우리는 C-Brick 표준 개발 과정에서 기술 지원을 해주신 Shanghai Tolo Biotech에게 감사드립니다. 이 연구는 중국 과학 아카데미의 전략적 우선 순위 연구 프로그램 (Grant No. XDB19040200)의 교부금으로 지원되었다.

1. crRNA의 제조 <ol><li> crRNA 주형의 제조 <ol><li> RNase가없는 물에서 10 μM의 농도로 개별 올리고 뉴클레오티드 ( 표 1 )를 재현 탁하십시오. </li><li> 상단 스트랜드 올리고 뉴클레오티드 ( 표 1의 T7-F) 22.5 μL, 하단 스트랜드 올리고 뉴클레오티드 22.5 μL ( 표 1 ) 및 10 mL 어닐링 완충액 5 μL를 0.2 mL PCR 튜브에 첨가한다. 총 부피가 50 μL인지 확인하십시오. 참고 : 6 개의 서로 다른 하단 가닥 올리고 뉴클레오타이드가 표 1 에 나와 있으며, 각각은 상단 가닥 T7-F와 개별적으로 쌍을 이루어야합니다. 표 1의 소문자는 crRNA의 가이드 시퀀스로 전사 될 서열을 나타낸다. 10x Taq PCR 버퍼는 10x 어닐링 버퍼 대신 사용될 수 있습니다. </li><li> Thermocycler에 PCR 튜브를 놓습니다. </li><li> 어닐링 프로그램을 실행하십시오 : 95 ° C에서의 초기 변성5 분 후 95 ~ 20 ° C의 재사용 대기 시간, 온도 조절기에서 1 분당 1 ° C 감소. 참고 : 1.2.1 단계의 샘플을 즉시 사용하십시오. </li></ol></li><li> crRNA의 전사 및 정제 <ol><li> RNase가없는 물 38 μL, 단계 1.1.4의 템플리트 8 μL, 5x T7 전사 버퍼 20 μL, NTP 혼합물 (10 μM) 20 μL, 재조합 RNase 억제제 (RRI) 4 μL 및 10 1.5 ML microcentrifuge 튜브에 T7 RNA 중합 효소 μL. 총 부피가 100 μL인지 확인하십시오. </li><li> 미세 원심 분리 튜브를 밤새 37 ° C의 수 욕조에 두십시오 (약 16 시간 동안). </li><li> 전사 된 RNA를 정화하기 위해 RNA 정화 및 농축 키트를 사용하십시오. 제조업체의 프로토콜을 따르십시오. </li><li> UV-Vis 분광 광도계로 RNA를 정량하고 RNA를 10 μM의 농도로 희석하십시오. 즉시 샘플을 사용하거나 -80 ° C에 보관하십시오. 참고 : crRNA 시퀀스표 2 에 열거되어있다. </li></ol></li></ol> 2. C-Brick 부품의 제작 (C-Brick 표준 벡터에 생물학적 부품 삽입) 참고 :이 단계에는 세 가지 하위 단계가 있습니다. 짧은 생물학적 부분 ( 예 : 프로모터 및 터미네이터)의 경우 C-Brick 표준 벡터에 생물학적 부분을 삽입하기 위해 직접 PCR 방법을 사용하는 것이 가장 좋습니다 4 . 전체 벡터 시퀀스는 보충 데이터에 표시되며 접두사 및 접미사 시퀀스는 그림 1 (아래 2.1 단계)에 나와 있습니다. PCR을 통해 쉽게 얻을 수있는 생물학적 부분 ( 예 : 게놈 DNA, 플라스미드 또는 새롭게 합성 된 DNA 서열 템플릿)을 사용하면 C-Brick 표준 벡터에 생물학적 부분을 삽입하기 위해 끊김없는 조립 방법을 사용하는 것이 가장 좋습니다 (아래의 2.2 단계). BioBrick 및 BglBrick 표준에서 얻은 부품의 경우 제한효소 매개 소화 및 T4 DNA 리가 아제 매개 연결을 사용하여 생물학적 부분을 C- 브릭 표준 벡터 (아래의 단계 2.3)에 삽입 할 수 있습니다. <ol><li> 직접 PCR 증폭을 통한 구축 <ol><li> PCR 증폭을위한 올리고 뉴클레오타이드를 설계하고 주문하십시오. 참고 : 올리고 뉴클레오타이드의 5 &#39;말단은 DNA 부분의 서열을 포함하고, 올리고 뉴클레오타이드의 3&#39;말단은 벡터 서열 ( 즉, 정방향 가닥의 3 &#39;말단에 &quot;GGATCCACTAGTCTCTAGCTCG&quot;및 &quot;GGATCCTTTCTCCTCTTTCTAG&quot; 역 가닥에서). 올리고 뉴클레오타이드의 5&#39;- 말단에 오버행이 없거나 ~ 20-bp 오버행을 설계 할 수 있습니다. 구체적인 예는 이전의 연구 4 에서 찾을 수 있습니다. </li><li> 초순수에서 개별 올리고 뉴클레오타이드를 10 μM의 농도로 재현 탁하십시오. </li><li> 0.2 ML PCR 튜브 얼음에 PCR 반응을 설정합니다 : 초 순수한 물 18 μL, 2x P의 25 μL를 추가CR 완충액, dNTPs (10 μM) 1 μL, 단계 2.1.2에서 정방향 및 역방향 프라이머 (10 μM) 각각 2.5 μL, 주형으로 C- 브릭 표준 벡터 (50 ng) 0.5 μL, 고 충실도 DNA 중합 효소 총 부피가 50 μL인지 확인하십시오. </li><li> 튜브를 thermocycler에 직접 놓고 thermocycler 프로그램을 시작하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li><li> Thermocycler 프로그램 : 98 ° C에서 3 분 동안 1 사이클; 98 ℃에서 10 초, 55 ℃에서 20 초, 72 ℃에서 2 분; 72 ℃에서 10 분 동안 1 사이클. 샘플을 16 ° C에 유지하십시오. </li><li> 단계 2.1.4에서 얻은 혼합물 9 μL를 1.5 mL 미세 원심 분리 튜브에 넣으십시오. </li><li> 1 μL의 DpnI를 첨가하고 37 ° C 수 욕조에서 1 시간 동안 배양하십시오. 참고 : 프라이머에 중첩 시퀀스가없는 경우 0.5 μL의 T4 폴리 뉴클레오타이드 키나아제 (PNK)와 0.5 μL의 T4 DNA 리가 제를 첨가하고1 시간 동안 22 ° C 수 욕조. 그렇지 않은 경우, 프라이머가 ~ 20nt 중첩 서열을 포함하고 있다면, DpnI 처리 제품을 대장균 (DH10B)에 적합한 세포로 직접 형질 전환 시킨다 (단계 2.4). 선형화 된 PCR 산물은 숙주 내에서 재조합 시스템에 의해 고리 화 될 것이다. </li><li> 즉시 샘플을 사용하거나 -20 ° C에 보관하십시오. </li></ol></li><li> 원활한 조립을 통한 시공 <ol><li> PCR 증폭을위한 올리고 뉴클레오타이드를 설계하고 주문하십시오. 참고 : 올리고 뉴클레오티드의 3 &#39;말단은 DNA 부분의 말단 서열을 포함하고, 올리고 뉴클레오타이드의 5&#39;- 말단은 선형화 된 C- 브릭 표준 벡터 서열의 말단을 함유한다 ( 즉, 5&#39;말단에 대해 &quot;CTAGAAAGAGGAGAAAGGATCC&quot; 역전 사슬의 5&#39;- 말단에 대한 &quot;CGAGCTAGAGACTAGTGGATCC&quot;). 구체적인 예는 이전의 연구 4 에서 찾을 수 있습니다. </li><li> 개인을 다시 일시 중지하십시오.10 μM의 농도로 초순수 중의 올리고 뉴클레오타이드를 제거합니다. </li><li> 0.2 ML PCR 튜브에서 얼음에 PCR 반응을 설정합니다 : 순전히 물 18 μL, 2 배 PCR 버퍼 25 μL, dNTPs (10 μM) 1 μL, 순방향 및 역방향 프라이머 각각 10 μM ), 0.5 μL의 template (20-500 ng) 및 0.5 μL의 high-fidelity DNA 중합 효소를 넣었다. 총 부피가 50 μL인지 확인하십시오. </li><li> 튜브를 thermocycler에 직접 놓고 thermocycler 프로그램을 실행하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. 참고 : thermocycler 프로그램을 다음과 같이 설정하십시오 : 98 ° C에서 3 분 동안 한 번; 98 ℃에서 10 초, 55 ℃에서 20 초 (프라이머의 어닐링 온도에 따라), 1 분 (생물학적 부분의 길이에 따라) 72 ℃에서 30 사이클; 72 ℃에서 10 분 동안 1 사이클. 샘플을 16 ° C에 유지하십시오. </li><li> PCR 클린업 시스템을 사용하여 PCR 생성물을 정제하십시오.시험 키트; 제조업체의 프로토콜을 따르십시오. </li><li> BamHI로 C-Brick 표준 벡터를 분해하십시오 : 초순수 34 μL, 플라스미드 (1 μg) 10 μL, 10x 버퍼 5 μL 및 BamHI 1 μL를 미세 원심 분리 튜브에 첨가하십시오. 수 욕조에서 37 ° C에서 2 시간 동안 품어 낸다. </li><li> 위의 제품을 젤 클린업 시스템 키트를 사용하여 정제하십시오. 제조업체의 프로토콜을 따르십시오. </li><li> 2.2.7 단계의 선형화 된 벡터 (50 ng), 2.2.4 단계의 단편 (200 ng) 5 μL, 5 x 이음새없는 조립 버퍼 2 μL 및 이음새없는 조립 키트의 이음새없는 조립 효소 1 μL를 첨가하십시오 1.5 mL의 마이크로 원심 분리 관으로 옮깁니다. 총 부피는 10 μL입니다. </li><li> 30 분 동안 37 ° C 수조에 넣으십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li><li> 제한 효소 - 매개 소화 및 T4 DNA 리가 제제 - 중재 결합을 통한 구축. 노트: BioBrick (단계 2.3.4-2.3.7) 및 BglBrick (단계 2.3.1-2.3.3) 표준에서 얻은 부품의 경우 제한 효소 매개 소화 및 T4 DNA 리가 아제 매개 연결을 사용하여 생물학적 인 부분을 C-Brick 표준 벡터로 변환합니다. <ol><li> BglHI과 BglII로 BglBrick 표준 부품을 소화합니다 : 초순수 34 μL, 플라스미드 (2 μg) 10 μL, 10x 버퍼 3 5 μL, BamHI 0.5 μL 및 BglII 0.5 μL를 미세 원심 분리 튜브에 첨가하십시오. 37 ° C 수 욕조에서 2 시간 동안 품어 낸다. </li><li> 1 % 아가로 오스 겔 전기 영동을 실행하고 겔 클린업 ​​시스템 키트를 사용하여 단편을 정제하십시오. </li><li> 단편과 C-Brick 표준 벡터를 합치십시오 : 단계 2.1.12의 선형화 된 벡터 (50 ng) 2 개와 단계 2.3.3의 단편 (200 ng) 6 μL를 1.5 mL 미세 원심 분리 튜브에 첨가하십시오. 10 X T4 DNA ligase 버퍼 1 μL와 T4 DNA ligase 1 μL를 첨가한다. 22 ° C에서 2 시간 동안 품어 낸다. 샘플을 즉시 사용하거나 정지하십시오.-20 ° C에서 보관하십시오. </li><li> XbaI 및 SpeI로 BioBrick 표준 부품을 소화합니다 : 34μL의 초순수, 10 μL의 플라스미드 (2 μg), 5 μL의 10 배 완충액, 0.5 μL의 XbaI 및 0.5 μL의 SpeI를 미세 원심 분리 튜브에 첨가하십시오. 37 ° C 수 욕조에서 2 시간 동안 품어 낸다. </li><li> XbaI 및 SpeI로 C-Brick 표준 벡터를 분해하십시오 : 초순수 34 μL, 플라스미드 (1 μg) 10 μL, 10 배 완충액 5 μL, XbaI 0.5 μL 및 SpeI 0.5 μL를 마이크로 원심 분리 관에 첨가하십시오 . 37 ° C 수 욕조에서 2 시간 동안 품어 낸다. </li><li> 1 % 아가 로즈 겔 전기 영동을 실행하고 겔 클린업 ​​시스템 키트로 2.3.4 단계의 단편과 2.3.5 단계의 선형화 된 벡터를 정제하십시오. 제조자의 프로토콜에 따라. </li><li> 단편과 C-Brick 벡터를 준비하십시오 : 단계 2.3.5의 선형화 된 벡터 (50 ng) 2 개와 단계 2.3.4의 단편 (200 ng) 6 μL를 1.5 mL 미세 원심 분리 튜브에 넣으십시오. 광고d 10 μL T4 DNA 리가 제 완충액 1 μL와 T4 DNA 리가 제 1 μL. 22 ° C에서 2 시간 동안 품어 낸다. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li><li> 단계 2.1.8, 2.2.9, 2.3.3 또는 2.3.7의 생성물 10 μL를 대장균 (DH10B)의 적격 세포로 화학적으로 변형시키기 위해 첨가한다. </li><li> 여러 클론을 5mL 액체 Luria-Bertani (LB) 튜브에 넣고 37 ℃에서 밤새 쉐이커 (220rpm)로 밤새 인큐베이터합니다. </li><li> 플라스미드 준비 키트를 사용하여 플라스미드를 추출합니다. 제조업체의 프로토콜을 따르십시오. </li><li> Sanger sequencing 11 에 의해 정확한 클론을 확인하십시오. </li></ol> 3. C- 브릭 어셈블리 ( 그림 2 ) <ol><li> C- 벽돌 벡터의 Cpf1 분해 <ol><li> RNase가없는 물 22.5 μL, 10x Cpf1 완충액 4 μL, 단계 2.6 (1 μg)의 플라스미드 10 μL, RRI 0.5 μL 및 1 &amp;# 181; Cpf1 (5 μM)을 1.5 mL 미세 원심 분리 튜브에 넣으십시오. 참고 : Cpf1은 상업적으로 구입하거나 이전 연구 4 의 프로토콜에 따라 정제 할 수 있습니다. </li><li> T1 및 T2 사이트에 외래 DNA 단편을 삽입하려면 1 μL의 crRNA-T2 (10 μM)를 첨가하고 37 ° C의 수조에서 30 분 동안 품을 때까지 기다리십시오. 추가 30 분 동안 1 μL의 crRNA-T1 (10 μM) 및 Cpf1 (5 μM)을 첨가 하였다. 참고 : 또는 T3 및 T4 부위에 외래 DNA 단편을 삽입하려면 1 μL의 crRNA-T3 (10 μM)를 첨가하고 37 ° C의 수조에서 30 분 동안 배양하십시오. 추가 30 분 동안 1 μL의 crRNA-T4 (10 μM)를 첨가한다. </li><li> 감수성 알칼리성 인산 가수 분해 효소 1 μL를 첨가하고 37 ℃에서 1 시간 동안 배양한다. </li><li> 아가 로스 겔 전기 영동을 실행하고 젤 클린업 시스템 키트를 사용하여 벡터를 정제하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li&gt; <li> Cpf1을 이용한 DNA 단편의 절단 <ol><li> RNase가없는 물 21.5 μL, 10x Cpf1 버퍼 4 μL, 단계 2.6 (2 μg), RRI 0.5 μL 및 Cpf1 (5 μM) 2 μL의 플라스미드 10 μL를 1.5 mL 미세 원심 분리 튜브에 넣으십시오. </li><li> T1 및 T2 사이트에 외인성 DNA 단편을 삽입하려면 crRNA-T1 (10 μM) 1 μL와 crRNA-T3 (10 μM) 1 μL를 넣고 37 ° C의 수조에서 2 시간 동안 품어줍니다. 참고 : 또는, crRNA-T2 (10 μM) 1 μL와 crRNA-T4 (10 μM) 1 μL를 넣고 37 ° C에서 2 시간 동안 수 욕조에서 품을 수 있습니다. </li><li> 아가 로스 겔 전기 영동을 실행하고 젤 클린업 시스템 키트를 사용하여 조각을 정화하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li><li> C-Brick 조립 및 추가 검증 <ol><li> 외래 DNA 단편과 C-Brick 벡터를 라이 게이션하십시오 : 2 μL의 선형화 된 벡터를 첨가하십시오50ng) 및 단계 3.2.3의 DNA 단편 (200ng) 6μL를 1.5mL 미세 원심 분리 튜브에 첨가 하였다. 10x T4 DNA ligase 버퍼 1 μL와 T4 DNA ligase 1 μL를 첨가한다. 22 ° C에서 2 시간 동안 품어 낸다. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li><li> 대장균 (DH10B) - 유능한 세포로 화학 변형을위한 연결 제품 (단계 3.3.1) 10 μL를 추가합니다. </li><li> 5 ML 액체 LB 튜브에 여러 클론을 추가하고 220 RPM 및 37 ° C에서 쉐이커에서 밤새 품어. </li><li> 플라스미드 준비 키트를 사용하여 플라스미드를 추출합니다. 제조업체의 프로토콜을 따르십시오. </li><li> Sanger sequencing으로 정확한 클론을 확인하십시오. 11 . </li></ol></li><li> 새로운 C-Brick 어셈블리 라운드를 수행하십시오. 3.3.4 단계의 올바른 클론은 3.1-3.3 단계와 동일한 프로토콜에 따라 반복 C-Brick 어셈블리를위한 새로운 C-Brick 벡터 또는 DNA 파트로 사용할 수 있습니다. 참고 : T2 &#39;및 T3&#39;ites는 T2 및 T3 사이트 ( 그림 1a )의 백업으로 설계되었습니다. 2.3.7 단계에서 얻은 플라스미드의 경우, C-Brick 표준 어셈블리에는 T2 &#39;및 T3&#39;만 사용할 수 있습니다. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

저자는 공개 할 것이 없습니다.

이 프로토콜은 DNA 어셈블리 표준 C-Brick을위한 절차를 설명합니다. 이 프로토콜에서 가장 중요한 단계는 C-Brick 표준 벡터의 선형화입니다. 벡터가 불완전하게 절단되면 성공률에 심각한 영향을 줄 수 있습니다. 또한, Cpf1은 주로 &quot;18-23&quot;분열 패턴의 표적 DNA 서열을 절단하지만, 두 개의 염기 근처에서 부정확 한 절단이 또한 검출되었는데, 이는 DNA 조립 후 작은 수의 돌연변이를 일으킬 수있다. 따라서 Sanger 시퀀싱은 조립 된 구조물을 검증하는 데 필요합니다. C-Brick 어셈블리의 효율은 이전의 연구 4 에서 기술 된 전통적인 제한 효소 및 결합 방법보다 낮습니다. 조립 효율에 영향을 미치는 주된 이유는 Cpf1의 부정확 한 분열 특성 일 수 있습니다. 장래에, 분열 정확도의 향상은 표준현재 탐색 중입니다. C-Brick은 또한 BglBrick 및 BioBrick 표준과 부분적으로 호환됩니다. 예를 들어, BglII 및 BamHI로 BglBrick 부품을 절단 한 다음 C-Brick 표준 벡터의 BamHI 사이트에 삽입하여 C-Brick 부품을 생성 할 수 있습니다. 그러나 BglBrick 부품의 삽입 방향을 확인해야하며 조립 후 &quot;GGATCT&quot;흉터가 있어야합니다. BioBrick 부품 ( 즉, XbaI 및 SpeI 분해)에서 C-Brick DNA 부품을 얻으면 T2 및 T3 사이트가 모두 파괴되고 두 개의 백업 Cpf1 타겟 시퀀스 (T2 &#39;및 T3&#39;)를 사용할 수 있습니다. Cpf1 분열에는 RNase에 매우 민감한 sgRNA가 필요하므로 모든 물질은 RNase가 없어야합니다. 현재 모든 C-Brick 표준 벡터, RNase-Free Cpf1 뉴 클레아 제 및 crRNA는 상업적으로 주문할 수 있습니다 12 . 따라서 C-Brick의 절차는 실제로 Bio의 절차만큼이나 간단합니다.벽돌 표준. 지난 몇 년 동안 Golden Gate Assembly 13 , Gibson Assembly 14 및 기타 15 등의 유용한 DNA 조립 방법이 개발되어 널리 사용되었습니다. 그러나 DNA 조립 표준은 비용 효과적이고 신뢰성이 높으며 처리량이 높은 자동 조립 반응을 제공 할 가능성이 있으므로 표준은 새롭게 설계되거나 재 설계된 유전자, 유전 회로 및 경로의 구축 및 테스트를 용이하게 할 수있다 . 16 , 17 , 특히 합성 생물학 분야. 현재 발표 된 DNA 어셈블리 표준 중에서 C-Brick 표준은 명확한 장점과 단점 4 ( 즉, 연결 효율성)을 모두 가지고 있습니다. 결 합 효율이 향상되면 표준을 앞으로 널리 채택 할 수 있습니다.

DNA 생물학적 부분의 표준화는 합성 생물학 1 의 개발에 중요합니다. DNA 조립 절차의 개발은 임시 실험 설계를 대체 할 수 있고 유전체 구성 요소를 대형 시스템으로 조립하는 동안 발생하는 예기치 않은 결과를 제거 할 수 있습니다. BioBrick 표준 (BBF RFC 10)은 가장 초기에 제안 된 DNA 어셈블리 표준 중 하나였습니다. 접두어 시퀀스 (EcoRI 및 XbaI 절단 사이트 포함)와 접미사 시퀀스 (SpeI 및 PstI 절단 사이트 포함) 2 , 3을 사용 합니다. XbaI와 SpeI는 상호 보완적인 응집력을 지니고 있기 때문에 XbaI와 SpeI로 절단 된 BioBrick DNA 부품을 결합하여 추가 반복 조립을위한 새로운 BioBrick을 생성 할 수 있습니다. 일부 결함은 BioBrick 표준을 사용하여 확인되었습니다. 예를 들어, 8-bp 흉터를 생성합니다.융합 단백질을 만들 수없는 DNA 부분들 사이. 게다가 위에서 언급 한 네 종류의 6-bp 제한 효소 부위는 DNA 부분에서 제거해야하므로 매우 불편합니다. BglBrick 표준은 첫 번째 문제를 해결하기 위해 수립되었습니다. 5 . 이것은 6-bp의 &quot;GGATCT&quot;흉터를 만들어 Gly-Ser를 만들고 여러 단백질 또는 단백질 도메인의 융합을 허용합니다. iBrick은 두 번째 문제점 6 을 처리하기 위해 개발되었습니다. 그것은 긴 DNA 염기 서열을 인식하는 homing endonucleases (HE)를 사용합니다. HE 인식 사이트가 천연 DNA 서열에는 거의 존재하지 않기 때문에, iBrick 표준은 DNA 서열을 수정하지 않고 iBrick 부품의 직접 건설에 사용될 수 있습니다. 그러나 iBrick 표준은 DNA 부분 사이에 21bp의 흉터를 남겨 둡니다. 이는 인기가없는 이유 일 수 있습니다. 최근 몇 년 동안, 클러스터 된 정기적으로 interresaced 짧은 palindromic 반복 (CRISPR) 시스템이 급속히 발전했다. CRISPR- 관련 (Cas) 단백질 중에서, Streptococcus pyogenes 로부터의 Cas9 엔도 뉴 클레아 제가 현재 널리 사용되고있다. 주로 둔기가있는 이중 가닥 DNA 브레이크 (DSB)를 도입합니다. 2015 년 Zhang과 동료들은 처음으로 Cpf1 ( Prevotella 와 Francisella의 CRISPR)을 특징으로했습니다. 그것은 클래스 2 유형 V CRISPR-Cas 시스템에 속하며 CRISRP RNA (crRNA) 유도 된 endonuclease 10 입니다. Cas9와는 달리, Cpf1은 4 또는 5 nt의 5 &#39;오버행을 갖는 DSB를 도입한다. 이 특성을 바탕으로 Cpf1은 DNA 어셈블리 표준 인 C-Brick 4 를 개발하는 데 사용되었습니다. C-Brick 표준 벡터에서, 접두어가 붙은 T1 / T2와 접미사가 붙은 T3 / T4의 4 개의 Cpf1 표적 부위는 생물학적 부분에 인접 해 있습니다. 이는 BioBrick 표준과 유사합니다. T2 및 T3 부위의 절단으로서상보적인 끈적 끈적한 말단이 생기면 DNA 부분의 반복적 인 조립을 수행하는 동시에 부품들 사이에 &quot;GGATCC&quot;흉터를 생성 할 수 있습니다. 특히, C-Brick 표준에는 긴 대상 시퀀스 인식과 짧은 흉터 남기기라는 두 가지 주요 이점이 있습니다. C-Brick이 만든 6 bp &quot;GGATCC&quot;흉터는 Gly-Ser를 암호화하며 융합 단백질을 만들 수 있습니다. 또한 C-Brick 표준은 BglBrick 및 BioBrick 표준과 부분적으로 호환됩니다.

<table><tbody><tr><td>Comercial Oligonucleotide</td><td>Sangon Biotech</td><td></td><td></td></tr><tr><td>10x Taq PCR Buffer</td><td>Transgen</td><td>#J40928</td><td></td></tr><tr><td>Ultra Pure Distilled Water</td><td>Invitrogen</td><td>10977-015</td><td></td></tr><tr><td>5x RNA Transcription Buffer</td><td>Thermo Scientific</td><td>K0441</td><td></td></tr><tr><td>T7 RNA polymerase</td><td>Thermo Scientific</td><td>#EP0111</td><td></td></tr><tr><td>NTP mixture</td><td>Sangon</td><td>#ND0056</td><td></td></tr><tr><td>RRI (Recombinant RNase Inhibitor)</td><td>Takara</td><td>2313A</td><td></td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td></td></tr><tr><td>UV-Vis Spectrometer</td><td>Thermo Scientific</td><td>Nano-Drop 2000c</td><td></td></tr><tr><td>2x Phanta Max Buffer</td><td>Vazyme</td><td>PB505</td><td>PCR buffer</td></tr><tr><td>dNTPs</td><td>Transgen</td><td>AD101</td><td></td></tr><tr><td>Phanta Max Super-Fidelity DNA Polymerase</td><td>Vazyme</td><td>P505-d1</td><td></td></tr><tr><td>Ezmax for One-step Cloning</td><td>Tolobio</td><td>24303-1</td><td>seamless assembly kit</td></tr><tr><td>5x Buffer for Ezmax One-step Cloning</td><td>Tolobio</td><td>32006</td><td></td></tr><tr><td>BamHI</td><td>NEB</td><td>#R0136L</td><td></td></tr><tr><td>BamHI-HF</td><td>NEB</td><td>#R3136L</td><td></td></tr><tr><td>BglII&amp;nbsp;</td><td>NEB</td><td>#R0144L</td><td></td></tr><tr><td>XbaI</td><td>NEB</td><td>#R0145L</td><td></td></tr><tr><td>SpeI</td><td>NEB</td><td>#R3133L</td><td></td></tr><tr><td>10x Buffer 3</td><td>NEB</td><td>#B7003S</td><td></td></tr><tr><td>10x CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>10x T4 DNA ligase Buffer</td><td>Tolobio</td><td>32002</td><td></td></tr><tr><td>T4 PNK</td><td>Tolobio</td><td>32206</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Tolobio</td><td>32210</td><td></td></tr><tr><td>DpnI</td><td>NEB</td><td>#R01762</td><td></td></tr><tr><td>SV Gel and PCR clean-up system</td><td>Promega</td><td>A9282</td><td></td></tr><tr><td>Plasmid Mini Kit I</td><td>Omega</td><td>D6943-02</td><td>plasmid preparation kit</td></tr><tr><td>thermosensitive alkaline phosphatase&amp;nbsp;</td><td>Thermo Scientific</td><td>#EF0651</td><td>FastAP</td></tr><tr><td>10x Cpf1 buffer</td><td>Tolobio</td><td>32008</td><td></td></tr><tr><td>Cpf1</td><td>Tolobio</td><td>32105</td><td>FnCpf1</td></tr><tr><td>thermocycler</td><td>Applied Biosystems</td><td>veriti 96 well</td><td></td></tr><tr><td>C-Brick standard vector</td><td>Tolobio</td><td>98101</td><td></td></tr><tr><td>E. coli [DH10B]</td><td>Invitrogen</td><td>18297010</td><td></td></tr><tr><td>Luria-Bertani media (tryptone)</td><td>Oxoid</td><td>LP0042</td><td></td></tr><tr><td>Luria-Bertani media (yeast extract)</td><td>Oxoid</td><td>LP0021</td><td></td></tr><tr><td>Luria-Bertani media (NaCl)</td><td>Sangon Biotech</td><td>B126BA0007</td><td></td></tr></tbody></table>

protocols for c-brick dna standard assembly using cpf1

CRISPR 관련 단백질 Cpf1은 CRISPR RNA (crRNA)의지도하에 이중 가닥 DNA를 절단하여 끈적 거리는 말단을 생성합니다. 이러한 특성 때문에 Cpf1은 C- 브릭 (C-Brick)이라는 DNA 어셈블리 표준의 확립에 사용되어 오랜 인식 사이트와 짧은 흉터의 장점을 가지고 있습니다. 표준 C-Brick 벡터에는 접두어 (T1 및 T2 사이트)와 접미어 (T3 및 T4 사이트) - 생물학적 DNA 부분이 인접한 4 개의 Cpf1 인식 사이트가 있습니다. T2 및 T3 부위의 절단은 상보적인 끈적한 말단을 생성하여 T2 및 T3 부위를 갖는 DNA 부분의 조립을 허용한다. 한편 조립 후 부품 사이에는 짧은 &quot;GGATCC&quot;흉터가 생깁니다. 새로 형성된 플라스미드가 다시 4 개의 Cpf1 절단 부위를 포함하기 때문에이 방법은 BioBrick 및 BglBrick 표준과 유사한 DNA 부분의 반복적 조립을 가능하게합니다. C-Brick 표준을 사용하여 DNA 부품을 조립하는 절차여기에 설명되어 있습니다. C-Brick 표준은 과학자, 대학원생, 학부생, 심지어 아마추어들까지 광범위하게 사용할 수 있습니다.

<html> 이 프로토콜은 세 가지 색소 카세트 (cjBlue (BBa_K592011), eforRed (BBa_K592012) 및 amilGFP (BBa_K592010))의 조립을 시연했습니다. 먼저, 상기 3 가지 유전자 및 터미네이터의 코딩 서열을 개별적으로 C- 브릭 표준 벡터에 클로닝 하였다. 5 &#39;말단에 짧은 DNA 부분을 포함하는 프라이머를 사용하여 PCR 증폭을 통해 짧은 DNA 부분, 프로모터 및 터미네이터를 C-Brick 벡터에 도입 하였다. 이것은 self-ligation 방법이 뒤 따른다. 3 개의 chromoprotein-encoding 서열을 먼저 de novo synthesis 한 후 C-Brick 표준 vector에 seamless assembly를 통해 복제 하였다. 프라이머는 이전의 연구 4에서 기술 되었다. 그 후, cjBlue, eforRed 및 amilGFP 서열을하기와 같이 동일한 절차로 터미네이터 및 프로모터 서열과 연결 하였다&quot;xfig&quot;&gt; 그림 2. 올바른 구조가 대장균 으로 변형되어 아름다운 색상을 나타냅니다 ( 그림 3a ). 그 후 두 가지 색상 발현 카세트를 더 많은 색상 ( 즉, amilGFP + eforRed의 빨간색 색상, amilGFP + cjBlue의 녹색 색상 및 eforRed + cjBlue의 밝은 보라색 색상)을 만들기 위해 C-Brick 표준으로 조립했습니다 3b ). <img alt="그림 1" class="xfigimg" src="/files/ftp_upload/55775/55775fig1.jpg" /> 그림 1 : C- 브릭 표준 인터페이스 DNA 서열 및 C- 브릭 표준 벡터. ( a ) C-brick 표준 인터페이스 -T1, T2, T3, T4, T2 &#39;, T3&#39;-의 순서는 해당 crRNA에 의해 인식되고 Cpf1을 사용하여 5&#39;돌출부에 도입 될 수있다. T2 및 T3 (또는 T2 &#39;및 T3&#39;) 부위의 절단은 상보적인멈춰. 8 개의 제한 사이트가 설계되어 C-Brick 표준은 BioBrick 및 BglBrick과 부분적으로 호환됩니다. ( b ) 제한 소화 부위가있는 C-Brick 표준 벡터의 플라스미드 맵. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55775/55775fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" class="xfigimg" src="/files/ftp_upload/55775/55775fig2.jpg" /> 그림 2 : C-Brick 표준의 DNA 어셈블리 워크 플로. Cpf1 분해 된 T2 및 T3 표적 부위는 각각 &quot;GGATC&quot;및 &quot;GATCC&quot;의 상보 적 응집성 말단을 생성하며, 이는 짧은 &quot;GGATCC&quot;흉터를 생성하도록 연결될 수있다. 상세한 절차는 3 번 텍스트 ( &quot;C-Brick assembly&quot;)에서 찾을 수 있습니다. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55775/55775fig2large.jpg" target="_blank">여기를 클릭하십시오</a><html> 이 그림의 더 큰 버전을보십시오. <img alt="그림 3" class="xfigimg" src="/files/ftp_upload/55775/55775fig3.jpg" /> 도표 3 : C-Brick 기준에서 조립 된 구조를 보유하고있는 E. Coli 에 의해 생산 된 다채로운 박테리아 안료. ( a ) 플레이트 상에 성장 된 대장균 에서 3 개의 염색 단백질을 발현 시켰다. 염색 단백질이없는 세균 (음성 대조군)은 4 번째 판에 표시됩니다. ( b ) 세 가지 색소 단백질과 세 개의 조립 된 이중 색소 단백질은 액체 LB 배지에서 성장한 대장균 에서 발현 되었다. 1에서 6까지는 eforRed (1), amilGFP (2), cjBlue (3), amilGFP plus eforRed (4), amilGFP plus cjBlue (5) 및 eforRed plus cjBlue (6)를 나타냅니다. 단일 플레이트 또는 단일 마이크로 원심 분리 관에있는 다채로운 박테리아를 단일 서열 확인 클론으로부터 배양했습니다. les / ftp_upload / 55775 / 55775fig3large.jpg &quot;target =&quot;_ blank &quot;&gt;이 그림의 확대 버전을 보려면 여기를 클릭하십시오. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td colspan="3"> 순서 </td></tr><tr><td> T7-F </td><td colspan="3"> GAAATTAATACGACTCACTATAGGG </td></tr><tr><td> T7-T1-R </td><td colspan="3"> gaattcagtagaaagttgcgataaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC </td></tr><tr><td> T7-T2&#39;-R </td><td colspan="3"> ctagagtaaagcttgaattcagtaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC </td></tr><tr><td> T7-T2-R </td><td colspan="3"> ggatcctttctcctctttctagagATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC </td></tr><tr><td> T7-T3-R </td><td colspan="3"> ggatccactagtctctagctcgaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC </td></tr><tr><td> T7-T3&#39;-R </td><td colspan="3"> ctctagctcgagaaattcaaggaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC </td></tr><tr><td> T7-T4-R </td><td colspan="3"> ttcaagggaaactgcagctagctATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC </td></tr></tbody></table> 표 1 :이 연구에 사용 된 crRNA 전사 템플릿의 준비 Oligos. T7-F는 상부 가닥 올리고 뉴클레오타이드 였고 나머지는 하부 가닥 올리고 뉴클레오타이드였다. 서열의 소문자 염기는 crRNA의 가이드 서열로 전사 될 것이다. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 이름 </td><td colspan="3"> RNA 서열 (5&#39;-3 &#39;) </td></tr><tr><td> crRNA-T1 </td><td colspan="3"> GGGAAUUUUKUGUUGUAGAUUUAUCGCAACUUUCUACUGAAUUC </td></tr><tr><td> crRNA-T2 </td><td colspan="3"> GGGAAUUUCUACUGUUGUAGAUCUCUAGAAAGAGGAGAAAGGAUCC </td></tr><tr><td> crRNA-T3 </td><td colspan="3"> GGGAAUUUCUACUGUUGUAGAUUCGAGCUAGAGACUAGUGGAUCC </td></tr><tr><td> crRNA-T4 </td><td colspan="3"> GGGAAUUUCUACUGUUGUAGAUAGCUAGCUGCAGUUUCUCCUUGAA </td></tr><tr><td> crRNA-T2 &#39; </td><td colspan="3"> GGGAAUUUCUACUGUUGUAGAUUACUGAAUUCAAGCUUUACUCUAG </td></tr><tr><td> crRNA-T3 &#39; </td><td colspan="3"> GGGAAUUUUUUUUUUUUUUUUUUUUUUUUUUUUKUUUUUUUCUCGAGCUAGAG </td></tr></tbody></table> 표 2 : 본 연구에서 사용 된 crRNA 서열. 이 crRNA는 1 번 텍스트 ( &quot;crRNA의 준비&quot;) 에서 시험 관내 전사를 통해 생산되었다.

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR 관련 단백질 Cpf1은 원하는 위치에서 이중 가닥 DNA를 절단하여 끈적 거리는 말단을 생성하도록 특별히 고안된 CRISPR RNA (crRNA)에 의해 유도 될 수 있습니다. 이 특성을 바탕으로 DNA 어셈블리 표준 (C-Brick)이 수립되었으며 여기에 그 사용법을 자세히 설명하는 프로토콜이 설명되어 있습니다.

Cpf1을 이용한 C-Brick DNA 표준 어셈블리 프로토콜

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Nanyang Technological University

Research

JoVE Journal

Genetics

8.2K 조회수.  Chinese Academy of Sciences.  CRISPR 관련 단백질 Cpf1은 원하는 위치에서 이중 가닥 DNA를 절단하여 끈적 거리는 말단을 생성하도록 특별히 고안된 CRISPR RNA (crRNA)에 의해 유도 될 수 있습니다. 이 특성을 바탕으로 DNA 어셈블리 표준 (C-Brick)이 수립되었으며 여기에 그 사용법을 자세히 설명하는 프로토콜이 설명되어 있습니다. 

비디오: Protocols for C-Brick DNA Standard Assembly Using Cpf1

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.
A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native &beta;-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.
To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.
The last part of the toolkit - targeting survival - was implemented using solvent tolerance genes, PhPFD&alpha; and &beta;, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFD&alpha; and &beta; improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.
Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.

A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via &beta;-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.

수성 환경에서 탄화수소 전환을 사용하는 툴킷

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

연구

생체공학

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

사용자 정의 프로토콜 문자열 어셈블리 gRNA에 대 한 복제 (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

유전학

Capturing Chromosome Conformation Across Length Scales

Chromosome conformation capture (3C) is used to detect three-dimensional chromatin interactions. Typically, chemical crosslinking with formaldehyde (FA) is used to fix chromatin interactions. Then, chromatin digestion with a restriction enzyme and subsequent religation of fragment ends converts three-dimensional (3D) proximity into unique ligation products. Finally, after reversal of crosslinks, protein removal, and DNA isolation, DNA is sheared and prepared for high-throughput sequencing. The frequency of proximity ligation of pairs of loci is a measure of the frequency of their colocalization in three-dimensional space in a cell population.
A sequenced Hi-C library provides genome-wide information on interaction frequencies between all pairs of loci. The resolution and precision of Hi-C relies on efficient crosslinking that maintains chromatin contacts and frequent and uniform fragmentation of the chromatin. This paper describes an improved in situ Hi-C protocol, Hi-C 3.0, that increases the efficiency of crosslinking by combining two crosslinkers (formaldehyde [FA] and disuccinimidyl glutarate [DSG]), followed by finer digestion using two restriction enzymes (DpnII and DdeI). Hi-C 3.0 is a single protocol for the accurate quantification of genome folding features at smaller scales such as loops and topologically associating domains (TADs), as well as features at larger nucleus-wide scales such as compartments.

Hi-C 3.0 is an improved Hi-C protocol that combines formaldehyde and disuccinimidyl glutarate crosslinkers with a cocktail of DpnII and DdeI restriction enzymes to increase the signal-to-noise ratio and the resolution of chromatin interaction detection.

길이 척도에 걸친 염색체 형태 포착

Chromosome conformation capture (3C) is used to detect three-dimensional chromatin interactions. Typically, chemical crosslinking with formaldehyde (FA) ...

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D DNA nanostructures. Over decades, the rapid development of DNA nanotechnology is attributed to the use of linear DNAs as the source materials. For example, the DAO (double crossover, antiparallel, odd half-turns) tile is well-known as a building block for construction of 2D DNA lattices; the core structure of DAO is made from two linear single-stranded (ss) oligonucleotides, like two ropes making a right hand granny&#160;knot. Herein, a new type of DNA tiles called cDAO (coupled DAO) are built using a small circular ss-DNA of c64nt or c84nt (circular 64 or 84 nucleotides) as the scaffold strand and several linear ss-DNAs as the staple strands. Perfect 1D and 2D nanostructures are assembled from cDAO tiles: infinite nanowires, nanospirals, nanotubes, nanoribbons; and finite nano-rectangles. Detailed protocols are described: 1) preparation by T4 ligase and purification by denaturing PAGE (polyacrylamide gel electrophoresis) of small circular oligonucleotides, 2) annealing of stable circular tiles, followed by native PAGE analysis, 3) assembling of infinite 1D nanowires, nanorings, nanospirals, infinite 2D lattices of nanotubes and nanoribbons, and finite 2D nano-rectangles, followed by AFM (Atomic Force Microscopy) imaging. The method is simple, robust, and affordable for most labs.

This article presents a detailed protocol for T4 ligation and denaturing PAGE purification of small circular DNA molecules, annealing and native PAGE analysis of circular tiles, assembling and AFM imaging of 1D and 2D DNA nanostructures, as well as agarose gel electrophoresis and centrifugation purification of finite DNA nanostructures.

안정적인 DNA 모티프, 1d와 2D Nanostructures 작은 원형 DNA 분자에서 건설

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D ...

화학

학부 연구 및 교육을 위한 염색체 형태 캡처(3C)

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

저자 스포트라이트: 3C로 A 받기: 학부생을 위한 염색체 형태 포착  

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

3C로 A 받기: 학부생을 위한 염색체 형태 캡처

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and sensitivity in cells because the resolution of conventional light microscopy is diffraction-limited to ~250 nm. By combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM), PPIs can be visualized in cells with single molecule sensitivity and nanometer spatial resolution. BiFC is a commonly used technique for visualizing PPIs with fluorescence contrast, which involves splitting of a fluorescent protein into two non-fluorescent fragments. PALM is a recent superresolution microscopy technique for imaging biological samples at the nanometer and single molecule scales, which uses phototransformable fluorescent probes such as photoactivatable fluorescent proteins (PA-FPs). BiFC-PALM was demonstrated by splitting PAmCherry1, a PA-FP compatible with PALM, for its monomeric nature, good single molecule brightness, high contrast ratio, and utility for stoichiometry measurements. When split between amino acids 159 and 160, PAmCherry1 can be made into a BiFC probe that reconstitutes efficiently at 37 &#176;C with high specificity to PPIs and low non-specific reconstitution. Ras-Raf interaction is used as an example to show how BiFC-PALM helps to probe interactions at the nanometer scale and with single molecule resolution. Their diffusion can also be tracked in live cells using single molecule tracking (smt-) PALM. In this protocol, factors to consider when designing the fusion proteins for BiFC-PALM are discussed, sample preparation, image acquisition, and data analysis steps are explained, and a few exemplary results are showcased. Providing high spatial resolution, specificity, and sensitivity, BiFC-PALM is a useful tool for studying PPIs in intact biological samples.

Photoactivated Localization Microscopy with Bimolecular Fluorescence Complementation BiFC-PALM

Protein-protein interactions are visualized in cells with nanometer spatial resolution by combining bimolecular fluorescence complementation (BiFC) with photoactivated localization microscopy (PALM). Described here is the use of BiFC-PALM for imaging Ras-Raf interactions in U2OS cells for visualizing the nanoscale clustering and diffusion of individual Ras-Raf complexes.

이분자 형광 보완과 광 활성화 현지화 현미경 (BiFC-PALM)

Protein-protein interactions (PPIs) are key molecular events to biology. However, it remains a challenge to visualize PPIs with sufficient resolution and ...

Automated Robotic Liquid Handling Assembly of Modular DNA Devices

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; represented by &#34;devices&#34; created as combinations of individual genetic components. However, manual assembly of such large numbers of devices is time-intensive, error-prone, and costly. The increasing sophistication and scale of synthetic biology research necessitates an efficient, reproducible way to accommodate large-scale, complex, and high throughput device construction.
Here, a DNA assembly protocol using the Type-IIS restriction endonuclease based Modular Cloning (MoClo) technique is automated on two liquid-handling robotic platforms. Automated liquid-handling robots require careful, often times tedious optimization of pipetting parameters for liquids of different viscosities (e.g. enzymes, DNA, water, buffers), as well as explicit programming to ensure correct aspiration and dispensing of DNA parts and reagents. This makes manual script writing for complex assemblies just as problematic as manual DNA assembly, and necessitates a software tool that can automate script generation. To this end, we have developed a web-based software tool, http://mocloassembly.com, for generating combinatorial DNA device libraries from basic DNA parts uploaded as Genbank files. We provide access to the tool, and an export file from our liquid handler software which includes optimized liquid classes, labware parameters, and deck layout. All DNA parts used are available through Addgene, and their digital maps can be accessed via the Boston University BDC ICE Registry. Together, these elements provide a foundation for other organizations to automate modular cloning experiments and similar protocols.
The automated DNA assembly workflow presented here enables the repeatable, automated, high-throughput production of DNA devices, and reduces the risk of human error arising from repetitive manual pipetting. Sequencing data show the automated DNA assembly reactions generated from this workflow are ~95% correct and require as little as 4% as much hands-on time, compared to manual reaction preparation.

Here, an automated workflow to perform modular DNA &#34;device&#34; assembly using a modular cloning DNA assembly method on liquid-handling robots is presented. The protocol uses an intuitive software tool for generating liquid handler picklists for combinatorial DNA device library generation, which we demonstrate using two liquid handling platforms.

모듈형 DNA 장치 조립 로봇 액체 처리 자동화

Recent advances in modular DNA assembly techniques have enabled synthetic biologists to test significantly more of the available &#34;design space&#34; ...

Design and Synthesis of a Reconfigurable DNA Accordion Rack

DNA nanostructure-based mechanical systems or DNA nanomachines, which produce complex nanoscale motion in 2D and 3D in the nanometer to &#229;ngstr&#246;m resolution, show great potential in various fields of nanotechnology such as the molecular reactors, drug delivery, and nanoplasmonic systems. The reconfigurable DNA accordion rack, which can collectively manipulate a 2D or 3D nanoscale network of elements, in multiple stages in response to the DNA inputs, is described. The platform has potential to increase the number of elements that DNA nanomachines can control from a few elements to a network scale with multiple stages of reconfiguration.
In this protocol, we describe the entire experimental process of the reconfigurable DNA accordion rack of 6 by 6 meshes. The protocol includes a design rule and simulation procedure of the structures and a wet-lab experiment for synthesis and reconfiguration. In addition, analysis of the structure using TEM (transmission electron microscopy) and FRET (fluorescence resonance energy transfer) is included in the protocol. The novel design and simulation methods covered in this protocol will assist researchers to use the DNA accordion rack for further applications.

We describe the detailed protocol for design, simulation, wet-lab experiments, and analysis for a reconfigurable DNA accordion rack of 6 by 6 meshes.

재구성 가능한 DNA 아코디언 랙의 설계 및 합성

DNA nanostructure-based mechanical systems or DNA nanomachines, which produce complex nanoscale motion in 2D and 3D in the nanometer to &#229;ngstr&#246;m ...

Cpf1을 이용한 C-Brick DNA 표준 어셈블리 프로토콜

요약

더 많은 비디오 탐색

이 비디오의 챕터

수성 환경에서 탄화수소 전환을 사용하는 툴킷

사용자 정의 프로토콜 문자열 어셈블리 gRNA에 대 한 복제 (STAgR)

길이 척도에 걸친 염색체 형태 포착

안정적인 DNA 모티프, 1d와 2D Nanostructures 작은 원형 DNA 분자에서 건설

3C로 A 받기: 학부생을 위한 염색체 형태 캡처

3C로 A 받기: 학부생을 위한 염색체 형태 캡처

3C로 A 받기: 학부생을 위한 염색체 형태 캡처

이분자 형광 보완과 광 활성화 현지화 현미경 (BiFC-PALM)

모듈형 DNA 장치 조립 로봇 액체 처리 자동화

재구성 가능한 DNA 아코디언 랙의 설계 및 합성