Chi-Chung Chen üzerinden Bakanlığı tıbbi araştırma, Chi Mei Tıp Merkezi (Tainan, Tayvan) fare yardım için enfeksiyon ve ulusal Cheng Kung Üniversitesi laboratuvar hayvan merkezinden destek anıyoruz. Bu eser bilim Bakanı tarafından desteklenir ve Teknoloji (en) CC için (en 104-2321-B-006-019, 105-2321-B-006-011, and106-2321-B-006-005) verir.

Dikkat: EHEC O157: H7 Biyogüvenlik seviye 2 (BSL-2) olan patojen merkezleri hastalık kontrol ve Önleme (CDC) Biyogüvenlik talimat (https://www.cdc.gov/) göre. Bu nedenle, tüm deneysel prosedürler EHEC içeren BSL-2 tesisinde gerçekleştirilmelidir. Laboratuvar mont ve eldiven giymek deney yaparken. Bir Sertifikalı Biyogüvenlik içinde dolap (BSC) çalışır. Deneysel kürsüye önce ve deneysel bir işlem ile % 70 etanol sonra dezenfekte. Bütün aletleri veya ekipman kişi (veya potansiyel kişi) EHEC % 70 etanol veya çamaşır suyu ile dezenfekte. Kirlenmiş (veya potansiyel olarak kontamine) atıkların dikkatle mühürlü ve autoclaved olmalıdır. Bir maske, göz koruması, çift eldiven veya tulum, gerekirse giymek. 6-hafta-yaşlı C57BL/6 dişi fareler satın ve laboratuvar hayvan Merkezi, ulusal Cheng Kung Üniversitesi (NCKU) yapılmaktadır. Hayvan deneyleri kurumsal hayvan bakım ve kullanım NCKU Komitesi (onay numarası 104-039) tarafından kabul edildi.
1. Bioluciferase etiketli EHEC bakteri üretimi
<ol><li>Mix 50 ng deoksiribonükleik asit (DNA), 1 μL her 10 mikron ileriye ve geriye doğru astar, 2 μL 2.5 mM deoxynucleotides (dNTPs), 2 μL 10 x arabellek, 0.2 μL DNA polimeraz ve steril çift distile su (GKD2O) yükseltmek için 20 μL son hacmiyle Anti-sefaloridin kaset, nptII gen24. PBSL18024Ulusal BioResource Projesi (NBRP) üzerinden satın alınan, DNA şablonudur. PCR koşulları Tablo 1 ' de listelenen ve astar sıra Tablo 2' de kullanılabilir.</li>
	<li>PCR ürünleri ticari bir klonlama vektör seti takip için ligate ( Tablo malzemelerigörmek) protokol.</li>
	<li>NptII gen parçası NsiI ve SmaI klonlama vektöründen tüketim ve sefaloridin dayanıklı plazmid oluşturmak için pAKlux29 NsiI ve ScaI tarafından sindirilmiş pBBR1MCS4 içine clone, pWF27813.</li>
	<li>Plazmid9, pAKlux2, SpeI-HF ve ScaI ve klon tarafından ifade luciferase üzerinden luxCDABE operon tüketim SpeI-HF ve SmaI sefaloridin oluşturmak için pWF278 sindirmek dayanıklı ve plazmid, pWF27913ifade luciferase. Not: plazmid çekimi ve eksize parçası purifications, ticari plazmid çıkarma ve jel ekstraksiyon kiti, sırasıyla kullanın. Enzim sindirim için 100 ng DNA, 1 μL 10 x tampon, her seçili restriksiyon enzimi ve steril GKD2O 10 μL, toplam hacmiyle 1 μL mix ve 2.5-3 h 37 ° C'de kuluçkaya.</li>
	<li>PWF279 plazmid elektroporasyon ile 2500 V 4 ms için tarafından E. coli O157: H7 EDL933 yetkili hücrelere dönüşümü.</li>
	<li>1 mL Luria-Bertani (LB) orta 1 h için 37 ° C'de dönüştürülmüş bakteri hücrelerinde kuluçkaya.</li>
	<li>16-18 h için 37 ° C'de sefaloridin 50 µg/mL ile desteklenmiş bir LB agar plaka üzerinde bakteri plaka.</li>
	<li>Plaka kollarındaki sinyal makine ertesi gün Imaging bir vivo içinde tarafından kontrol edin. Bir koloni plaka almak ve 3 ml 50 µg/mL sefaloridin 16-18 h için 37 ° C'de ile takıma LB kültür.</li>
	<li>Bakteriyel hisse senedi orta sulandrarak hazırlamak % 100 gliserol % 30 gliserol çözüm yapmak için steril GKD2O.</li>
	<li>Sefaloridin dayanıklı Don E. coli O157: H7 EDL933 bakteri olarak bakteri kültürü ve % 30 gliserol çözüm-80 ° C'de 1:1 oranında bir vidalı kapak cryovial bakteriyel bir hisse senedi olarak luciferase plazmid yataklık Gliserol son konsantrasyonu % 15 olduğunu.</li>
</ol>2. kollarındaki EHEC bakteri hazırlık Oral aşılama için
Not: Zaman çizelgesi akış çizelgesi EHEC hazırlık ve fare oral gavaj deneysel prosedürleri deneysel hazırlanmasında yardımcı olmak için şekil 1 ' deki sunulur.
<ol><li>Çizgi E. coli O157: H7 EDL933 bakteri luciferase plazmid 50 µg/mL sefaloridin-80 ° C stoktan bir LB agar plaka üzerine yataklık. 16-18 h 37 ° C'de için bakteri büyümesi</li>
	<li>Bir koloni gecede plaka ve kültür 3 mL LB orta 50 µg/mL sefaloridin 16-18 h 37 ° C kuluçka 220 RPM ile seç.</li>
	<li>Alt kültür için 2,5-3 h 37 ° C kuluçka 200 devirde LB suyu içeren bakteri (1: 100 seyreltme) sefaloridin (50 µg/mL). (Örneğin, 2 mL gecede takıma 200 mL LB orta sefaloridin (50 µg/mL) ile bakteri kültürlü ekleyin).</li>
	<li>Bakteri 2.5-3 h için kuluçkaya ve 600 optik yoğunluk değerini ölçmek nm (OD600) değeri olduğunu 0,9-1 arasında. Yaklaşık 108 koloni oluşturan birim (CFU) yoğunluğudur: bakteri hücre numarası / mL.</li>
	<li>8000 x g 30 dk, 4 ° c'de yeniden kültürlü bakteri santrifüj kapasitesi</li>
	<li>Süpernatant bakteri Pelet Tantanacı olmadan atmak ve 100 mL % 0,9 steril normal salin ile pelet tarafından nazik ajitasyon yıkayın.</li>
	<li>2.5 ve 2.6 bir kez adımları yineleyin.</li>
	<li>Wash sonra santrifüj kapasitesi 8000 x g 30 dk, 4 ° C de bakteri kültürü ve süpernatant yavaşça atın.</li>
	<li>Yoğuşma Pelet, 100-fold %0,9 steril normal salin ile. 200 mL bakteri centrifuged, örneğin, pelet askıya almak için 2 mL normal tuz ekleyin.</li>
	<li>(Yaklaşık 109 CFU/100 μL yoğunlaşma sonra normal salin olması gereken) CFU bakteri ile 10 kat seri seyreltme25konsantre bakteri kaplama tarafından onaylayın.</li>
</ol>3. fare sözlü sonda ile besleme, EHEC
<ol><li>6-hafta-yaşlı kadın C57BL/6 fareler streptomisin su (5 g/L) için 24 h ile tedavi.</li>
	<li>24 saat sonra normal içme suyu başka bir 24 saat daha önce sonda ile besleme için geçiş yapın. 24 h için düzenli su ile tedavi sonra fareler EHEC oral gavaj için hazırsınız demektir.</li>
	<li>Şırınga ile 100 μL EHEC bakteri üzerinde pistonu geri çekerek doldurun. Şırıngada hava hava kabarcığı yok olduğundan emin olun. Baloncuklar şırınga ile parmaklarını şaklatarak kaldırın.</li>
	<li>Hayvan yavaşça kaldırın ve bakım ile kafes üstüne yerleştirin.</li>
	<li>Fareyi kuyruğundan dikkatle tutun ve hayvan kafes üst kavrama ve uzaklaşmaya girişimi.</li>
	<li>Yavaşça fare derisi boyun ve arka başparmak ve işaret parmağı fare başkanı taşınmasını engelleme hayvanla açgözlü tarafından dizginlemek.</li>
	<li>Fare sonda ile besleme iğne yerleştirin ve fare immobilize ve dikey başıdır emin olmak için bir dikey konumda tutun.</li>
	<li>Sonda ile besleme iğneyi ağız çatı takip fare ağzına yerleştirin ve yemek borusu ve mide doğru aşağı taşı.</li>
	<li>Eklenen iğne yarısı veya üçte iki uzunluğu fare olduğunda yaklaşık 109 CFU hücreleri içeren 100 μL EHEC bakteri enjekte et.</li>
</ol>4. görsel öğe
<ol><li>Oral gavaj sonra 1-2 gün kollarındaki sinyalleri algılayabilir.</li>
	<li>Hayvanların kollarındaki sinyalleri inceleyerek önce onları % 2.5 isoflurane 1, 5 L/dk oksijen ile TMMOB içine koyarak onları anestezi.</li>
	<li>Olana kadar tüm fareler bilinçsiz ve hareket durdurmak için 2-5 dk bekle. Hayvanlar bioluminescence vivo içinde tespiti için hazırsınız demektir.</li>
	<li>Algılamak ve hayvanların kollarındaki sinyalleri görüntüleme sistemi bir vivo içinde tarafından görüntü. Bölüm 5 "Veri toplama" yazılım işlem için bakınız. Görüntüleme işlemi sırasında tüm % 2.5 isoflurane 1, 5 L/dk oksijen ile sürekli bir tedarik altında hayvanlardır.<ol>
<li>Tıkırtı eğe > canlı ve el ile fare üzerinde odaklanmak.</li>
		<li>Pozlama zaman ve lazer yoğunluğunu seçin.</li>
		<li>Tıklama elde etmek > yakalamak.</li>
	</ol>
</li>
	<li>Ex vivo görüntüleme için fareler tarafından servikal çıkığı ötenazi ve virüslü fareleri tüm bağırsak kaldırın. Bağırsak bir 9-cm Petri kabına ve resim görüntüleme sistemi içinde vivo tarafından yerleştirin. Aynı görüş alanı A/b olarak ayarlanır dışında vivo içinde görüntüleme ayardır Lütfen ayrıntılar için Bölüm 5 "Veri toplama" bakın. Not: Yöntem servikal yerinden çıkması için: kafes üstünde fare böylece hayvanları kafes kavrama tek elle kuyruk açgözlü dizginlemek. Pen marker veya başparmak ve ilk parmak boyun arkası karşı diğer el kafatası tabanında yer. Hızlı bir şekilde el veya nesne ile baş frenleyici push ileri ve kuyruğunu tutan el ile geri çekin. Yakından solunum durması ve kalp atışı yoktu onaylamak için kontrol edin.</li>
</ol>5. veri toplama
Not: yazılım veri toplama için kullanılan Malzemeler tablolistelenir.
<ol><li>Resim alma için satın alma kontrol panelinin yazılımı (Şekil 2) açın.</li>
	<li>Seç "ışıklı," "Fotoğraf" ve "Overlay"</li>
	<li>Pozlama süresi "Otomatik" olarak ayarlayın "Orta" Binning ayarla</li>
	<li>Işıksaçan ve 8 için ƒ/1 durağı ayarlamak fotoğraf için. Ƒ/durdur denetimleri ışık miktarını CCD algılayıcısı tarafından aldı.</li>
	<li>Görüntüleri elde etmek için ilgi alanına göre görüş alanı ayarlayın. Seçenek "D" beş 6-hafta-yaşlı fareler uygun ve onları teker teker görüntü. "C" üç 6-hafta-yaşlı fare bir alandaki görüntü.</li>
	<li>Fare/örnekleri görüntüleme için hazır olduğunuzda, resim alma için "Al" düğmesini tıklatın.</li>
	<li>Satın alınan görüntü verilerini açın.</li>
	<li>Araç paleti paneli (şekil 3) açın.</li>
	<li>ROI araçlarını seçin. Daire (en soldaki bir) (şekil 4) görüntülerde kollarındaki alan aralığı için tavsiye ediyoruz.</li>
	<li>"Ölçü yüzey kollarındaki yoğunluğu (şekil 3) ölçmek için ROIs" (kalem simgesi) tıklatın. Yatırım Getirisi ölçümleri panelinde ve miktar değerleri (şekil 5) görünür.</li>
	<li>Yapılandırmak ölçü ROI ölçüm panelinin sol köşesinde değerleri/gerekli bilgileri (şekil 6) seçin, aksi takdirde "Bu veri tablosunu verin ve .csv dosyası (şekil 5) olarak kaydetmek için Dışa Aktar" düğmesini tıklatın için kullanın.</li>
	<li>Kollarındaki yoğunluğu miktar .csv dosyasındaki değerleri sütun "Toplam akı (p/s)" kullanın.</li>
</ol>

<ol>
	<li>Pennington, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+O157.">Escherichia coli O157.</a> Lancet. 376 (9750), 1428-1435 (2010).</li><li>Mayer, C. L., Leibowitz, C. S., Kurosawa, S., Stearns-Kurosawa, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shiga+toxins+and+the+pathophysiology+of+hemolytic+uremic+syndrome+in+humans+and+animals.">Shiga toxins and the pathophysiology of hemolytic uremic syndrome in humans and animals.</a> Toxins (Basel). 4 (11), 1261-1287 (2012).</li><li>Tarr, P. I., Gordon, C. A., Chandler, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shiga-toxin-producing+Escherichia+coli+and+haemolytic+uraemic+syndrome.">Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome.</a> Lancet. 365 (9464), 1073-1086 (2005).</li><li>Obrig, T. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Shiga+Toxin+Mechanisms+of+Action+in+Renal+Disease.">Escherichia coli Shiga Toxin Mechanisms of Action in Renal Disease.</a> Toxins (Basel). 2 (12), 2769-2794 (2010).</li><li>Nguyen, Y., Sperandio, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohemorrhagic+E.+coli+(EHEC)+pathogenesis.">Enterohemorrhagic E. coli (EHEC) pathogenesis.</a> Front Cell Infect Microbiol. 2, 90 (2012).</li><li>Wiles, S., Robertson, B. D., Frankel, G., Kerton, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioluminescent+monitoring+of+in+vivo+colonization+and+clearance+dynamics+by+light-emitting+bacteria.">Bioluminescent monitoring of in vivo colonization and clearance dynamics by light-emitting bacteria.</a> Methods Mol Biol. 574, 137-153 (2009).</li><li>Hutchens, M., Luker, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+bioluminescence+imaging+to+the+study+of+infectious+diseases.">Applications of bioluminescence imaging to the study of infectious diseases.</a> Cell Microbiol. 9 (10), 2315-2322 (2007).</li><li>Rhee, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+spatial+and+temporal+colonization+of+enteropathogenic+E.+coli+and+enterohemorrhagic+E.+coli+in+mice+using+bioluminescent+in+vivo+imaging.">Determination of spatial and temporal colonization of enteropathogenic E. coli and enterohemorrhagic E. coli in mice using bioluminescent in vivo imaging.</a> Gut Microbes. 2 (1), 34-41 (2011).</li><li>Karsi, A., Lawrence, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broad+host+range+fluorescence+and+bioluminescence+expression+vectors+for+Gram-negative+bacteria.">Broad host range fluorescence and bioluminescence expression vectors for Gram-negative bacteria.</a> Plasmid. 57 (3), 286-295 (2007).</li><li>Lane, M. C., Alteri, C. J. S., Smith, S. N., Mobley, L. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+flagella+is+coincident+with+uropathogenic+Escherichia+coli+ascension+to+the+upper+urinary+tract.">Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract.</a> Proc Natl Acad Sci U S A. 104 (42), 16669-16674 (2007).</li><li>Roxas, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohemorrhagic+E.+coli+alters+murine+intestinal+epithelial+tight+junction+protein+expression+and+barrier+function+in+a+Shiga+toxin+independent+manner.">Enterohemorrhagic E. coli alters murine intestinal epithelial tight junction protein expression and barrier function in a Shiga toxin independent manner.</a> Lab Invest. 90 (8), 1152-1168 (2010).</li><li>Siragusa, G. R., Nawotka, K., Spilman, S. D., Contag, P. R., Contag, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Real-Time Monitoring of Escherichia coli O157:H7 Adherence to Beef Carcass Surface Tissues with a Bioluminescent Reporter. , (1999).</li><li>Kuo, C. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutation+of+the+Enterohemorrhagic+Escherichia+coli+Core+LPS+Biosynthesis+Enzyme+RfaD+Confers+Hypersusceptibility+to+Host+Intestinal+Innate+Immunity+In+vivo.">Mutation of the Enterohemorrhagic Escherichia coli Core LPS Biosynthesis Enzyme RfaD Confers Hypersusceptibility to Host Intestinal Innate Immunity In vivo.</a> Front Cell Infect Microbiol. 6, 82 (2016).</li><li>Wiles, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organ+specificity,+colonization+and+clearance+dynamics+in+vivo+following+oral+challenges+with+the+murine+pathogen+Citrobacter+rodentium.">Organ specificity, colonization and clearance dynamics in vivo following oral challenges with the murine pathogen Citrobacter rodentium.</a> Cell Microbiol. 6 (10), 963-972 (2004).</li><li>Wiles, S., Pickard, K. M., Peng, K., MacDonald, T. T., Frankel, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+bioluminescence+imaging+of+the+murine+pathogen+Citrobacter+rodentium.">In vivo bioluminescence imaging of the murine pathogen Citrobacter rodentium.</a> Infect Immun. 74 (9), 5391-5396 (2006).</li><li>Contag, C. H., Contag, P. R., Mullins, J. I., Spillman, S. D., Stevenson, D. K., Benaron, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Photonic+detection+of+bacterial+pathogens+in+living+hosts.">Photonic detection of bacterial pathogens in living hosts.</a> Mol Microbiol. 18 (4), 593-603 (1995).</li><li>Hardy, J., Francis, K. P., DeBoer, M., Chu, P., Gibbs, K., Contag, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extracellular+replication+of+Listeria+monocytogenes+in+the+murine+gall+bladder.">Extracellular replication of Listeria monocytogenes in the murine gall bladder.</a> Science. 303 (5659), 851-853 (2004).</li><li>Kaniga, K., Sory, M. P., Delor, I., Saegerman, C., Limet, J. N., Cornelis, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+of+Yersinia+enterocolitica+in+Murine+and+Bovine+Feces+on+the+Basis+of+the+Chromosomally+Integrated+luxAB+Marker+Gene.">Monitoring of Yersinia enterocolitica in Murine and Bovine Feces on the Basis of the Chromosomally Integrated luxAB Marker Gene.</a> Appl Environ Microbiol. 58 (3), 1024-1026 (1992).</li><li>Trcek, J., Fuchs, T. M., Trulzsch, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Yersinia+enterocolitica+invasin+expression+in+vitro+and+in+vivo+using+a+novel+luxCDABE+reporter+system.">Analysis of Yersinia enterocolitica invasin expression in vitro and in vivo using a novel luxCDABE reporter system.</a> Microbiology. 156 (Pt 9), 2734-2745 (2010).</li><li>Morin, C. E., Kaper, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stabilized+luciferase-expressing+plasmids+to+examine+in+vivo-induced+promoters+in+the+Vibrio+cholerae+vaccine+strain+CVD+103-HgR.">Use of stabilized luciferase-expressing plasmids to examine in vivo-induced promoters in the Vibrio cholerae vaccine strain CVD 103-HgR.</a> FEMS Immunol Med Microbiol. 57 (1), 69-79 (2009).</li><li>Law, R. J., Gur-Arie, L., Rosenshine, I., Finlay, B. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+model+systems+for+studying+enteropathogenic+Escherichia+coli+infections.">In vitro and in vivo model systems for studying enteropathogenic Escherichia coli infections.</a> Cold Spring Harb Perspect Med. 3 (3), a009977 (2013).</li><li>Ritchie, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+Models+of+Enterohemorrhagic+Escherichia+coli+Infection.">Animal Models of Enterohemorrhagic Escherichia coli Infection.</a> Microbiol Spectr. 2 (4), EHEC-0022-2013 (2014).</li><li>Chou, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enterohaemorrhagic+Escherichia+coli+O157:H7+Shiga-like+toxin+1+is+required+for+full+pathogenicity+and+activation+of+the+p38+mitogen-activated+protein+kinase+pathway+in+Caenorhabditis+elegans.">Enterohaemorrhagic Escherichia coli O157:H7 Shiga-like toxin 1 is required for full pathogenicity and activation of the p38 mitogen-activated protein kinase pathway in Caenorhabditis elegans.</a> Cell Microbiol. 15 (1), 82-97 (2013).</li><li>Alexeyev, M. F., Shokolenko, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mini-Tnl+0+transposon+derivatives+for+insertion+mutagenesis+and+gene+delivery+into+the+chromosome+of+Gram-negative+bacteria.">Mini-Tnl 0 transposon derivatives for insertion mutagenesis and gene delivery into the chromosome of Gram-negative bacteria.</a> Gene. 160 (1), 59-62 (1995).</li><li>Wiegand, I., Hilpert, K., Hancock, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agar+and+broth+dilution+methods+to+determine+the+minimal+inhibitory+concentration+(MIC)+of+antimicrobial+substances.">Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances.</a> Nat Protoc. 3 (2), 163-175 (2008).</li><li>Pansare, V., Hejazi, S., Faenza, W., Prud'homme, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+of+Long-Wavelength+Optical+and+NIR+Imaging+Materials:+Contrast+Agents,+Fluorophores+and+Multifunctional+Nano+Carriers.">Review of Long-Wavelength Optical and NIR Imaging Materials: Contrast Agents, Fluorophores and Multifunctional Nano Carriers.</a> Chem Mater. 24 (5), 812-827 (2012).</li><li>Heim, R., Cubitt, A. B., Tsien, R. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+green+fluorescence.">Improved green fluorescence.</a> Nature. 373 (6516), 663-664 (1995).</li><li>Weissleder, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+clearer+vision+for+in+vivo+imaging.">A clearer vision for in vivo imaging.</a> Nat Biotechnol. 19 (4), 316-317 (2001).</li><li>Frangioni, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+near-infrared+fluorescence+imaging.">In vivo near-infrared fluorescence imaging.</a> Current Opinion in Chemical Biology. 7 (5), 626-634 (2003).</li><li>Collins, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Citrobacter+rodentium:+infection,+inflammation+and+the+microbiota.">Citrobacter rodentium: infection, inflammation and the microbiota.</a> Nat Rev Microbiol. 12 (9), 612-623 (2014).</li><li>Mallick, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+murine+infection+model+for+Shiga+toxin-producing+Escherichia+coli.">A novel murine infection model for Shiga toxin-producing Escherichia coli.</a> J Clin Invest. 122 (11), 4012-4024 (2012).</li><li>Petty, N. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Citrobacter+rodentium+genome+sequence+reveals+convergent+evolution+with+human+pathogenic+Escherichia+coli.">The Citrobacter rodentium genome sequence reveals convergent evolution with human pathogenic Escherichia coli.</a> J Bacteriol. 192 (2), 525-538 (2010).</li><li>Kovach, M. E., Elzer, P. H., Hill, D. S., Robertson , G. T., Farris, M. A., Roop, R. M., Peterson, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Four+new+derivatives+of+the+broad-host-range+cloning+vector+pBBR1MCS,+carrying+different+antibiotic-resistance+cassettes.">Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes.</a> Gene. 166 (1), 175-176 (1995).</li><li>Galen, J. E., Nair, J., Wang , J. Y., Wasserman, S. S., Tanner, M. K., Sztein , M. B., Levine, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+Plasmid+Maintenance+in+the+Attenuated+Live+Vector+Vaccine+Strain+Salmonella+typhiCVD+908-htrA.">Optimization of Plasmid Maintenance in the Attenuated Live Vector Vaccine Strain Salmonella typhiCVD 908-htrA.</a> Infect Immun. 67 (12), 6424-6433 (1999).</li><li>Francis, K. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+pneumococcal+infections+in+the+lungs+of+live+mice+using+bioluminescent+Streptococcus+pneumoniae+transformed+with+a+novel+gram-positive+lux+transposon.">Visualizing pneumococcal infections in the lungs of live mice using bioluminescent Streptococcus pneumoniae transformed with a novel gram-positive lux transposon.</a> Infect Immun. 69 (5), 3350-3358 (2001).</li><li>Goldwater, P. N., Bettelheim, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treatment+of+enterohemorrhagic+Escherichia+coli+(EHEC)+infection+and+hemolytic+uremic+syndrome+(HUS).">Treatment of enterohemorrhagic Escherichia coli (EHEC) infection and hemolytic uremic syndrome (HUS).</a> BMC Med. 10, (2012).</li></ol>

Yazarlar ifşa gerek yok.

Bu luciferase plazmid ile dönüştürülmüş EHEC onun Yerelleştirme Ana bilgisayarlar veya gen ifade vivo içinde8,11,12incelemek için kullanılan bildirilmiştir. Aşağıda gösterildiği fare modeli ayrıca fare ana bilgisayar8' bulmak belgili tanımlık kolonize EHEC zamanlama ve yerelleştirme bildirilmiştir. Yine de, biz, farelere EHEC aşılama intragastrically yönetmek ve kollarındaki bakteri oral gavaj için dikkatlice hazırlanmanız ayrıntı iletişim kuralı sağlar. Özellikle, sonda ile besleme iğne takıldığında EHEC (Adım 3.7) fare oral gavaj için fare baş konumu önemlidir. Dikey konumu yoksa, iğne geçmek zor olacak ve muhtemelen fare zarar. Sonda ile besleme iğne fareyi, ağız içinde olduğunda 3.8 adımda dilini ağız dışında biraz yatıyordu olacaktır. Direnç sonda ile besleme iğne yemek borusu geçerken oluşursa, iğne ileri hareket etmeyi bırak ve hemen geri. İğne özofagus giriyor emin olmak için iğne pozisyon değiştirin. Direnç, hangi bakteri mide yerine akciğerlerde enjekte için yol açacak oluştuğunda iğne Trakea girerek.
Bir Biyoalgılayıcı olarak yeşil flüoresan protein (GFP) uygulama biyolojik deneylerde yaygındır. Ancak, GFP patojen bulaşma/kolonizasyon yanında vivo içinde düşsel Canlı hayvanlarda tavsiye edilmez, çünkü Absorbans hemoglobin, proteinler ve su tarafından hangi ile çakışıyor 200-650 nm26arasında yüksek gözlemlemek için muhabir olarak kullanma GFP (uyarma 480 nm, emisyon 510 nm)27. Bu nedenle, GFP kullanarak vivo içinde görüntüleme için bir muhabir olarak sinyal hemoglobin, proteinler ve hayvanlar26su tarafından durdurulabilir. Yakın kızılötesi (Nur) floresan çevresinde onun Absorbans pencere olduğu için vivo içinde görüntüleme için ideal olan en düşük emme katsayısı hemoglobin bölgede 650-900 nm28, (< 650 nm) ve su (> 900 nm)26 ,28 . Ayrıca, doku ışık emer olduğunda autofluorescence ikna etmek için bir şans. GFP penceresinde uyarma ve emisyon dalga boyu aralığı zaman NIR29daha çok daha fazla autofluorescence neden olmaktadır. NIR kullanımı sinyal GFP autofluorescence arka plan29ortadan kaldırarak kıyasla arka plan oranı artırabilir. Bioluminescence görünür ışık üretmek için enerji uyarma gerektirmez. Substrat biyoluminesans onun enzim luciferase tarafından katalize ve ışık oluşturmak için tepki olarak bağlıdır. Bioluminescence ışık doğrudan bir örnek gerektirmez, arka plan sinyal bir örnekten çok düşüktür. Bu nedenle, daha genel ve vivo içinde görüntüleme için daha kolay bir muhabir olan biyolüminesans kullanın. Buna ek olarak, Floresan ışık uyarma sinyal ışık ikna etmek için gerektirir. Doku ışık absorbe olduğunda bir şans Floresan ışık yayılan ve böylece onların sinyal gürültü daha bu bioluminescence göre autofluorescence ikna etmek.
EHEC doğal olarak daha az oral enfeksiyon2,22tarafından fareler kolonize olduğunu düşünürsek, Sitrobacter rodentium, adı verilen farelerin doğal Mukozal patojen fare ana bilgisayara kolonizasyon mekanizması çalışmaya kullanılmıştır bir bakteri22,30vekil. EHEC ve C. rodentium her ikisi de bağırsak mukoza kolonize ve ana bilgisayar22,30A/E lezyonlarının oluşumu teşvik. Ayrıca bir T3SS ve A/E lezyon22,30indüklenen çeşitli efektör Protein kodlayan LEE patojenitesi adanın içerirler. Bu nedenle,14, luciferase C. rodentium kolonizasyon patoloji tespit ve kolonizasyon mekanizması içinde vivo görüntüleme sistemi ile çalışma bir muhabiri de olduğu gibi plazmid ifade kullanımı bildirdi 15. C. rodentium enfeksiyon farelerin T3SS fonksiyonu ve A/E lezyon mekanizmasının araştırmak için uzun bir faydalı model olsa da, yine de, C. rodentium Shiga toksin (Stx)30, bir baskın olduğu içermiyor EHEC, özellikle serotip O157: H73böbrek yetmezliği nedenleri virülans faktörü. Stx ifade C. rodentium zorlanma inşa edilmiştir, ancak son zamanlarda EHEC enfeksiyona daha gerçekçi olan31, bu kolonizasyon ve/veya enfeksiyon için çok önemli potansiyel diğer EHEC virülans faktörleri içermez. Ayrıca, C. rodentium , genlerin % 67 EHEC32EHEC virülans C. rodentium farklı kolonizasyon ve/veya enfeksiyon sırasında kullanabilir öneriyor, paylaşır.
Burada, pWF27913, kullanılan plazmid ifade luciferase olan omurga pBBR1MCS433pAKlux29 güncellenmiştir. PBBR1MCS4 test edilmiş ve çeşitli bakteri33olarak çoğaltılan, çoğaltma (ORI) bu plazmid kökenli olup bakteriyel ana bilgisayar için uygun bu luciferase plazmid tabanlı sistem denemenin kullanmadan önce emin olmak çok önemli olsa da ve Böylece teyit plazmid ifade bu luciferase bakteriyel konak çoğaltabilirsiniz. Antibiyotik stres plazmid Candidatus kararlılığını korumak için kullanıyoruz. Bakterilerin antibiyotik yokluğunda hayvanlar girdiğinizde, vahşi tipi EHEC kollarındaki sinyal en az 2 gün için algılandı. Ancak, biz zaten Işıksaçan yoğunluğu önemli bir fark (Bu bir gen sağlam LPS sentezleme EHEC için gerekli kodlar) EHEC rfaD arasındaki EHEC WT gördüğüm için enfeksiyon 2 gün daha uzun süre takip değil 2 gün, mutant. Plazmid stabil bakterilerde antibiyotik yokluğu altında korumak için plazmid pCM1710,34 bu amaç için kullanılabilir. pCM17 bir iki-plazmid bölümleme sistemi ve bakterilerde antibiyotik10,34yokluğunda plazmid bakım sağlamak için bir post-segregational öldürme mekanizması kodlar. Plazmid pCM17 OmpC düzenleyici tarafından tahrik luxCDABE operon tarafından en az 7 gün8için kollarındaki sinyal tespit edilebilir içeren. Sürekli kollarındaki ifade bakteriler antibiyotikler yokluğunda elde etmek için alternatif bir yöntem bakteriyel kromozom35 luxABCDE gen eklemektir. Francis kullanılan vd. transposon rastgele bioluminescence stabil zorlanma35elde etmek için Streptococcus pneumoniae kromozom eklenen luxABCDE operon ve antibiyotik kaset eklenmiş.
Bizim önceki çalışma13' te, EHEC kolonizasyon bir ev sahibi incelemek ve kolonizasyon yetenek EHEC vahşi türü (WT) ve mutant13arasında fark karşılaştırmak için bu modeli sistemi kullanılmaktadır. Ne zaman fare yönetilen kollarındaki EHEC rfaD mutant önemli ölçüde azalmış kollarındaki sinyalleri için WT EHEC 2 gün sonra enfeksiyon sonrası karşılaştırıldığında. Bu fare modeli EHEC kolonizasyon ev sahibi mutasyon etkisini çözümleyebilirsiniz kanıt sağlar. Ayrıca, EHEC kolonizasyon azaltmak için tedavi tedaviler bir çözümdür düşünülmüş, potansiyel EHEC enfeksiyon için antibiyotik kullanımı kontrendikedir5,36olduğundan. Bu nedenle, bu test değer bu modeli sistem ev sahibi enterobacteria kolonizasyon karşı anti-kolonizasyon uyuşturucu/tedavi etkinliği incelemek için kullanılıp kullanılamayacağını. Bu model sistem kullanarak, bu zamanlama ve EHEC değil sadece, aynı zamanda diğer enterobacteria kolonizasyon içinde vivokonumunu incelemek mümkün olduğuna inanıyoruz. Bu hayvan modeli kullanarak, farelerde EHEC kolonizasyon sürecinin izlenebilir ve kolonizasyon yükü ana EHEC kayma ve temporal kolonizasyon Canlı hayvanlarda belirlemek için sayılabilir. Görselleştirme ve miktar bu modeli kullanarak enterobacteria kolonizasyon araştırmak ve enterobacterial kolonizasyon iyi mekanizmalarını analiz ve böylece kolonizasyon araştırma eksikliği telafi etmek için harika bir araç yapar ve Geçerli bilgi geliştirmek.

EHEC O157: H7 nedenleri ishal1, HS2, HUS3ve hatta Akut böbrek yetmezliği4 kontamine su veya gıda ile bir patojen var. EHEC patojenik bir enterobacterium olduğunu ve insanların1gastrointestinal sistem colonizes. EHEC ilk uygun zaman ana bağırsak epiteli, kolonizasyon faktörler bir bağlama inducing ve daha sonra zorlamak için (A/E) lezyon effacing moleküler bir şırınga işlev gören tür III salgı sistemi (T3SS) ile ana hücreleri içine enjekte yapışma (kolonizasyon)5. Bu genlerin A/E lezyon oluşumunda yer alan Enterocytes efasman (LEE) patojenitesi ada5locus tarafından kodlanır.
Bioluminescence olduğunu ışık üreten kimyasal reaksiyon, görünür ışık6oluşturmak için onun substrat biyoluminesans hangi luciferase tromboksan. Enzimatik bu işlem genellikle oksijen veya adenozin trifosfat (ATP)6varlığını gerektirir. (BLI) görüntüleme bioluminescence araştırmacılar canlı hayvan7görselleştirme ve ana bilgisayar-patojen etkileşimlerin niceleme sağlar. Saçınıza canlı hayvan bakteriyel enfeksiyon döngüsünde onlar göç ve farklı dokular7istila kollarındaki bakteri izleyerek karakterize olabilir; Bu enfeksiyon dinamik bir ilerleme ortaya koymaktadır. Ayrıca, hayvanlarda bakteri yükü kollarındaki sinyal8' e ilişkilidir; Böylece, deneysel hayvan patolojik şartları basit ve doğrudan bir şekilde tahmin etmek için uygun bir göstergedir.
Burada kullanılan plazmid luciferase operon, bakteri, kendi luciferase substrat7,9kodlar Photorhabdus luminescens olan luxCDABE, yer. Bu luciferase ifade plazmid bakteri dönüştürerek, canlı hayvan kollarındaki bu bakteri gözlemleyerek kolonizasyon ve enfeksiyon işlemleri izlenebilir. Genel olarak, alma ve bioluminescence etiketli bakteri araştırmacılar bakteri numaraları ve konumu, bakteriyel canlılığı antibiyotikler/tedavi ve bakteri gen ekspresyonu enfeksiyon/kolonizasyon6, ile izlemek izin 7. çok sayıda patojen bakteri enfeksiyonu onların enfeksiyon döngüsü ve/veya gen ifade incelemek için luxCDABE operon express bildirilmiştir. Bu bakterilerin uropathogenic E. coli10, EHEC8,11,12,13, enteropathogenic de dahil olmak üzere, E. coli (EPEC)8, Sitrobacter rodentium14,15, Salmonella typhimurium16, Listeria Monositogenez17, Yersinia enterocolitica18,19, ve Vibrio cholerae20, dokümante edilmiştir.
EHEC kolonizasyon vitro ve in vivo21,22,23çalışma kolaylaştırmak için çeşitli modeller geliştirilmiştir. Ancak, EHEC kolonizasyon vivo içindeçalışmaya uygun hayvan modellerin eksikliği ve böylece ayrıntılar ortaya çıkan bir yetersizliği olduğunu. EHEC kolonizasyon mekanizması vivo içindeçalışma kolaylaştırmak için gözlemlemek ve non-invaziv bir yöntem canlı hayvan EHEC kolonizasyon ölçmek için hayvan modelleri oluşturmak için değerlidir.
Bu el yazması kollarındaki ifade sisteminin EHEC kolonizasyon zaman içinde yaşayan ana bilgisayarları izlemek için kullandığı bir fare-EHEC kolonizasyon modeli açıklar. Fareler intragastrically bioluminescence etiketli EHEC ile aşılanmış ve kollarındaki sinyal farelerde sistem13Imaging bir non-invaziv vivo içinde ile algılanır. Sonra 2 gün sonra 2 gün enfeksiyon sonrası bu bakteri konak bağırsaklarda kolonize önerilen enfeksiyon sonrası önemli kollarındaki sinyalleri onların bağırsaklarda gösterdi EHEC bioluminescence etiketli fareler bulaşmış. Ex vivo görüntü verilerini bu kolonizasyon özellikle çekum ve kolon farelerin olduğunu gösterdi. Bu fare-EHEC modelini kullanarak, kollarındaki EHEC kolonizasyon yaşam ana bilgisayarında bir görüntüleme sistemi daha fazla anlayış teşvik edebilir enterik bakteri kolonizasyonu detaylı mekanizmaları incelemek için in vivo tarafından tespit edilebilir EHEC kaynaklı fizyolojik ve patolojik değişiklikler.

<table border="0" cellpadding="0" cellspacing="0" width="721">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Shaker incubator</td>
			<td style="width:175px;">YIH DER</td>
			<td style="width:143px;">LM-570R</td>
			<td style="width:167px;">bacteria incubation&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Orbital shaking incubator</td>
			<td style="width:175px;">FIRSTEK</td>
			<td style="width:143px;">S300</td>
			<td>bacteria incubation&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">pBSL180</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>source of nptII gene</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pAKlux2</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>source of luxCDABE operon</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">T&#38;A Cloning Kit</td>
			<td>Yeastern Biotech</td>
			<td style="width:143px;">FYC001-20P</td>
			<td>use for TA cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nsi I</td>
			<td style="width:175px;">NEB</td>
			<td>R0127S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sca I</td>
			<td style="width:175px;">NEB</td>
			<td>R0122S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Spe I-HF</td>
			<td style="width:175px;">NEB</td>
			<td>R0133S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sma I&#160;</td>
			<td style="width:175px;">NEB</td>
			<td>R0141S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">T4 ligase</td>
			<td style="width:175px;">NEB</td>
			<td style="width:143px;">M0202S</td>
			<td>use for plasmid cloning&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Ex Taq</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">10X Ex Taq Buffer</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">dNTP Mixture&#160;</td>
			<td style="width:175px;">TaKaRa</td>
			<td>RR001A</td>
			<td>use for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">PCR machine</td>
			<td style="width:175px;">applied Biosystem&#160;</td>
			<td style="width:143px;">2720 thermal cycler&#160;</td>
			<td>&#160;for PCR amplification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Glycerol</td>
			<td style="width:175px;">SIGMA</td>
			<td style="width:143px;">G5516-1L</td>
			<td>use for bacteria stocking solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">NaCl</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">31434-5KG-R</td>
			<td>chemical for making LB medium, 10 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Tryptone</td>
			<td style="width:175px;">CONDA pronadisa</td>
			<td style="width:143px;">Cat 1612.00</td>
			<td>chemical for making LB medium, 10 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Yeast Extract powder</td>
			<td style="width:175px;">Affymetrix</td>
			<td style="width:143px;">23547-1 KG</td>
			<td>chemical for making LB medium, 5 g/L</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Agar</td>
			<td style="width:175px;">CONDA pronadisa</td>
			<td style="width:143px;">Cat 1802.00</td>
			<td>chemical for making LB agar</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">kanamycin&#160;</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">K4000-5G</td>
			<td>antibiotics, use for seleciton</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">streptomycin&#160;</td>
			<td style="width:175px;">Sigma</td>
			<td style="width:143px;">S6501-100G</td>
			<td>antibiotics, eliminate the microbiota in mice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">EDL933 competent cell</td>
			<td style="width:175px;">Homemade</td>
			<td style="width:143px;"></td>
			<td>method is on supplemental document&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Electroporator</td>
			<td style="width:175px;">MicroPulser</td>
			<td style="width:143px;"></td>
			<td>for electroporation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Electroporation Cuvettes</td>
			<td style="width:175px;">Gene Pulser/MicroPulser</td>
			<td style="width:143px;">1652086</td>
			<td>for electroporation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">High-speed centrifuge</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">Avanti, J-26S XP</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fixed-Angle Rotor</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">JA25.5</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Fixed-Angle Rotor</td>
			<td style="width:175px;">Beckman Coulter</td>
			<td style="width:143px;">JLA10.5</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifuge bottles</td>
			<td>Beckman Coulter</td>
			<td>REF357003</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">centrifuge bottles</td>
			<td style="width:175px;">Thermo Fisher scientific</td>
			<td style="width:143px;">3141-0500</td>
			<td>use for centrifuging bacteria&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">eppendorf biophotometer plus&#160;</td>
			<td>eppendorf</td>
			<td>AG 22331 hamburg</td>
			<td>for measuring the OD600 value of bacteria</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">C57BL/6 mice&#160;</td>
			<td colspan="2">Laboratory Animal Center of NCKU</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">lab coat, gloves</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>for personnel protection&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">isoflurane&#160;</td>
			<td>Panion &#38; BF Biotech Inc.</td>
			<td style="width:143px;">G-8669</td>
			<td>for mice anesthesia, pharmaceutical grade</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1ml syringe&#160;</td>
			<td style="width:175px;"></td>
			<td style="width:143px;"></td>
			<td>use for oral gavage of mice</td>
		</tr>
		<tr height="21">
			<td colspan="2" height="21" style="height:21px;">Reusable 22 G ball-tipped feeding needle</td>
			<td style="width:143px;">&#966;0.9 mm X L 50 mm</td>
			<td>use for oral gavage of mice</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">surgical&#160; scissors&#160;</td>
			<td></td>
			<td style="width:143px;"></td>
			<td>use for mice experiment</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Xenogen IVIS 200 imaging system</td>
			<td>Perkin Elmer</td>
			<td>IVIS spectrum</td>
			<td>use for bioluminescent image capture&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:237px;">Living Image Software</td>
			<td>Perkin Elmer</td>
			<td style="width:143px;">version 4.1</td>
			<td>use for quantifying the image data</td>
		</tr>
	</tbody>
</table>

detection of enterohemorrhagic escherichia coli colonization in murine host by non-invasive in vivo bioluminescence system

Enterohemorrhagic E. coli (EHEC) O157: H7, hangi o causesdiarrhea, Hemorajik kolit (HS), gıda kaynaklı patojen olduğunu ve hemolitik üremik Sendromu (HUS), kolonize insanlar bağırsak için. EHEC kolonizasyon içinde vivo detaylı mekanizması çalışmaya EHEC kolonizasyon ölçmek ve izlemek için hayvan modelleri olması esastır. Burada bir fare-EHEC kolonizasyon modeli kollarındaki ifade plazmid EHEC izlemek ve yaşam ana EHEC kolonizasyon ölçmek için dönüşüm tarafından göstermektedir. Bioluminescence etiketli EHEC ile aşılanmış hayvanlar yoğun kollarındaki sinyalleri farelerde algılama tarafından görüntüleme sistemi bir non-invaziv vivo içinde ile göstermek. Sonra 1-2 gün enfeksiyon sonrası, kollarındaki sinyalleri hala enfekte hayvanlarda da EHEC konaklarda en az 2 gün için kolonize gösterir tespit edilemedi. Biz de bu kollarındaki EHEC bulun ki fare Bağırsaklarda, özellikle çekum ve iki nokta üst üste, için ex vivo imge--dan göstermek. Bu fare-EHEC kolonizasyon model EHEC kolonizasyon mekanizma mevcut bilgi ilerlemek için bir araç olarak hizmet verebilir.

Bioluminescence etiketli EHEC yönetilen (~ 109 bakteri hücreleri) 6 - hafta eski kadın C57BL/6 farelere oral gavaj tarafından. EHEC farelere 1s içinde sözlü aşı sonra hayvanlar kollarındaki sinyali VIVO içinde görüntüleme sistemi Şekil 7gösterildiği gibi tarafından incelenmiş. Sonuçlar sonda ile besleme farelerde bioluminescence etiketli EHEC ile güçlü bir kollarındaki sinyal gösterdi. Biz 2 gün sonrası enfeksiyon sinyalleri inceledi. Şekil 8Aiçinde gösterildiği gibi ile EDL933 sonra bile 2 gün EHEC konaklarda 2 gün kolonize önerilen enfeksiyon sonrası yoğun kollarındaki sinyalleri gösterdi vahşi tipi EHEC bioluminescence etiketli fareler aşılandı. Biz de intragastrically bioluminescence etiketli EDL933ΔrfaD (ΔrfaD) farelere (şekil 8A) hasta. Bu mutant iltica lipopolysaccharide (LPS), kolonizasyon konak önceki çalışma azaltmak için gösterilmiştir. Şekil 8Aiçinde gösterildiği gibi ΔrfaDiçinde tespit kollarındaki sinyal var-yok veya daha az bakteri olduğunu göstermektedir virüslü fareleri hücreleri kolonize fareler. Miktar floresan sinyal resim 8Biçinde gösterilir. Daha sonra bu bioluminescence etiketli bakteri konumunu tespit edilmiştir. Virüslü fareleri insanca kurban edildi ve onların tüm ince bağırsak kaldırıldı. Fareler 2 gün sonrası enfeksiyon bağırsağından 9 cm Petri yemekler üzerinde konumlandırılmış ve ex vivo (Þekil 9A) görüntüsü. Bioluminescence etiketli enfekte EDL933 fareler bağırsak dokuların kollarındaki sinyaller çekum ve iki nokta üst üste, kollarındaki bu EHEC 2 gün için çekum ve virüslü farelerin kolon kolonize olduğunu öneren de önemli bir artış ortaya En azından. Buna ek olarak, ortaya bioluminescence etiketli ΔrfaD ile (Þekil 9A), enfekte fareler kollarındaki sinyali VIVO içinde görüntü (şekil 8A ile tutarlıdır onların bağırsak dokusunda azalma ). Miktar floresan sinyal şekil 9Biçinde gösterilir.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56169/56169fig1.jpg"> Resim 1 : Zaman çizelgesi deneysel hazırlık akış şeması,. Zamanlama bakış kollarındaki EHEC bakteri hazırlamak ve streptomisin ile fareler pretreat gerekiyordu. (A) EHEC hazırlık. (B) fareler hazırlık. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56169/56169fig2.jpg"> Resim 2 : Vivo sistemi edinme Denetim Masası Imaging. Örnekleri Imaging önce IVIS edinme kontrol panelini açın. Seç "ışıklı," "Fotoğraf" ve "Overlay" Pozlama süresi "Otomatik" olarak ayarlayın "Orta" Binning ayarla Işıksaçan ve 8 için ƒ/1 durağı ayarlamak fotoğraf için. Ƒ/durdur denetimleri ışık miktarını CCD algılayıcısı tarafından aldı. Örnekleri görüntüleme için hazır olduğunuzda, görüntüleri elde etmek için "al" düğmesini tıklatın. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56169/56169fig3.jpg"> Şekil 3 : Araç paleti paneli. Elde görüntüsü sonra kollarındaki yoğunluğu miktarının için araç paleti panelini kullanın. Araç paleti panelini açın ve veri görüntü. Görüntülerde kollarındaki sinyal aralığı için yatırım Getirisi araçlarından birini seçin. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56169/56169fig4.jpg"> Şekil 4 : Örnek kollarındaki sinyalini miktar için. Kollarındaki sinyal alanı görüntülerde ROI araçları tarafından çevrili. Burada gösterilen tüm kollarındaki sinyaller kırmızı daire içinde var. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56169/56169fig5.jpg"> Şekil 5 : Yatırım Getirisi ölçümleri. Kollarındaki sinyalleri çember ve "Ölçü ROIs" üzerinde araç paleti Masası'nı tıklatın sonra değerleri gösterildiği gibi sunulmaktadır. Toplam akı (p/s) sütunun değerlerine kollarındaki yoğunluğu miktar için kullanılır. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56169/56169fig6.jpg"> Şekil 6 : Farklı miktar bilgi eklemek. Yapılandırmak ölçüm üzerinde yatırım Getirisi ölçüm panelinin sol köşesinde tıklatarak, diğer istenen miktar değerleri/bilgi seçebilirsiniz. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56169/56169fig7.jpg"> Şekil 7 : Kollarındaki EHEC ile aşılanmış sonra farelerin temsilcisi imaj. Farelerin temsilcisi görüntü ile kollarındaki EHEC 1s içinde sözlü sonda ile besleme tarafından aşılandı. Renk ölçeği parlaklığı (p/s/cm2/sr) temsil eder. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig7large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56169/56169fig8.jpg"> Şekil 8 : Fare görüntülerini aşısını bioluminescence etiketli EHEC ile 2 gün sonra. (A)temsil görüntü farelerin aşısını kollarındaki vahşi türüyle EHEC EDL933 ve EDL933:ΔrfaD sonra 2 gün enfeksiyon sonrası oral gavaj tarafından. (B) miktar bioluminescence yoğunluk farelerin EHEC ile enfekte. Hata çubukları standart sapmalar gösterir. Temsili resim gösterilir. Tüm deneyler bağımsız olarak üç kez 2-3 hayvanlar ile her zaman yapılmıştır ve hata çubukları standart sapmalar gösterir. P-değerleri t-testi ile istatistiksel analiz sonuçlarını gösterir. Renk ölçeği parlaklığı (p/s/cm2/sr) temsil eder. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig8large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/56169/56169fig9.jpg"> Şekil 9 : Virüs bulaşmış fareler bağırsak dokuların görüntülerle bioluminescence etiketli EHEC. (A) 2 gün sonra aşılama ile bioluminescence etiketli EHEC, fareler euthanized ve tüm intestinal doku çıkarıldı ve ex vivogörüntüsü. Temsili resim gösterilir. (B) miktar bioluminescence yoğunluk EHEC ile enfekte fareler gelen bağırsak dokuların. Tüm deneyler bağımsız olarak üç kez 2-3 hayvanlar ile her zaman yapılmıştır ve hata çubukları standart sapmalar gösterir. P-değerleri t-testi ile istatistiksel analiz sonuçlarını gösterir. Renk ölçeği parlaklığı (p/s/cm2/sr) temsil eder. Ölçek çubuğu temsil eder 1 cm. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56169/56169fig9large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Adımları</td>
			<td>Sıcaklık</td>
			<td>Zaman</td>
			<td>Döngü sayısı</td>
		</tr>
<tr>
<td>İlk denatürasyon</td>
			<td>95 ° C</td>
			<td>10 dk</td>
			<td>1</td>
		</tr>
<tr>
<td>Denatürasyon</td>
			<td>95 ° C</td>
			<td>30 sn</td>
			<td rowspan="3">35</td>
		</tr>
<tr>
<td>Tavlama</td>
			<td>58,4 ° C</td>
			<td>30 sn</td>
		</tr>
<tr>
<td>Uzantısı</td>
			<td>72 ° C</td>
			<td>1,5 dk</td>
		</tr>
<tr>
<td>Son uzantısı</td>
			<td>72 ° C</td>
			<td>10 dk</td>
			<td>1</td>
		</tr>
<tr>
<td>Basılı tutun</td>
			<td>4 ° C</td>
			<td>∞</td>
			<td>1</td>
		</tr>
</tbody></table>Tablo 1: Polimeraz zincir reaksiyonu (PCR) koşulları
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Astar adı</td>
			<td>Sıra</td>
		</tr>
<tr>
<td>nptII F</td>
			<td>5' CCTATGCATAATAATTCCGCTAGCTTCACG3'</td>
		</tr>
<tr>
<td>nptII R</td>
			<td>5' GCTCCACCGATAATATTCCTGAGTCATACT3'</td>
		</tr>
</tbody></table>Tablo 2: yükseltmek için kullanılan astar dizileri nptII

Watch this Scientific Journal Video about Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System at JoVE.com

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Bir fare modeli enterohemorrhagic bioluminescence etiketli bakteri kullanarak E. coli (EHEC) kolonizasyon için detaylı bir protokol sunulmuştur. Kollarındaki bu bakteriler tarafından bir non-invaziv görüntüleme sistemi içinde canlı hayvan vivo içinde tespiti geçerli anlayışımız EHEC kolonizasyon ilerletebilirsiniz.

Non-invaziv Vivo içinde Bioluminescence sistemi tarafından fare konak Enterohemorrhagic Escherichia Coli kolonizasyon algılama

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

detection-enterohemorrhagic-escherichia-coli-colonization-murine-host

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

9.4K Görüntüleme.  National Cheng Kung University. Bir fare modeli enterohemorrhagic bioluminescence etiketli bakteri kullanarak E. coli (EHEC) kolonizasyon için detaylı bir protokol sunulmuştur. Kollarındaki bu bakteriler tarafından bir non-invaziv görüntüleme sistemi içinde canlı hayvan vivo içinde tespiti geçerli anlayışımız EHEC kolonizasyon ilerletebilirsiniz.

Video: Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Non-invasive Imaging of Leukocyte Homing and Migration in vivo

Two-photon (2P) microscopy is a high resolution imaging technique that has been broadly adapted by biologists. The value of 2P microscopy is that it provides rich spatiotemporal information regarding cell behaviors within intact tissues and in live mice. Leukocyte recruitment plays a significant role in host defense against infection and when unchecked, can contribute to inflammatory and autoimmune diseases. Studying leukocyte recruitment in vivo is technically challenging since cells are moving rapidly within vessels located deep within light scattering tissues. To date, most intravital imaging studies require surgical preparation to expose the blood vessels and tissues. To avoid the tissue damage and inflammation induced by surgery itself, here, we describe a non-invasive single-cell imaging approach that can be used to study leukocyte trafficking in the mouse footpad and phalanges. We discuss the technical aspects of our 2P imaging preparation and walk the reader through a typical experiment from initial set up to execution and data collection.

Non-invasive Imaging of Leukocyte Homing and Migration in vivo

Here, we describe a non-invasive two-photon (2P) microscopy approach to study leukocyte homing in the mouse footpad. We discuss the technical aspects of our tissue imaging preparation and walk the reader through a typical experiment from initial set up to execution and data collection.

Lökosit Homing Göç ve non-invaziv Görüntüleme In vivo</em

Two-photon (2P) microscopy is a high resolution imaging technique that has been broadly adapted by biologists.  The value of 2P microscopy is that it ...

İmmünoloji ve Enfeksiyon

Non-invasive Imaging of Disseminated Candidiasis in Zebrafish Larvae

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 to 40% attributable mortality6. Systemic candidiasis is normally controlled by innate immunity, and individuals with genetic defects in innate immune cell components such as phagocyte NADPH oxidase are more susceptible to candidemia7-9. Very little is known about the dynamics of C. albicans interaction with innate immune cells in vivo. Extensive in vitro studies have established that outside of the host C. albicans germinates inside of macrophages, and is quickly destroyed by neutrophils10-14. In vitro studies, though useful, cannot recapitulate the complex in vivo environment, which includes time-dependent dynamics of cytokine levels, extracellular matrix attachments, and intercellular contacts10, 15-18. To probe the contribution of these factors in host-pathogen interaction, it is critical to find a model organism to visualize these aspects of infection non-invasively in a live intact host. 
The zebrafish larva offers a unique and versatile vertebrate host for the study of infection. For the first 30 days of development zebrafish larvae have only innate immune defenses2, 19-21, simplifying the study of diseases such as disseminated candidiasis that are highly dependent on innate immunity. The small size and transparency of zebrafish larvae enable imaging of infection dynamics at the cellular level for both host and pathogen. Transgenic larvae with fluorescing innate immune cells can be used to identify specific cells types involved in infection22-24. Modified anti-sense oligonucleotides (Morpholinos) can be used to knock down various immune components such as phagocyte NADPH oxidase and study the changes in response to fungal infection5. In addition to the ethical and practical advantages of using a small lower vertebrate, the zebrafish larvae offers the unique possibility to image the pitched battle between pathogen and host both intravitally and in color. 
The zebrafish has been used to model infection for a number of human pathogenic bacteria, and has been instrumental in major advances in our understanding of mycobacterial infection3, 25. However, only recently have much larger pathogens such as fungi been used to infect larva5, 23, 26, and to date there has not been a detailed visual description of the infection methodology. Here we present our techniques for hindbrain ventricle microinjection of prim25 zebrafish, including our modifications to previous protocols. Our findings using the larval zebrafish model for fungal infection diverge from in vitro studies and reinforce the need to examine the host-pathogen interaction in the complex environment of the host rather than the simplified system of the Petri dish5.

The rapid development, small size and transparency of zebrafish are tremendous advantages for the study of innate immune control of infection1-4. Here we demonstrate techniques for infecting zebrafish larvae using the fungal pathogen Candida albicans by microinjection, methodology recently used to implicate phagocyte NADPH oxidase activity in control of fungal dimorphism5.

Zebra balığı Larva yılında Dissemine Kandidiyazis non-invaziv Görüntüleme

Disseminated candidiasis caused by the pathogen Candida albicans is a clinically important problem in hospitalized individuals and is associated with a 30 ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal features of the natural infection. This protocol describes procedures for the establishment and evaluation of systemic infection due to neuropathogenic Escherichia coli K1 in the neonatal rat. Colonization of the gastrointestinal tract leads to dissemination of the pathogen along the gut-lymph-blood-brain course of infection and the model displays strong age dependency. A strain of E. coli O18:K1 with enhanced virulence for the neonatal rat produces exceptionally high rates of colonization, translocation to the blood compartment and invasion of the meninges following transit through the choroid plexus. As in the human host, penetration of the central nervous system is accompanied by local inflammation and an invariably lethal outcome. The model is of proven utility for studies of the mechanism of pathogenesis, for evaluation of therapeutic interventions and for assessment of bacterial virulence.

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Here, a procedure is described for the establishment of systemic infection in the neonatal rat with cultures of Escherichia coli K1. This non-invasive procedure permits colonization of the gastrointestinal tract, translocation of the pathogen to the systemic circulation, and invasion of the central nervous system at the choroid plexus.

Neuropathogenic olmayan İnvaziv Modeli<em&gt; Escherichia coli</em&gt; Yenidoğan Sıçan Enfeksiyon

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. pylori-induced gastric inflammation by activating several innate leukocytes including neutrophils, monocytes, and mast cells. The immunogenic and immunomodulatory properties of HP-NAP make it a potential diagnostic and vaccine candidate for H. pylori and a new drug candidate for cancer therapy. In order to obtain substantial quantities of purified HP-NAP used for its clinical applications, an efficient method to purify this protein with high yield and purity needs to be established.
In this protocol, we have described a method for one-step negative chromatographic purification of recombinant HP-NAP overexpressed in Escherichia coli (E. coli) by using diethylaminoethyl (DEAE) ion-exchange resins (e.g., Sephadex) in batch mode. Recombinant HP-NAP constitutes nearly 70% of the total protein in E. coli and is almost fully recovered in the soluble fraction upon cell lysis at pH 9.0. Under the optimal condition at pH 8.0, the majority of HP-NAP is recovered in the unbound fraction while the endogenous proteins from E. coli are efficiently removed by the resin.
This purification method using negative mode batch chromatography with DEAE ion-exchange resins yields functional HP-NAP from E. coli in its native form with high yield and purity. The purified HP-NAP could be further utilized for the prevention, treatment, and prognosis of H. pylori-associated diseases as well as cancer therapy.

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

A high yield method for one-step negative purification of recombinant Helicobacter pylori neutrophil-activating protein (HP-NAP) overexpressed in Escherichia coli by using diethylaminoethyl resins in batch mode is described. HP-NAP purified by this method is beneficial for the development of vaccines, drugs, or diagnostics for H. pylori-associated diseases.

Tek adımlı olumsuz Kromatografik arıtma<em&gt; Helicobacter pylori</em&gt; Nötrofil-aktive protein aşın<em&gt; Escherichia coli</em&gt; Toplu Modunda

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Murine Model of Group B Streptococcus Vaginal Colonization

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of 10 - 30% of adults. In immune-compromised individuals, including neonates, pregnant women, and the elderly, GBS may switch to an invasive pathogen causing sepsis, arthritis, pneumonia, and meningitis. Because GBS is a leading bacterial pathogen of neonates, current prophylaxis is comprised of late gestation screening for GBS vaginal colonization and subsequent peripartum antibiotic treatment of GBS-positive mothers. Heavy GBS vaginal burden is a risk factor for both neonatal disease and colonization. Unfortunately, little is known about the host and bacterial factors that promote or permit GBS vaginal colonization. This protocol describes a technique for establishing persistent GBS vaginal colonization using a single &#946;-estradiol pre-treatment and daily sampling to determine bacterial load. It further details methods to administer additional therapies or reagents of interest and to collect vaginal lavage fluid and reproductive tract tissues. This mouse model will further the understanding of the GBS-host interaction within the vaginal environment, which will lead to potential therapeutic targets to control maternal vaginal colonization during pregnancy and to prevent transmission to the vulnerable newborn. It will also be of interest to increase our understanding of general bacterial-host interactions in the female vaginal tract.

A Murine Model of Group B Streptococcus Vaginal Colonization

The purpose of this protocol is to imitate human group B Streptococcus (GBS) vaginal colonization in a murine model. This method may be used to investigate host immune responses and bacterial factors contributing to GBS vaginal persistence, as well as to test therapeutic strategies.

B Grubu bir murin modelinde<em&gt; Streptococcus</em&gt; Vajinal Kolonizasyon

Streptococcus agalactiae (group B Streptococcus, GBS), is a Gram-positive, asymptomatic colonizer of the human gastrointestinal tract and vaginal tract of ...

Non-invasive In Vivo Fluorescence Optical Imaging of Inflammatory MMP Activity Using an Activatable Fluorescent Imaging Agent

This paper describes a non-invasive method for imaging matrix metalloproteinases (MMP)-activity by an activatable fluorescent probe, via in vivo fluorescence optical imaging (OI), in two different mouse models of inflammation: a rheumatoid arthritis (RA) and a contact hypersensitivity reaction (CHR) model. Light with a wavelength in the near infrared (NIR) window (650 - 950 nm) allows a deeper tissue penetration and minimal signal absorption compared to wavelengths below 650 nm. The major advantages using fluorescence OI is that it is cheap, fast and easy to implement in different animal models.
Activatable fluorescent probes are optically silent in their inactivated states, but become highly fluorescent when activated by a protease. Activated MMPs lead to tissue destruction and play an important role for disease progression in delayed-type hypersensitivity reactions (DTHRs) such as RA and CHR. Furthermore, MMPs are the key proteases for cartilage and bone degradation and are induced by macrophages, fibroblasts and chondrocytes in response to pro-inflammatory cytokines. Here we use a probe that is activated by the key MMPs like MMP-2, -3, -9 and -13 and describe an imaging protocol for near infrared fluorescence OI of MMP activity in RA and control mice 6 days after disease induction as well as in mice with acute (1x challenge) and chronic (5x challenge) CHR on the right ear compared to healthy ears.

Non-invasive In Vivo Fluorescence Optical Imaging of Inflammatory MMP Activity Using an Activatable Fluorescent Imaging Agent

This paper explains the application of fluorescent imaging using an activatable optical imaging probe to visualize the in vivo activity of key matrix metalloproteinases in two different experimental models of inflammation.

Non-invaziv<emIn vivo</em&gt; Aktive Edilebilir Floresan Görüntüleme Ajanını Kullanan İnflamatuvar MMP Aktivitesinin Flüoresan Optik Görüntülemesi

This paper describes a non-invasive method for imaging matrix metalloproteinases (MMP)-activity by an activatable fluorescent probe, via in vivo ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple condensation reactions. DHDDS (dehydrodolichyl diphosphate synthase) is a eukaryotic long-chain cis-PT (forming cis double bonds from the condensation reaction) that catalyzes chain elongation of farnesyl diphosphate (FPP, an allylic diphosphate) via multiple condensations with isopentenyl diphosphate (IPP). DHDDS is of biomedical importance, as a non-conservative mutation (K42E) in the enzyme results in retinitis pigmentosa, ultimately leading to blindness. Therefore, the present protocol was developed in order to acquire large quantities of purified DHDDS, suitable for mechanistic studies. Here, the usage of protein fusion, optimized culture conditions and codon-optimization were used to allow the overexpression and purification of functionally active human DHDDS in E. coli. The described protocol is simple, cost-effective and time sparing. The homology of cis-PT among different species suggests that this protocol may be applied for other eukaryotic cis-PT as well, such as those involved in natural rubber synthesis.

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

A simple protocol for overexpression and purification of codon-optimized, human cis-prenyltransferase, under non-denaturing conditions, from Escherichia coli, is described, along with an enzymatic activity assay. This protocol can be generalized for production of other cis- prenyltransferase proteins in quantity and quality suitable for mechanistic studies.

Aşırı Ezme ve İnsanın Saflaştırılması<em&gt; Cis</em&gt; -prenıltransferaz in<em&gt; Escherichia coli</em

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. Among them, reversible lysine acetylation is one of the most widely distributed in all domains of life. Although numerous mass spectrometry-based acetylome studies have been performed, further characterization of these putative acetylation targets has been limited. One possible reason is that it is difficult to generate purely acetylated proteins at desired positions by most classic biochemical approaches. To overcome this challenge, the genetic code expansion technique has been applied to use the pair of an engineered pyrrolysyl-tRNA synthetase variant, and its cognate tRNA from Methanosarcinaceae species, to direct the cotranslational incorporation of acetyllysine at the specific site in the protein of interest. After first application in the study of histone acetylation, this approach has facilitated acetylation studies on a variety of proteins. In this work, we demonstrated a facile protocol to produce site-specifically acetylated proteins by using the model bacterium Escherichia coli as the host. Malate dehydrogenase was used as a demonstration example in this work.

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetic code expansion serves as a powerful tool to study a wide range of biological processes, including protein acetylation. Here we demonstrate a facile protocol to exploit this technique for generating homogeneously acetylated proteins at specific sites in Escherichia coli cells.

Escherichia Coli proteinler Site-Specifically oluşturmak için Facile iletişim kuralı Acetylated

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Recurrent Escherichia coli Urinary Tract Infection Triggered by Gardnerella vaginalis Bladder Exposure in Mice

Recurrent urinary tract infections (rUTI) caused by uropathogenic Escherichia coli (UPEC) are common and costly. Previous articles describing models of UTI in male and female mice have illustrated the procedures for bacterial inoculation and enumeration in urine and tissues. During an initial bladder infection in C57BL/6 mice, UPEC establish latent reservoirs inside bladder epithelial cells that persist following clearance of UPEC bacteriuria. This model builds on these studies to examine rUTI caused by the emergence of UPEC from within latent bladder reservoirs. The urogenital bacterium Gardnerella vaginalis is used as the trigger of rUTI in this model because it is frequently present in the urogenital tracts of women, especially in the context of vaginal dysbiosis that has been associated with UTI. In addition, a method for in situ bladder fixation followed by scanning electron microscopy (SEM) analysis of bladder tissue is also described, with potential application to other studies involving the bladder.

Recurrent Escherichia coli Urinary Tract Infection Triggered by Gardnerella vaginalis Bladder Exposure in Mice

A mouse model of uropathogenic E. coli (UPEC) transurethral inoculation to establish latent intracellular bladder reservoirs and subsequent bladder exposure to G. vaginalis to induce recurrent UPEC UTI is demonstrated. Also demonstrated are the enumeration of bacteria, urine cytology, and in situ bladder fixation and processing for scanning electron microscopy.

Farelerde Gardnerella vaginalis Mesane Maruziyeti Tarafından Tetiklenen Tekrarlayan Escherichia coli İdrar Yolu Enfeksiyonu

Recurrent urinary tract infections (rUTI) caused by uropathogenic Escherichia coli (UPEC) are common and costly. Previous articles describing models of ...

Real-Time Quantification of Reactive Oxygen Species in Neutrophils Infected with Meningitic Escherichia Coli

Escherichia coli (E. coli) is the most common Gram-negative bacteria causing neonatal meningitis. The occurrence of bacteremia and bacterial penetration through the blood-brain barrier are indispensable steps for the development of E. coli meningitis. Reactive oxygen species (ROS) represent the major bactericidal mechanisms of neutrophils to destroy the invaded pathogens. In this protocol, the time-dependent intracellular ROS production in neutrophils infected with meningitic E. coli was quantified using fluorescent ROS probes detected by a real-time fluorescence microplate reader. This method may also be applied to the assessment of ROS production in mammalian cells during pathogen-host interactions.

Real-Time Quantification of Reactive Oxygen Species in Neutrophils Infected with Meningitic Escherichia Coli

Escherichia coli is the leading cause of neonatal Gram-negative bacterial meningitis. During the bacterial infection, reactive oxygen species produced by neutrophils play a major bactericidal role. Here we introduce a method to detect the reactive oxygen species in neutrophils in response to meningitis E. coli.

Meningitik Escherichia Coli ile Enfekte Olan Nötrofillerde Reaktif Oksijen Türlerinin Gerçek Zamanlı Nicelemesi

Escherichia coli (E. coli) is the most common Gram-negative bacteria causing neonatal meningitis. The occurrence of bacteremia and bacterial penetration ...