우리는 인정 하는 치 정 첸에서 학과의 의료 연구, 치 매 의료 센터 (타이난, 대만), 감염 및 국립 쳉 쿵 대학 실험실 동물 센터에서 지원에 마우스에 도움. 이 작품은 과학의 성직자에 의해 지원 하 고 기술 (대부분) CC를 (가장 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005)를 부여 합니다.

주의: EHEC O157:H7는 biosafety 수준 2 (BSL-2) 병원 체 질병 통제 및 예방 (CDC) biosafety 지시 (https://www.cdc.gov/)를 위한 센터에 따르면. 따라서, 모든 실험 절차 관련 된 EHEC BSL-2 시설에서 수행 되어야 합니다. 실험을 수행 하는 동안 실험실 코트와 장갑 착용. 인증된 biosafety 내각 (BSC)에서 작동 합니다. 70% 에탄올과 실험 절차 전후 실험 벤치를 소독. 모든 악기 또는 장비 연락처 (또는 잠재적으로 연락처) EHEC 70% 에탄올 이나 표 백제로 소독 되어야 한다. 신중 하 게 오염 된 (또는 잠재적으로 오염 된) 폐기물은 밀봉 하 고 압력가 이어야 한다. 필요한 경우 마스크, 눈 보호, 이중 장갑 또는 죄수 복을 착용. 6 주 된 C57BL/6 여성 마우스 구입 하 고 실험실 동물 센터의 국립 쳉 쿵 대학 (NCKU)에서 유지 했다. 동물 실험 기관 동물 관리 및 사용 위원회 NCKU (승인 번호 104-039)에 의해 승인 되었다.
1. Bioluciferase 표시 된 EHEC 박테리아 생성
<ol><li>믹스 50 ng deoxyribonucleic 산 (DNA), 1 μ 각 10 μ M의 앞으로 반전 뇌관, 2 μ 2.5 m m deoxynucleotides (dNTPs), 2 μ 버퍼, 0.2 μ DNA 중 합 효소, 및 살 균 이중 증 류 물 (ddH2O) 증폭 20 μ의 최종 볼륨을 x 10에 반대로 대 카세트, nptII 유전자24 DNA 템플렛 pBSL18024, 국가 유관 프로젝트 (NBRP)에서 구입 하는 것입니다. PCR 조건 표 1 에 나열 되 고 뇌관 순서는 표 2에서 사용할 수 있습니다.</li>
	<li>PCR 제품 상업적 복제 벡터 키트 다음을 위하여 프로토콜 ( 재료의 표참조).</li>
	<li>NsiI 와 SmaI 에 의해 클로닝 벡터에서 nptII 유전자 단편을 삭제할 및 pAKlux29 대 내성 플라스 미드를 만드는 NsiI ScaI 에 의해 소화 되어, pBBR1MCS4로 복제 pWF27813.</li>
	<li>LuxCDABE 오 페론 luciferase 플라스 미드9, pAKlux2, SpeI-HF 와 ScaI 및 복제에 의해 표현에서 삭제할 SpeI HF 와 SmaI 소화 대를 생성 하는 pWF278 저항 및 luciferase 플라스 미드, pWF27913를 표현. 참고: 플라스 미드 추출 및 삭제 조각 purifications, 상업 플라스 미드 추출 및 젤 추출 키트를 각각 사용 합니다. 효소 소화에 대 한 100 ng DNA, 1 μ 10 x 버퍼, 각 선택 된 제한 효소, 그리고 살 균 ddH2O 10 μ의 총 볼륨의 1 μ를 혼합 하 고 2.5-3 h 37 ° C에서 품 어.</li>
	<li>2500 V 4 ms와 electroporation에 의해 대장균 O157:H7 EDL933 유능한 세포에 pWF279 플라스 미드를 변환.</li>
	<li>1 시간 동안 37 ° C에서 1 mL Luria Bertani (파운드) 매체에 변형 된 박테리아 세포를 품 어.</li>
	<li>16-18 h 37 ° C에서 대의 50 µ g/mL으로 보충 한 파운드 천 배지에 박테리아 접시</li>
	<li>vivo에서 이미징 기계 다음 날 여 접시의 발광 신호를 확인 하십시오. 접시에서 단일 식민지를 선택 하 고 3 mL 파운드 16-18 h 37 ° C에서 50 µ g/mL 대 보충에 문화.</li>
	<li>Diluting 하 여 세균성 주식 매체를 준비 살 균 ddH2O 30% 글리세롤 솔루션 100% 글리세롤.</li>
	<li>대 방지 고정 나사 모자 cryovial에 세균성 주식으로-80 ° c.에서 박테리아 문화 및 30% 글리세롤 용액의 1:1 비율로 luciferase 플라스 미드를 은닉 하는 대장균 O157:H7 EDL933 박테리아 글리세롤의 최종 농도 15%입니다.</li>
</ol>2. 발광 EHEC 박테리아 준비 구두 접종에 대 한
참고: EHEC 준비 및 마우스 구강에 대 한 실험 절차의 타임 라인 순서도 그림 1 실험 준비에 도움을 제공.
<ol><li>은닉 luciferase 플라스 미드-80 ° C 주식에서 50 µ g/mL 대와 파운드 한 천 배지 위에 행진 대장균 O157:H7 EDL933 박테리아. 16-18 h 37 ° c.에 대 한 박테리아를 성장</li>
	<li>16-18 h 220 rpm에서 37 ° C 배양 기에서 50 µ g/mL 대와 3 mL 파운드 매체에 문화와 하룻밤 플레이트에서 단일 식민지를 선택 하십시오.</li>
	<li>Subculture 박테리아 (1: 100 희석) 대 (50 µ g/mL)으로 200 rpm에서 37 ° C 배양 기에서 2.5-3 h에 대 한 파운드 국물 포함. (예를 들어, 추가 2 mL 하룻밤 배양 보충 대 (50 µ g/mL)와 200 mL 파운드 매체에 박테리아).</li>
	<li>2.5-3 h에 대 한 박테리아를 품 어 및 600에서 광학 밀도 값 측정 값까지 nm (OD600) 0.9 ~ 1 사이입니다. 세균성 세포 수는 약 108 콜로 니 형성 단위 (CFU)의 밀도 / mL.</li>
	<li>8000 x g 30 분, 4 ° c.에서 다시 교양된 박테리아 원심</li>
	<li>박테리아의 펠 릿을 교 반 하지 않고는 상쾌한을 삭제 하 고 부드러운 동요에 의해 100 mL 0.9% 메 마른 정상적인 염 분으로 펠 릿을 세척.</li>
	<li>한 번 2.5-2.6 단계를 반복 합니다.</li>
	<li>세척 후 원심 8000 x g 30 분, 4 ° C에서 세균성 문화 하 고는 상쾌한 부드럽게 삭제.</li>
	<li>응축은 펠 릿에 100 0.9% 살 균 일반 식 염 수와 함께. 예를 들어, 200 mL 박테리아 centrifuged는 펠 릿을 중단 2 mL 정상적인 염 분을 추가 합니다.</li>
	<li>10 직렬 희석25통해 집중된 박테리아를 도금 하 여 박테리아 CFU (그것은 약 109 CFU/100 μ 응축 후에 있어야 정상적인 염 분)을 확인 합니다.</li>
</ol>3. 마우스 EHEC의 구강
<ol><li>24 h에 대 한 스 물 (5 g/L)와 6 주 된 여성 C57BL/6 쥐를 취급 합니다.</li>
	<li>24 시간 후 gavage 전에 또 다른 24 h에 대 한 일반 식 수로 전환. 24 h에 대 한 일반 물으로 치료 후 쥐 EHEC의 구강에 대 한 준비가.입니다.</li>
	<li>플런저에 다시 당겨 100 μ EHEC 박테리아로 주사기를 채우십시오. 아무 공기 방울이 주사기에는 확인 하십시오. 손가락으로 주사기를 스냅 하 여 거품을 제거 합니다.</li>
	<li>동물을 부드럽게 들어올리고 주의 케이지 위에 그것을 배치 합니다.</li>
	<li>꼬리, 신중 하 게 마우스 잡고 고 동물 케이지의 상단을 그립 하 고 멀리 이동 하려고.</li>
	<li>부드럽게 마우스의 머리를 이동 하지 않도록 엄지와 함께 동물의 앞면과 뒷면 목의 느슨한 피부를 파악 하 여 마우스를 제 지 하십시오.</li>
	<li>Gavage 바늘을 삽입 하 고 마우스의 머리는 고정 하 고 수직을 확인 하는 수직 위치에 마우스를 잡아.</li>
	<li>입의 지붕에 따라 마우스 입에 gavage 바늘을 삽입 하 고 식도 및 위를 향해 아래로 이동.</li>
	<li>삽입 된 바늘 절반 또는 2/3 길이 마우스에 때 주사 약 109 CFU 셀을 포함 하는 100 μ EHEC 박테리아.</li>
</ol>4입니다. 시각화
<ol><li>구강, 후 1, 2 일에 발광 신호를 감지 합니다.</li>
	<li>동물의 발광 신호를 검사 하기 전에 2.5% isoflurane 1.5 L/min 산소의 약 실에 그들을 둬서 그들을 anesthetize.</li>
	<li>모든 마우스 의식 및 중지 이동 될 때까지 2-5 분을 기다립니다. 동물 생물 발광의 비보에 탐지에 대 한 준비가 되었습니다.</li>
	<li>검색 및 이미지 동물의 발광 신호는 vivo에서 이미징 시스템. 소프트웨어 작업에 대 한 "데이터 수집" 섹션 5를 참조 하십시오. 이미징 프로세스 동안 모든 동물 2.5% isoflurane 1.5 L/min 산소의 지속적인된 공급을 받고 있다.<ol>
<li>파일을 클릭 > 라이브, 그리고 수동으로 마우스에 집중.</li>
		<li>노출 시간 및 레이저 강도 선택 합니다.</li>
		<li>클릭 취득 > 캡처.</li>
	</ol>
</li>
	<li>쥐 자 궁 경부 전위에 의해 안락사는 ex vivo 영상, 감염 된 쥐의 전체 내장 제거 및. Vivo에서 이미징 시스템 내장 9 cm 배양 접시와 이미지에 배치 합니다. 설정 되는 vivo에서 이미징 보기의 필드 A/b.로 설정 되어 제외 하 고 동일 자세한 내용은 "데이터 수집" 섹션 5를 참조 하십시오. 참고: 자 궁 경부 전위에 대 한 방법: 동물 케이지 그립을 한 손으로 꼬리를 파악 하 여 케이지 위에 마우스를 억제. 두개골의 기지에서 마커 펜 또는 엄지 및 목의 뒤에 대 한 다른 한편의 첫 번째 손가락을 놓습니다. 빨리 머리를 억제 하는 동안 손 또는 개체와 함께 앞으로 밀어 하 고 꼬리를 잡고 손으로 뒤로 당겨. 밀접 하 게 호흡 검거, 및 아무 심장 박동 확인 확인.</li>
</ol>5. 데이터 수집
참고: 데이터 수집에 사용 되는 소프트웨어는 재료의 테이블에에서 나열 됩니다.
<ol><li>이미지 수집을 위한 소프트웨어 (그림 2)의 수집 컨트롤 패널을 엽니다.</li>
	<li>선택 "발광" "사진,"와 "오버레이 합니다."</li>
	<li>"자동"으로 노출 시간 설정 "매체"로 Binning 설정</li>
	<li>Ƒ/중지 1로 발광 하 고 8에 대 한 설정 사진. Ƒ/중지 컨트롤 CCD 검출기는 빛의 양을 받았다.</li>
	<li>보기의 이미지를 얻으려고 관심 분야에 따라 필드를 설정 합니다. 옵션 "D"는 5 6 주 된 쥐를 적합 하 고 한 번에 모든 이미지 수 있습니다. "C"는 한 필드에서 3 6 주 된 쥐 이미지 수 있습니다.</li>
	<li>마우스/샘플 영상에 대 한 준비가 되 면, 일단 이미지 수집을 위한 "취득"을 클릭 합니다.</li>
	<li>이미지 데이터 획득을 엽니다.</li>
	<li>도구 팔레트 패널 (그림 3)을 엽니다.</li>
	<li>ROI 도구를 선택 합니다. 이미지 (그림 4) 발광 영역 범위 원을 (가장 왼쪽 중 하나)이 좋습니다.</li>
	<li>"측정 ROIs" (연필 아이콘) 측정 표면 발광 강도 (그림 3)를 클릭 합니다. 패널의 ROI 측정 및 정량화 값 표시 (그림 5).</li>
	<li>사용 하 여 구성 측정 ROI 측정 패널의 왼쪽에 선택 값/필요한 정보 (그림 6), 그렇지 않으면 "수출"이 데이터 테이블 내보내고.csv 파일 (그림 5)으로 저장을 클릭 합니다.</li>
	<li>.Csv 파일에서 발광 강도 정량화로 열 "총 속 (p/s)"의 값을 사용 합니다.</li>
</ol>

<ol>
	<li>Pennington, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+O157.">Escherichia coli O157.</a> Lancet. 376 (9750), 1428-1435 (2010).</li><li>Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shiga+toxins+and+the+pathophysiology+of+hemolytic+uremic+syndrome+in+humans+and+animals.">Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals.</a> Toxins (Basel). 4 (11), 1261-1287 (2012).</li><li>Tarr, P. I., Gordon, C. A., Chandler, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shiga-toxin-producing+Escherichia+coli+and+haemolytic+uraemic+syndrome.">Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome.</a> Lancet. 365 (9464), 1073-1086 (2005).</li><li>Obrig, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Shiga+Toxin+Mechanisms+of+Action+in+Renal+Disease.">Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease.</a> Toxins (Basel). 2 (12), 2769-2794 (2010).</li><li>Nguyen, Y., Sperandio, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohemorrhagic+E.+coli+(EHEC)+pathogenesis.">Enterohemorrhagic E. coli (EHEC) pathogenesis.</a> Front Cell Infect Microbiol. 2, 90 (2012).</li><li>Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescent+monitoring+of+in+vivo+colonization+and+clearance+dynamics+by+light-emitting+bacteria.">Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria.</a> Methods Mol Biol. 574, 137-153 (2009).</li><li>Hutchens, M., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+bioluminescence+imaging+to+the+study+of+infectious+diseases.">Applications of bioluminescence imaging to the study of infectious diseases.</a> Cell Microbiol. 9 (10), 2315-2322 (2007).</li><li>Rhee, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+spatial+and+temporal+colonization+of+enteropathogenic+E.+coli+and+enterohemorrhagic+E.+coli+in+mice+using+bioluminescent+in+vivo+imaging.">Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging.</a> Gut Microbes. 2 (1), 34-41 (2011).</li><li>Karsi, A., Lawrence, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+host+range+fluorescence+and+bioluminescence+expression+vectors+for+Gram-negative+bacteria.">Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria.</a> Plasmid. 57 (3), 286-295 (2007).</li><li>Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+flagella+is+coincident+with+uropathogenic+Escherichia+coli+ascension+to+the+upper+urinary+tract.">Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract.</a> Proc Natl Acad Sci U S A. 104 (42), 16669-16674 (2007).</li><li>Roxas, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohemorrhagic+E.+coli+alters+murine+intestinal+epithelial+tight+junction+protein+expression+and+barrier+function+in+a+Shiga+toxin+independent+manner.">Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner.</a> Lab Invest. 90 (8), 1152-1168 (2010).</li><li>Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. , (1999).</li><li>Kuo, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutation+of+the+Enterohemorrhagic+Escherichia+coli+Core+LPS+Biosynthesis+Enzyme+RfaD+Confers+Hypersusceptibility+to+Host+Intestinal+Innate+Immunity+In+vivo.">Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo.</a> Front Cell Infect Microbiol. 6, 82 (2016).</li><li>Wiles, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+specificity,+colonization+and+clearance+dynamics+in+vivo+following+oral+challenges+with+the+murine+pathogen+Citrobacter+rodentium.">Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium.</a> Cell Microbiol. 6 (10), 963-972 (2004).</li><li>Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+bioluminescence+imaging+of+the+murine+pathogen+Citrobacter+rodentium.">In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium.</a> Infect Immun. 74 (9), 5391-5396 (2006).</li><li>Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photonic+detection+of+bacterial+pathogens+in+living+hosts.">Photonic detection of bacterial pathogens in living hosts.</a> Mol Microbiol. 18 (4), 593-603 (1995).</li><li>Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extracellular+replication+of+Listeria+monocytogenes+in+the+murine+gall+bladder.">Extracellular replication of Listeria monocytogenes in the murine gall bladder.</a> Science. 303 (5659), 851-853 (2004).</li><li>Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+Yersinia+enterocolitica+in+Murine+and+Bovine+Feces+on+the+Basis+of+the+Chromosomally+Integrated+luxAB+Marker+Gene.">Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene.</a> Appl Environ Microbiol. 58 (3), 1024-1026 (1992).</li><li>Trcek, J., Fuchs, T. M., Trulzsch, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Yersinia+enterocolitica+invasin+expression+in+vitro+and+in+vivo+using+a+novel+luxCDABE+reporter+system.">Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system.</a> Microbiology. 156 (Pt 9), 2734-2745 (2010).</li><li>Morin, C. E., Kaper, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stabilized+luciferase-expressing+plasmids+to+examine+in+vivo-induced+promoters+in+the+Vibrio+cholerae+vaccine+strain+CVD+103-HgR.">Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR.</a> FEMS Immunol Med Microbiol. 57 (1), 69-79 (2009).</li><li>Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+model+systems+for+studying+enteropathogenic+Escherichia+coli+infections.">In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections.</a> Cold Spring Harb Perspect Med. 3 (3), a009977 (2013).</li><li>Ritchie, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+Models+of+Enterohemorrhagic+Escherichia+coli+Infection.">Animal Models of Enterohemorrhagic Escherichia coli Infection.</a> Microbiol Spectr. 2 (4), EHEC-0022-2013 (2014).</li><li>Chou, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohaemorrhagic+Escherichia+coli+O157:H7+Shiga-like+toxin+1+is+required+for+full+pathogenicity+and+activation+of+the+p38+mitogen-activated+protein+kinase+pathway+in+Caenorhabditis+elegans.">Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans.</a> Cell Microbiol. 15 (1), 82-97 (2013).</li><li>Alexeyev, M. F., Shokolenko, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tnl+0+transposon+derivatives+for+insertion+mutagenesis+and+gene+delivery+into+the+chromosome+of+Gram-negative+bacteria.">Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria.</a> Gene. 160 (1), 59-62 (1995).</li><li>Wiegand, I., Hilpert, K., Hancock, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agar+and+broth+dilution+methods+to+determine+the+minimal+inhibitory+concentration+(MIC)+of+antimicrobial+substances.">Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances.</a> Nat Protoc. 3 (2), 163-175 (2008).</li><li>Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+of+Long-Wavelength+Optical+and+NIR+Imaging+Materials:+Contrast+Agents,+Fluorophores+and+Multifunctional+Nano+Carriers.">Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers.</a> Chem Mater. 24 (5), 812-827 (2012).</li><li>Heim, R., Cubitt, A. B., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+green+fluorescence.">Improved green fluorescence.</a> Nature. 373 (6516), 663-664 (1995).</li><li>Weissleder, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+clearer+vision+for+in+vivo+imaging.">A clearer vision for in vivo imaging.</a> Nat Biotechnol. 19 (4), 316-317 (2001).</li><li>Frangioni, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+near-infrared+fluorescence+imaging.">In vivo near-infrared fluorescence imaging.</a> Current Opinion in Chemical Biology. 7 (5), 626-634 (2003).</li><li>Collins, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Citrobacter+rodentium:+infection,+inflammation+and+the+microbiota.">Citrobacter rodentium: infection, inflammation and the microbiota.</a> Nat Rev Microbiol. 12 (9), 612-623 (2014).</li><li>Mallick, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+murine+infection+model+for+Shiga+toxin-producing+Escherichia+coli.">A novel murine infection model for Shiga toxin-producing Escherichia coli.</a> J Clin Invest. 122 (11), 4012-4024 (2012).</li><li>Petty, N. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Citrobacter+rodentium+genome+sequence+reveals+convergent+evolution+with+human+pathogenic+Escherichia+coli.">The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli.</a> J Bacteriol. 192 (2), 525-538 (2010).</li><li>Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M., Peterson, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Four+new+derivatives+of+the+broad-host-range+cloning+vector+pBBR1MCS,+carrying+different+antibiotic-resistance+cassettes.">Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes.</a> Gene. 166 (1), 175-176 (1995).</li><li>Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+Plasmid+Maintenance+in+the+Attenuated+Live+Vector+Vaccine+Strain+Salmonella+typhiCVD+908-htrA.">Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA.</a> Infect Immun. 67 (12), 6424-6433 (1999).</li><li>Francis, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+pneumococcal+infections+in+the+lungs+of+live+mice+using+bioluminescent+Streptococcus+pneumoniae+transformed+with+a+novel+gram-positive+lux+transposon.">Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon.</a> Infect Immun. 69 (5), 3350-3358 (2001).</li><li>Goldwater, P. N., Bettelheim, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treatment+of+enterohemorrhagic+Escherichia+coli+(EHEC)+infection+and+hemolytic+uremic+syndrome+(HUS).">Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS).</a> BMC Med. 10, (2012).</li></ol>

저자는 공개 없다.

그것은 알려졌다 EHEC luciferase 플라스 미드와 변환 호스트 또는 유전자 식 vivo에서8,,1112에 그것의 지역화를 검사 활용 되었습니다. 여기 시연 murine 모델 또한 murine 호스트8에서 EHEC 식민지 시기와 지역화를 검색 하기 위해 보고 되었다. 그럼에도 불구 하 고, 우리는 intragastrically 마우스 EHEC 접종을 관리 하는 방법과 구강에 대 한 발광 박테리아를 신중 하 게 준비 하는 방법의 세부 프로토콜을 제공 합니다. 특히,는 마우스 구강 EHEC (단계 3.7)의에 대 한 마우스 헤드의 위치 때 중요 gavage 바늘 삽입 됩니다. 위치 수직 하지 않으면 그것은 바늘을 통과 하기 어려울 것입니다 그리고 그것은 아마도 마우스를 다칠 수 있습니다. 3.8 단계에서 gavage 바늘 마우스의 입 안에 있을 때 혀 누워 것입니다 입 밖으로 약간. 식도에 gavage 바늘을 전달할 때 저항을 발생 하는 경우 바늘을 앞으로 이동 중지 하 고 즉시 그것을 철회. 바늘 식도 입력은 되도록 바늘 위치를 변경 합니다. 바늘 저항 발생, 박테리아는 위 대신 폐에 주입을 초래할 때 기도 입력 수 있습니다.
녹색 형광 단백질 (GFP)를 바이오 센서로 응용 생물학 실험에서 일반적 이다. 그러나,를 사용 하 여 GFP 기자로 서 헤모글로빈, 단백질 및 물 흡수도 200-650 nm 사이26, 겹치면는 높은 때문에 vivo에서 영상으로 라이브 동물에서 병원 체 감염/식민을 권장 하지 않습니다 관찰 GFP (여기 480 nm, 방출 510 nm)27 따라서, GFP를 사용 하 여 이미징 vivo에서 기자로 서 신호 수 중단 될 헤모글로빈, 단백질, 및 물 동물26에. 근 적외선 (NIR) 형광 적합 vivo에서 이미징의 흡 광도 창 주위는 때문에 650-900 nm28, 헤모글로빈의 낮은 흡수 계수의 지역에 있는 (< 650 nm)와 물 (> 900 nm)26 ,28 . 또한, 조직의 빛을 흡수 때 autofluorescence를 유도 하는 기회가 있다. 때 여기 및 방출의 파장 범위 GFP 창에서 NIR29보다 훨씬 더 autofluorescence를 유도 합니다. NIR의 사용은 신호 대 배경 비 autofluorescence 배경29를 제거 하 여 GFP의 비교를 개선할 수 있습니다. 생물 발광은 가시광선을 생성 하 여 자기 에너지를 필요 하지 않습니다. 그것은 그것의 효소 luciferase에 의해 기판 소를 진작 하 고 빛을 생성에 대 한 반응에 따라 다릅니다. 생물 발광 샘플에 직접 빛을 필요로 하지 않습니다, 샘플에서 배경 신호 이므로 매우 낮은. 기자는 더 일반적인 vivo에서 화상 진 찰에 대 한 쉽고 따라서 생물 발광의 사용. 반면, 형광 빛 여기를 신호 빛을 유도 하는 것이 필요 합니다. 때 조직의 빛을 흡수, 형광 빛 방출 될 것 이다 하 고 그들의 신호-잡음은 높은 생물 발광의 비교 있도록 autofluorescence를 유발 가능성이 있다.
라는 Citrobacter rodentium, 쥐의 자연적인 막 병원 체 murine 호스트를 식민지 메커니즘 연구 활용 되었습니다 EHEC 자연스럽 게 덜 구강 감염2,22에 의해 쥐에 있는 식민지는, 고려는 박테리아22,30서로게이트입니다. EHEC의 C. rodentium 둘 다 식민지 장 점 막 하 고 호스트22,30병 변 A/E의 형성을 유발. 그들은 또한 한 T3SS 및 A/E 병 변22,30을 유도 하는 여러 가지 이펙터 단백질 인코딩하는 리 pathogenicity 섬 포함. 따라서, luciferase C. rodentium 식민 병 리를 감지 하는 vivo에서 이미징 시스템을 통해 식민지 메커니즘 연구에서 기자가 되었습니다 또한 플라스 미드 표현 사용 보고14, 15. 그럼에도 불구 하 고, C. rodentium 감염 생쥐의 T3SS의 기능과 병 변 A/E의 메커니즘을 조사 하는 유용한 모델은, C. rodentium 포함 하지 않는 시가 독 소 (Stx)30, 즉 지배 EHEC, 특히 serotype O157:H73신장 장애를 일으키는 독성 요소. Stx 표현 C. rodentium 스트레인 건설 되어 있지만 최근31, EHEC 감염에 더 현실적 이다, 그것은 포함 되지 않습니다 식민지 및 감염에 대 한 중요 한 다른 잠재적인 EHEC 독성 요인. 또한, C. rodentium EHEC32, EHEC 식민지 그리고/또한 감염 하는 동안 독성 C. rodentium 에서 사용할 수 있습니다 제안 그것의 유전자의 67%를 공유 한다.
PWF27913, 여기에서 사용 하는 플라스 미드 표현 luciferase pAKlux29 그 등뼈는 pBBR1MCS433에서 수정 되었습니다. PBBR1MCS4 시험 되 고 다양 한 박테리아33복제, 비록 그것은 되도록이 플라스 미드 복제 (ORI)의 세균 호스트에 대 한 적합 한 실험에 대 한이 luciferase 플라스 미드-기반 시스템을 사용 하기 전에 중요 한 고 따라서 확인이 luciferase 플라스 미드 표현 세균 호스트에 복제할 수 있습니다. 우리는 박테리아에서 플라스 미드의 안정성을 유지 하기 위해 항생제 스트레스를 사용 합니다. 박테리아는 항생제의 부재에서 동물을 입력, 적어도 2 일 동안 야생-타입 EHEC의 발광 신호 감지 되었습니다. 그러나 우리 때문에 우리가 이미 EHEC WT EHEC rfaD (즉 EHEC 그대로 LPS 합성에 필요한 유전자를 인코딩합니다) 사이 발광 강도에 상당한 차이 볼 수 없었다 감염 2 일 이상에 대 한 다음 않았다, 2 일에 돌연변이. 유지 하기 위해 안정적으로 항생제의 부재에서 박테리아에 플라스 미드, 플라스 미드 pCM1710,34 이 목적을 위해 사용할 수 있습니다. pCM17 2-플라스 미드 분할 시스템 및 항생제10,34의 부재에 박테리아에서 플라스 미드의 유지 보수를 위해 post-segregational 살인 메커니즘을 인코딩합니다. 플라스 미드 pCM17 포함 OmpC 발기인에 의해 구동 luxCDABE 오 페론 적어도 7 일8발광 신호에 의해 검출 될 수 있다. 항생제의 부재에서 연속 발광 식 박테리아를 다른 방법 세균성 염색체35에 luxABCDE 유전자를 삽입 하는 것입니다. 프랜시스 외 사용 transposon 생물 발광 안정적인 스트레인35를 구 균 의 염색체에 무작위로 삽입 luxABCDE 오 페론과 항생제 카세트 삽입.
우리의 이전 연구13, 우리는 검사 하는 호스트에서 EHEC 식민지 고 EHEC 야생 유형 (WT) 및 돌연변이13식민지 능력의 차이 비교 하 여이 모델 시스템을 활용. 쥐 때 관리 되었다 발광 EHEC rfaD 돌연변이, 극적으로 점감 하는 발광 신호에 비해 그의 2 일 후 WT EHEC 감염 게시. 이 murine 모델 호스트에서 EHEC 식민의 돌연변이 효과 분석할 수 있는 증거를 제공 합니다. 또한, EHEC의 식민을 줄이기 위한 치료 치료 항생제의 사용 이기 때문에 금기5,36EHEC 감염을 고려 하 고, 잠재적인 솔루션입니다. 따라서, 그것은 가치가 테스트 여부이 모델 시스템 반대로 식민 마약/호스트에서 enterobacteria 식민지에 대 한 치료의 효능을 검사를 사용할 수 있습니다. 우리는이 모델 시스템을 사용 하 여 그것이 가능한 타이밍 및 단순히 EHEC, 뿐만 아니라 다른 enterobacteria 식민지 비보의 위치를 검사 하는 믿습니다. 이 동물 모델을 사용 하 여 마우스에서 EHEC 식민의 과정을 모니터링 할 수 있습니다 하 고 호스트에서 식민 부담 살아있는 동물에서 EHEC의 공간 및 시간 식민지를 결정 하기 위해 계량 수 있습니다. 시각화 및이 모델을 사용 하 여 enterobacteria 식민의 정량화 하 게 조사 하 고 enterobacterial 식민의 정밀한 메커니즘을 분석 하 고 따라서 식민지 연구의 부족에 대 한 보상을 하는 훌륭한 도구 및 현재 지식 향상.

EHEC O157:H7 설사1, HS2에서3, 오염 된 물 이나 음식을 통해도 급성 신부전4 원인 병원 체 이다. EHEC 병원 성 enterobacterium 이며 인간1의 위장을 colonizes. EHEC 먼저 호스트 창 자 상피 준수 때 그들은 유형 III 분 비 시스템 (T3SS) 분자 주사기는 연결을 유도 하 고 적용을 이후에 병 변 (A/E) effacing 역할을 통해 호스트 세포에 주입 식민 요인 접착 (식민)5. 이 유전자는 A/E 병 변 형성에 관여 enterocyte 항목 (리) pathogenicity 섬5의 소재 시로 인코딩됩니다.
생물 발광은 빛 생산 화학 반응, 어떤 luciferase catalyzes 보이는 빛6를 생성 하는 기판 소. 이 효소 과정은 종종 산소 또는 아데노신 3 인산 염 (ATP)6의 존재를 필요로 한다. 생물 발광 영상 (BLI) 연구원 시각화 및 호스트 병원 체 상호 작용의 양자화에에서 있습니다 라이브 동물7. 씨 수 있습니다 그들은 이주와 다른 조직7; 침략 발광 박테리아에 따라 살아있는 동물에서 세균 감염 사이클 특성을 이 감염의 동적 진행을 보여준다. 또한, 동물에서 세균 부하는 관련이 발광 신호8; 따라서, 그것은 간단 하 고 직접적인 방법으로 실험 동물의 병 적인 상태를 추정 하는 편리한 표시기입니다.
여기에 사용 되는 플라스 미드 포함 luciferase 오 페론, luxCDABE, 박테리아 자체 luciferase 기판7,9인코딩하는 Photorhabdus luminescens 에서. 이 luciferase 표현 플라스 미드 박테리아로 변형 하 여 살아있는 동물에서 이러한 발광 박테리아를 관찰 하 여 식민과 감염 프로세스를 모니터링할 수 있습니다. 전반적으로, 씨 및 생물 발광 표시 된 박테리아 세균 숫자 및 위치, 항생제/치료 치료와 감염/식민지6, 에 세균성 유전자 발현 세균 생존 능력을 감시 하는 연구자 수 7. 수많은 병원 성 박테리아는 감염에서 감염 주기 및/또는 유전자 표현 검토 하 luxCDABE 오 페론 표현 보고 되었습니다. Uropathogenic 대장균10, EHEC8,11,,1213, enteropathogenic를 포함 하 여 이러한 박테리아 대장균 (EPEC)8, Citrobacter rodentium14,15, 살 모 넬 라 typhimurium16, Listeria monocytogenes17, Yersinia enterocolitica18,19, 비 브리 오 cholerae20, 문서화 되었습니다.
몇 가지 실험 모델 EHEC 식민 생체 외에서 그리고 vivo에서21,,2223의 연구를 촉진 하기 위해 개발 되었습니다. 그러나, 공부 하기는 EHEC 식민 vivo에서, 적당 한 동물 모델의 부족 및 따라서 내용의 결과 소수 있다. EHEC 식민 메커니즘에는 vivo에서의 연구를 촉진 하기 위하여 관찰 하 고 계량 비-침략 적 방법에서 살아있는 동물에서 EHEC 식민 동물 모델을 구축 하는 귀중 한입니다.
이 원고는 EHEC 식민 생활 호스트에 시간이 지남에 따라 모니터 발광 표현 시스템을 사용 하는 마우스-EHEC 식민 모델을 설명 합니다. 마우스는 intragastrically 생물 발광 표시 EHEC로 접종 하 고 발광 신호는 비-침략 적 vivo에서 이미징 시스템13와 쥐에서 발견 되. 마우스 감염 생물 발광 표시 EHEC 2 일 게시 감염 후 2 일 게시 감염 호스트 창에 그 박테리아 식민지는 제안 후 그들의 내장에서 중요 한 발광 신호를 보여주었다. 이미지 데이터 비보 전 이 식민은 맹 쥐의 콜론에서 구체적으로 보여주었다. 이 마우스 EHEC 모델을 사용 하 여 발광 EHEC 식민 검출 될 수 있다 살아있는 호스트에는 vivo에서 이미징 시스템에서 더 이해를 증진 수 있습니다 장의 박테리아 식민지의 상세한 메커니즘을 연구 하 여 EHEC 유도 생리와 병리학 변화입니다.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Shaker incubator</td>
			<td style="width:175px;">YIH DER</td>
			<td style="width:143px;">LM-570R</td>
			<td style="width:167px;">bacteria incubation&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Orbital shaking incubator</td>
			<td style="width:175px;">FIRSTEK</td>
			<td style="width:143px;">S300</td>
			<td>bacteria incubation&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">pBSL180</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>source of nptII gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pAKlux2</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>source of luxCDABE operon</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T&#38;A Cloning Kit</td>
			<td>Yeastern Biotech</td>
			<td style="width:143px;">FYC001-20P</td>
			<td>use for TA cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nsi I</td>
			<td style="width:175px;">NEB</td>
			<td>R0127S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sca I</td>
			<td style="width:175px;">NEB</td>
			<td>R0122S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Spe I-HF</td>
			<td style="width:175px;">NEB</td>
			<td>R0133S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sma I&#160;</td>
			<td style="width:175px;">NEB</td>
			<td>R0141S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">T4 ligase</td>
			<td style="width:175px;">NEB</td>
			<td style="width:143px;">M0202S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Ex Taq</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">10X Ex Taq Buffer</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP Mixture&#160;</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">PCR machine</td>
			<td style="width:175px;">applied Biosystem&#160;</td>
			<td style="width:143px;">2720 thermal cycler&#160;</td>
			<td>&#160;for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Glycerol</td>
			<td style="width:175px;">SIGMA</td>
			<td style="width:143px;">G5516-1L</td>
			<td>use for bacteria stocking solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">NaCl</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">31434-5KG-R</td>
			<td>chemical for making LB medium, 10 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Tryptone</td>
			<td style="width:175px;">CONDA pronadisa</td>
			<td style="width:143px;">Cat 1612.00</td>
			<td>chemical for making LB medium, 10 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Yeast Extract powder</td>
			<td style="width:175px;">Affymetrix</td>
			<td style="width:143px;">23547-1 KG</td>
			<td>chemical for making LB medium, 5 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Agar</td>
			<td style="width:175px;">CONDA pronadisa</td>
			<td style="width:143px;">Cat 1802.00</td>
			<td>chemical for making LB agar</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">kanamycin&#160;</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">K4000-5G</td>
			<td>antibiotics, use for seleciton</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">streptomycin&#160;</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">S6501-100G</td>
			<td>antibiotics, eliminate the microbiota in mice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">EDL933 competent cell</td>
			<td style="width:175px;">Homemade</td>
			<td style="width:143px;"></td>
			<td>method is on supplemental document&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Electroporator</td>
			<td style="width:175px;">MicroPulser</td>
			<td style="width:143px;"></td>
			<td>for electroporation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Electroporation Cuvettes</td>
			<td style="width:175px;">Gene Pulser/MicroPulser</td>
			<td style="width:143px;">1652086</td>
			<td>for electroporation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">High-speed centrifuge</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">Avanti, J-26S XP</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fixed-Angle Rotor</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">JA25.5</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fixed-Angle Rotor</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">JLA10.5</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifuge bottles</td>
			<td>Beckman Coulter</td>
			<td>REF357003</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifuge bottles</td>
			<td style="width:175px;">Thermo Fisher scientific</td>
			<td style="width:143px;">3141-0500</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">eppendorf biophotometer plus&#160;</td>
			<td>eppendorf</td>
			<td>AG 22331 hamburg</td>
			<td>for measuring the OD600 value of bacteria</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">C57BL/6 mice&#160;</td>
			<td colspan="2">Laboratory Animal Center of NCKU</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">lab coat, gloves</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>for personnel protection&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">isoflurane&#160;</td>
			<td>Panion &#38; BF Biotech Inc.</td>
			<td style="width:143px;">G-8669</td>
			<td>for mice anesthesia, pharmaceutical grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1ml syringe&#160;</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>use for oral gavage of mice</td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Reusable 22 G ball-tipped feeding needle</td>
			<td style="width:143px;">&#966;0.9 mm X L 50 mm</td>
			<td>use for oral gavage of mice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">surgical&#160; scissors&#160;</td>
			<td></td>
			<td style="width:143px;"></td>
			<td>use for mice experiment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Xenogen IVIS 200 imaging system</td>
			<td>Perkin Elmer</td>
			<td>IVIS spectrum</td>
			<td>use for bioluminescent image capture&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Living Image Software</td>
			<td>Perkin Elmer</td>
			<td style="width:143px;">version 4.1</td>
			<td>use for quantifying the image data</td>
		</tr>
	</tbody>
</table>

detection of enterohemorrhagic escherichia coli colonization in murine host by non-invasive in vivo bioluminescence system

Enterohemorrhagic E. 대장균 (EHEC) O157:H7는 foodborne 병원 체는 causesdiarrhea, 출혈 성 대 장 염 (HS), 그리고 hemolytic 신부전 증후군 (HUS), 인간의 창 자 장관에 식민지. EHEC 식민 vivo에서 의 상세한 메커니즘 연구를 모니터링 하 고 계량 EHEC 식민 동물 모델에 필수적 이다. 여기 모니터링 하 고 계량 EHEC 식민지 생활 호스트에서 EHEC에 발광 표현 플라스 미드를 변형 하 여 마우스 EHEC 식민 모델을 설명 합니다. 동물 생물 발광 표시 EHEC로 주사는 비-침략 적 vivo에서 이미징 시스템으로 탐지 하 여 쥐에서 강렬한 발광 신호를 보여줍니다. 후 1, 2 일 게시 감염, 발광 신호 수 여전히 감지할 수 감염 된 동물에서 EHEC 호스트에 적어도 2 일 동안 식민지 건의 하. 우리는 또한 이러한 발광 EHEC ex vivo 이미지에서 맹에 콜론, 특히 마우스 소장을 찾아 보여줍니다. 이 마우스 EHEC 식민 모델 EHEC 식민 메커니즘의 현재 정보를 도구 될 수 있습니다.

우리는 생물 발광 표시 EHEC 관리 (~ 109 세균성 세포) 구강에 의해 6 주 오래 된 여성 C57BL/6 마우스. 1 시간 이내 쥐 EHEC의 구두 접종 후 동물 vivo에서 이미징 시스템 그림 7과 같이 발광 신호 위해 시험 되었다. 결과 생물 발광 표시 EHEC와 gavage 쥐에서 강한 발광 신호를 보여주었다. 우리는 2 일 게시물 감염에 신호를 검사합니다. 그림 8A같이 쥐 2 일 EHEC는 2 일에 의해 호스트에 식민지 제안 감염 게시 후에 강렬한 발광 신호를 보여 야생-타입 EHEC EDL933 생물 발광 표시와 주사. 우리는 또한 intragastrically 생물 발광 표시 된 EDL933ΔrfaD (ΔrfaD) 쥐 (그림 8A) 감염. 이 돌연변이, lipopolysaccharide (LPS)에 망명을 우리의 이전 연구에서 호스트에 식민지를 줄이기 위해 표시 되었습니다. 그림 8A같이 발광 신호 ΔrfaD에서 발견은-없거나 적은 박테리아 나왔다 감염 된 쥐 세포는 쥐에 있는 식민지. 형광 성 신호의 정량화 그림 8B에서 표시 됩니다. 다음으로, 이러한 생물 발광 표시 된 박테리아의 위치 결정 했다. 감염 된 쥐 고통 없이 희생 했다 그리고 그들의 전체 내장 제거. 쥐 2 일 게시물 감염의 창 자 9 cm 배양 접시에 배치 했다 고 비보 전 (그림 9A) 몇 군데. 생물 발광 표시 된 EDL933에 감염 된 쥐의 장 조직을 밝혀 맹과 콜론, 이러한 발광 EHEC 식민지 맹에 감염 된 쥐의 콜론에 2 일에 대 한 제안에 발광 신호에 크게 증가 적어도. 쥐 감염 생물 발광 표시 ΔrfaD (그림 9A), 공개 된 vivo에서 이미지 (그림 8A와 일치 하는 그들의 창 자 조직에 발광 신호를 감소 하는 반면, ). 형광 신호의 정량화는 그림 9B에 표시 됩니다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56169/56169fig1.jpg"> 그림 1 : 타임 라인 실험 준비 순서도의. 타이밍의 개요 발광 EHEC 박테리아를 준비 하 고 스와 쥐를 pretreat 필요가 있었다. (A) EHEC 준비입니다. (B) 마우스 준비. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56169/56169fig2.jpg"> 그림 2 : Vivo에서 이미징 시스템 수집 제어판. 이미징 샘플, 전에 IVIS 수집 컨트롤 패널을 엽니다. 선택 "발광" "사진,"와 "오버레이 합니다." "자동"으로 노출 시간 설정 "매체"로 Binning 설정 Ƒ/중지 1로 발광 하 고 8에 대 한 설정 사진. Ƒ/중지 컨트롤 CCD 검출기는 빛의 양을 받았다. 샘플 영상에 대 한 준비가 되 면 "취득" 이미지를 클릭 합니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56169/56169fig3.jpg"> 그림 3 : 도구 팔레트 패널. 이미지 획득, 후 발광 강도 측정을 위한 도구 팔레트 패널을 사용 합니다. 도구 팔레트 패널을 열고 이미지 데이터. 이미지에 발광 신호 범위를 ROI 도구 중 하나를 선택 합니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56169/56169fig4.jpg"> 그림 4 : 정량화에 대 한 샘플에서 발광 신호. 이미지 ROI 도구에 의해 둘러 쌓여에 발광 신호 영역입니다. 여기에 표시 된 모든 발광 신호 빨간색 동그라미에서 있습니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56169/56169fig5.jpg"> 그림 5 : ROI 측정. 발광 신호를 돌고, 도구 팔레트 패널에 "측정 ROIs" 클릭 후 값 같이 표시 됩니다. 열 총 속 (p/s)의 값은 발광 강도 정량화에 사용 됩니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56169/56169fig6.jpg"> 그림 6 : 다른 부 량 정보 추가. 구성 측정 ROI 측정 패널의 왼쪽에, 클릭 하 여 다른 원하는 정량화 값/정보를 선택할 수 있습니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56169/56169fig7.jpg"> 그림 7 : 쥐 발광 EHEC로 주사 후의 대표 이미지. 마우스의 대표 이미지는 1 시간 이내 구강에 의해 발광 EHEC와 주사. 색 눈금 빛남을 (/sr p/s/c m2)를 나타냅니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig7large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56169/56169fig8.jpg"> 그림 8 : 쥐의 이미지는 2 일 후 생물 발광 표시 EHEC로 주사. (A) 마우스의 대표 이미지 EHEC EDL933 및 EDL933 발광 야생-타입으로 주사: 2 일 게시 감염 후 구강으로ΔrfaD . EHEC 감염 쥐의 생물 발광 강도 (B) 정량화. 오차 막대는 표준 편차를 나타냅니다. 대표 이미지 표시 됩니다. 모든 실험 실시 했다 하지 독립적으로 세 번 2-3 동물 들과 함께 각 시간 및 오차 막대는 표준 편차를 나타냅니다. P-값은 t-검정에 의해 통계 분석의 결과를 나타냅니다. 색 눈금 빛남을 (/sr p/s/c m2)를 나타냅니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig8large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/56169/56169fig9.jpg"> 그림 9 : 생물 발광 표시 EHEC 감염 된 쥐의 장 조직의 이미지. (A) 2 일 후에 접종을 생물 발광 표시 된 EHEC, 쥐 했다 안락사와 전체 장 조직 제거 및 전 비보를 몇 군데. 대표 이미지 표시 됩니다. 장 조직 EHEC 감염 마우스에서의 생물 발광 강도 (B) 정량화. 모든 실험 실시 했다 하지 독립적으로 세 번 2-3 동물 들과 함께 각 시간 및 오차 막대는 표준 편차를 나타냅니다. P-값은 t-검정에 의해 통계 분석의 결과를 나타냅니다. 색 눈금 빛남을 (/sr p/s/c m2)를 나타냅니다. 눈금 막대 나타냅니다 1 cm. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig9large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>단계</td>
			<td>온도</td>
			<td>시간</td>
			<td>사이클 수</td>
		</tr>
<tr>
<td>초기 변성</td>
			<td>95 ° C</td>
			<td>10 분</td>
			<td>1</td>
		</tr>
<tr>
<td>변성</td>
			<td>95 ° C</td>
			<td>30 초</td>
			<td rowspan="3">35</td>
		</tr>
<tr>
<td>어 닐 링</td>
			<td>58.4 ° C</td>
			<td>30 초</td>
		</tr>
<tr>
<td>확장</td>
			<td>72 ° C</td>
			<td>1.5 분</td>
		</tr>
<tr>
<td>마지막 확장</td>
			<td>72 ° C</td>
			<td>10 분</td>
			<td>1</td>
		</tr>
<tr>
<td>보류</td>
			<td>4 ° C</td>
			<td>∞</td>
			<td>1</td>
		</tr>
</tbody></table>표 1: 중 합 효소 연쇄 반응 (PCR) 조건
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관 이름</td>
			<td>시퀀스</td>
		</tr>
<tr>
<td>nptII F</td>
			<td>5' CCTATGCATAATAATTCCGCTAGCTTCACG3'</td>
		</tr>
<tr>
<td>nptII R</td>
			<td>5' GCTCCACCGATAATATTCCTGAGTCATACT3'</td>
		</tr>
</tbody></table>표 2: 증폭 하는 데 사용 하는 뇌관 순서 nptII

Watch this Scientific Journal Video about Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System at JoVE.com

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Enterohemorrhagic 생물 발광 표시 된 박테리아를 사용 하 여 대장균 (EHEC) 식민지에 대 한 마우스 모델의 자세한 프로토콜 제공 됩니다. 비-침략 적 vivo에서 이미징 시스템 라이브 동물에 의해 이러한 발광 박테리아의 탐지 EHEC 식민의 우리의 현재 이해를 미리 수 있습니다.

생물 발광 시스템 비-침략 적 비보에 의해 Murine 호스트에서 Enterohemorrhagic 대장균 식민지의 검출

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

detection-enterohemorrhagic-escherichia-coli-colonization-murine-host

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

9.4K 조회수.  National Cheng Kung University. Enterohemorrhagic 생물 발광 표시 된 박테리아를 사용 하 여 대장균 (EHEC) 식민지에 대 한 마우스 모델의 자세한 프로토콜 제공 됩니다. 비-침략 적 vivo에서 이미징 시스템 라이브 동물에 의해 이러한 발광 박테리아의 탐지 EHEC 식민의 우리의 현재 이해를 미리 수 있습니다.

비디오: Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Non-invasive Imaging of Leukocyte Homing and Migration in vivo

Two-photon (2P) microscopy is a high resolution imaging technique that has been broadly adapted by biologists. The value of 2P microscopy is that it provides rich spatiotemporal information regarding cell behaviors within intact tissues and in live mice. Leukocyte recruitment plays a significant role in host defense against infection and when unchecked, can contribute to inflammatory and autoimmune diseases. Studying leukocyte recruitment in vivo is technically challenging since cells are moving rapidly within vessels located deep within light scattering tissues. To date, most intravital imaging studies require surgical preparation to expose the blood vessels and tissues. To avoid the tissue damage and inflammation induced by surgery itself, here, we describe a non-invasive single-cell imaging approach that can be used to study leukocyte trafficking in the mouse footpad and phalanges. We discuss the technical aspects of our 2P imaging preparation and walk the reader through a typical experiment from initial set up to execution and data collection.

Non-invasive Imaging of Leukocyte Homing and Migration in vivo

Here, we describe a non-invasive two-photon (2P) microscopy approach to study leukocyte homing in the mouse footpad. We discuss the technical aspects of our tissue imaging preparation and walk the reader through a typical experiment from initial set up to execution and data collection.

백혈구 호밍 및 마이 그 레이션의 비침습 영상 생체내에</em

Two-photon (2P) microscopy is a high resolution imaging technique that has been broadly adapted by biologists.  The value of 2P microscopy is that it ...

연구

면역학 및 감염병학

Non-invasive Imaging of Disseminated Candidiasis in Zebrafish Larvae

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 to 40% attributable mortality6. Systemic candidiasis is normally controlled by innate immunity, and individuals with genetic defects in innate immune cell components such as phagocyte NADPH oxidase are more susceptible to candidemia7-9. Very little is known about the dynamics of C. albicans interaction with innate immune cells in vivo. Extensive in vitro studies have established that outside of the host C. albicans germinates inside of macrophages, and is quickly destroyed by neutrophils10-14. In vitro studies, though useful, cannot recapitulate the complex in vivo environment, which includes time-dependent dynamics of cytokine levels, extracellular matrix attachments, and intercellular contacts10, 15-18. To probe the contribution of these factors in host-pathogen interaction, it is critical to find a model organism to visualize these aspects of infection non-invasively in a live intact host. 
The zebrafish larva offers a unique and versatile vertebrate host for the study of infection. For the first 30 days of development zebrafish larvae have only innate immune defenses2, 19-21, simplifying the study of diseases such as disseminated candidiasis that are highly dependent on innate immunity. The small size and transparency of zebrafish larvae enable imaging of infection dynamics at the cellular level for both host and pathogen. Transgenic larvae with fluorescing innate immune cells can be used to identify specific cells types involved in infection22-24. Modified anti-sense oligonucleotides (Morpholinos) can be used to knock down various immune components such as phagocyte NADPH oxidase and study the changes in response to fungal infection5. In addition to the ethical and practical advantages of using a small lower vertebrate, the zebrafish larvae offers the unique possibility to image the pitched battle between pathogen and host both intravitally and in color. 
The zebrafish has been used to model infection for a number of human pathogenic bacteria, and has been instrumental in major advances in our understanding of mycobacterial infection3, 25. However, only recently have much larger pathogens such as fungi been used to infect larva5, 23, 26, and to date there has not been a detailed visual description of the infection methodology. Here we present our techniques for hindbrain ventricle microinjection of prim25 zebrafish, including our modifications to previous protocols. Our findings using the larval zebrafish model for fungal infection diverge from in vitro studies and reinforce the need to examine the host-pathogen interaction in the complex environment of the host rather than the simplified system of the Petri dish5.

The rapid development, small size and transparency of zebrafish are tremendous advantages for the study of innate immune control of infection1-4. Here we demonstrate techniques for infecting zebrafish larvae using the fungal pathogen Candida albicans by microinjection, methodology recently used to implicate phagocyte NADPH oxidase activity in control of fungal dimorphism5.

Zebrafish 애벌레의 분해해 칸디다 증의 비침습 이미징

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal features of the natural infection. This protocol describes procedures for the establishment and evaluation of systemic infection due to neuropathogenic Escherichia coli K1 in the neonatal rat. Colonization of the gastrointestinal tract leads to dissemination of the pathogen along the gut-lymph-blood-brain course of infection and the model displays strong age dependency. A strain of E. coli O18:K1 with enhanced virulence for the neonatal rat produces exceptionally high rates of colonization, translocation to the blood compartment and invasion of the meninges following transit through the choroid plexus. As in the human host, penetration of the central nervous system is accompanied by local inflammation and an invariably lethal outcome. The model is of proven utility for studies of the mechanism of pathogenesis, for evaluation of therapeutic interventions and for assessment of bacterial virulence.

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Here, a procedure is described for the establishment of systemic infection in the neonatal rat with cultures of Escherichia coli K1. This non-invasive procedure permits colonization of the gastrointestinal tract, translocation of the pathogen to the systemic circulation, and invasion of the central nervous system at the choroid plexus.

Neuropathogenic의 비 침습 모델<em&gt; 대장균</em&gt; 신생아 쥐에 감염

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. pylori-induced gastric inflammation by activating several innate leukocytes including neutrophils, monocytes, and mast cells. The immunogenic and immunomodulatory properties of HP-NAP make it a potential diagnostic and vaccine candidate for H. pylori and a new drug candidate for cancer therapy. In order to obtain substantial quantities of purified HP-NAP used for its clinical applications, an efficient method to purify this protein with high yield and purity needs to be established.
In this protocol, we have described a method for one-step negative chromatographic purification of recombinant HP-NAP overexpressed in Escherichia coli (E. coli) by using diethylaminoethyl (DEAE) ion-exchange resins (e.g., Sephadex) in batch mode. Recombinant HP-NAP constitutes nearly 70% of the total protein in E. coli and is almost fully recovered in the soluble fraction upon cell lysis at pH 9.0. Under the optimal condition at pH 8.0, the majority of HP-NAP is recovered in the unbound fraction while the endogenous proteins from E. coli are efficiently removed by the resin.
This purification method using negative mode batch chromatography with DEAE ion-exchange resins yields functional HP-NAP from E. coli in its native form with high yield and purity. The purified HP-NAP could be further utilized for the prevention, treatment, and prognosis of H. pylori-associated diseases as well as cancer therapy.

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

A high yield method for one-step negative purification of recombinant Helicobacter pylori neutrophil-activating protein (HP-NAP) overexpressed in Escherichia coli by using diethylaminoethyl resins in batch mode is described. HP-NAP purified by this method is beneficial for the development of vaccines, drugs, or diagnostics for H. pylori-associated diseases.

한 단계의 부정적인 크로마토 그래피 정제<em&gt; 헬리코박터 파이로리</em&gt; 호중구 - 활성화 단백질 과발현<em&gt; 대장균</em&gt; 배치 모드에서

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

그룹 B의 쥐 모델<em&gt; 연쇄상 구균</em&gt; 질 식민

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

Non-invasive In Vivo Fluorescence Optical Imaging of Inflammatory MMP Activity Using an Activatable Fluorescent Imaging Agent

This paper describes a non-invasive method for imaging matrix metalloproteinases (MMP)-activity by an activatable fluorescent probe, via in vivo fluorescence optical imaging (OI), in two different mouse models of inflammation: a rheumatoid arthritis (RA) and a contact hypersensitivity reaction (CHR) model. Light with a wavelength in the near infrared (NIR) window (650 - 950 nm) allows a deeper tissue penetration and minimal signal absorption compared to wavelengths below 650 nm. The major advantages using fluorescence OI is that it is cheap, fast and easy to implement in different animal models.
Activatable fluorescent probes are optically silent in their inactivated states, but become highly fluorescent when activated by a protease. Activated MMPs lead to tissue destruction and play an important role for disease progression in delayed-type hypersensitivity reactions (DTHRs) such as RA and CHR. Furthermore, MMPs are the key proteases for cartilage and bone degradation and are induced by macrophages, fibroblasts and chondrocytes in response to pro-inflammatory cytokines. Here we use a probe that is activated by the key MMPs like MMP-2, -3, -9 and -13 and describe an imaging protocol for near infrared fluorescence OI of MMP activity in RA and control mice 6 days after disease induction as well as in mice with acute (1x challenge) and chronic (5x challenge) CHR on the right ear compared to healthy ears.

Non-invasive In Vivo Fluorescence Optical Imaging of Inflammatory MMP Activity Using an Activatable Fluorescent Imaging Agent

This paper explains the application of fluorescent imaging using an activatable optical imaging probe to visualize the in vivo activity of key matrix metalloproteinases in two different experimental models of inflammation.

비 침습적<em&gt; In Vivo</em&gt; 활성화 가능한 형광 이미징 에이전트를 사용한 염증성 MMP 활성의 형광 광학 이미징

This paper describes a non-invasive method for imaging matrix metalloproteinases (MMP)-activity by an activatable fluorescent probe, via in vivo ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple condensation reactions. DHDDS (dehydrodolichyl diphosphate synthase) is a eukaryotic long-chain cis-PT (forming cis double bonds from the condensation reaction) that catalyzes chain elongation of farnesyl diphosphate (FPP, an allylic diphosphate) via multiple condensations with isopentenyl diphosphate (IPP). DHDDS is of biomedical importance, as a non-conservative mutation (K42E) in the enzyme results in retinitis pigmentosa, ultimately leading to blindness. Therefore, the present protocol was developed in order to acquire large quantities of purified DHDDS, suitable for mechanistic studies. Here, the usage of protein fusion, optimized culture conditions and codon-optimization were used to allow the overexpression and purification of functionally active human DHDDS in E. coli. The described protocol is simple, cost-effective and time sparing. The homology of cis-PT among different species suggests that this protocol may be applied for other eukaryotic cis-PT as well, such as those involved in natural rubber synthesis.

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

A simple protocol for overexpression and purification of codon-optimized, human cis-prenyltransferase, under non-denaturing conditions, from Escherichia coli, is described, along with an enzymatic activity assay. This protocol can be generalized for production of other cis- prenyltransferase proteins in quantity and quality suitable for mechanistic studies.

인간의 과발현과 정제<em&gt; 시스</em&gt; - 프레 닐 트랜스퍼 라제<em&gt; 대장균</em

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Site-Specifically 생성 하는 손쉬운 프로토콜 Acetylated 대장균 에서 단백질

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Recurrent Escherichia coli Urinary Tract Infection Triggered by Gardnerella vaginalis Bladder Exposure in Mice

Recurrent urinary tract infections (rUTI) caused by uropathogenic Escherichia coli (UPEC) are common and costly. Previous articles describing models of UTI in male and female mice have illustrated the procedures for bacterial inoculation and enumeration in urine and tissues. During an initial bladder infection in C57BL/6 mice, UPEC establish latent reservoirs inside bladder epithelial cells that persist following clearance of UPEC bacteriuria. This model builds on these studies to examine rUTI caused by the emergence of UPEC from within latent bladder reservoirs. The urogenital bacterium Gardnerella vaginalis is used as the trigger of rUTI in this model because it is frequently present in the urogenital tracts of women, especially in the context of vaginal dysbiosis that has been associated with UTI. In addition, a method for in situ bladder fixation followed by scanning electron microscopy (SEM) analysis of bladder tissue is also described, with potential application to other studies involving the bladder.

Recurrent Escherichia coli Urinary Tract Infection Triggered by Gardnerella vaginalis Bladder Exposure in Mice

A mouse model of uropathogenic E. coli (UPEC) transurethral inoculation to establish latent intracellular bladder reservoirs and subsequent bladder exposure to G. vaginalis to induce recurrent UPEC UTI is demonstrated. Also demonstrated are the enumeration of bacteria, urine cytology, and in situ bladder fixation and processing for scanning electron microscopy.

재발 성 에스케리치아 콜라 이 요로 감염 Gardnerella 질 방광 노출에 의해 유발 마우스에서

Recurrent urinary tract infections (rUTI) caused by uropathogenic Escherichia coli (UPEC) are common and costly. Previous articles describing models of ...

Real-Time Quantification of Reactive Oxygen Species in Neutrophils Infected with Meningitic Escherichia Coli

Escherichia coli (E. coli) is the most common Gram-negative bacteria causing neonatal meningitis. The occurrence of bacteremia and bacterial penetration through the blood-brain barrier are indispensable steps for the development of E. coli meningitis. Reactive oxygen species (ROS) represent the major bactericidal mechanisms of neutrophils to destroy the invaded pathogens. In this protocol, the time-dependent intracellular ROS production in neutrophils infected with meningitic E. coli was quantified using fluorescent ROS probes detected by a real-time fluorescence microplate reader. This method may also be applied to the assessment of ROS production in mammalian cells during pathogen-host interactions.

Real-Time Quantification of Reactive Oxygen Species in Neutrophils Infected with Meningitic Escherichia Coli

Escherichia coli is the leading cause of neonatal Gram-negative bacterial meningitis. During the bacterial infection, reactive oxygen species produced by neutrophils play a major bactericidal role. Here we introduce a method to detect the reactive oxygen species in neutrophils in response to meningitis E. coli.

수막 대장균에 감염된 호중구의 반응성 산소 종의 실시간 정량화

Escherichia coli (E. coli) is the most common Gram-negative bacteria causing neonatal meningitis. The occurrence of bacteremia and bacterial penetration ...