form and interact with each other.

A Method to Study de novo Formation of Chromatin Domains

This method is designed to follow formation of PRC2-mediated chromatin domains in cell lines, and the method can be adapted to many other systems.

Eine Methode zur Untersuchung der de novo Bildung von Chromatin-Domänen

The organization and structure of chromatin domains are unique to individual cell lineages. Their misregulation might lead to a loss in cellular identity ...

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing (ChIP-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription factors, histone modifications, and other DNA-associated proteins. ChIP-seq data can also be used to find differential binding of transcription factors in different environmental conditions or cell types. Initially, ChIP was performed through hybridization on a microarray (ChIP-chip); however, ChIP-seq has become the preferred method through technological advancements, decreasing financial barriers to sequencing, and massive amounts of high-quality data output. Techniques of performing ChIP-seq with bacterial biofilms, a major source of persistent and chronic infections, are described in this protocol. ChIP-seq is performed on Salmonella enterica serovar Typhimurium biofilm and planktonic cells, targeting the master biofilm regulator, CsgD, to determine differential binding in the two cell types. Here, we demonstrate the appropriate amount of biofilm to harvest, normalizing to a planktonic control sample, homogenizing biofilm for cross-linker access, and performing routine ChIP-seq steps to obtain high quality sequencing results.

Discovering CsgD Regulatory Targets in Salmonella Biofilm Using Chromatin Immunoprecipitation and High-Throughput Sequencing ChIP-seq

Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a method used to establish interactions between transcription factors and the genomic sequences they control. This protocol outlines techniques for performing ChIP-seq with bacterial biofilms, using Salmonella enterica serovar Typhimurium bacterial biofilm as an example.

Entdeckung von CsgD-Regulierungszielen im Salmonellen-Biofilm mit Chromatin-Immunpräzipitation und Hochdurchsatz-Sequenzierung (ChIP-seq)

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique that can be used to discover the regulatory targets of transcription ...