We thank Shanghai Tolo Biotech for their technical assistance during the development of the C-Brick standard. This work was supported by grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDB19040200).

1. Preparation of crRNA
<ol>
	<li>Preparation of crRNA templates
	<ol>
		<li>Re-suspend individual oligonucleotides (Table 1) in RNase-free water to a concentration of 10 &#181;M.</li>
		<li>Add 22.5 &#181;L of top-strand oligonucleotide (T7-F in Table 1), 22.5 &#181;L of bottom-strand oligonucleotide (Table 1), and 5 &#181;L of 10x annealing buffer to a 0.2 mL PCR tube. Ensure that the total volume is 50 &#181;L. 
		NOTE: Six different bottom-strand oligonucleotides are shown in Table 1, each of which should be individually paired with the top-strand T7-F. The lowercase letters in Table 1 represent the sequence to be transcribed into the guide sequence of crRNA. 10x Taq PCR buffer can be used instead of the 10x annealing buffer.</li>
		<li>Place the PCR tube into a thermocycler.</li>
		<li>Run the annealing program: initial denaturation at 95 &#176;C for 5 min and then a cooldown from 95-20 &#176;C, with a 1 &#176;C decrease per min on the thermocycler. 
		NOTE: Immediately use the samples for step 1.2.1.</li>
	</ol>
	</li>
	<li>Transcription and purification of crRNA
	<ol>
		<li>Add 38 &#181;L of RNase-free water, 8 &#181;L of the template from step 1.1.4, 20 &#181;L of 5x T7 transcription buffer, 20 &#181;L of NTP mixture (10 &#181;M), 4 &#181;L of recombinant RNase inhibitor (RRI), and 10 &#181;L of T7 RNA polymerase to a 1.5 mL microcentrifuge tube. Ensure that the total volume is 100 &#181;L.</li>
		<li>Put the microcentrifuge tube in a 37 &#176;C water bath overnight (for about 16 h).</li>
		<li>Use an RNA cleanup and concentration kit to purify the transcribed RNA; follow the manufacturer&#39;s protocol.</li>
		<li>Quantitate the RNAs with UV-Vis spectrophotometers and dilute the RNA to a concentration of 10 &#181;M. Use the samples immediately or store them at -80 &#176;C. 
		NOTE: The crRNA sequences are listed in Table 2.</li>
	</ol>
	</li>
</ol>
2. Construction of C-Brick Parts ( i.e., the Insertion of Biological Parts into a C-Brick Standard Vector)
NOTE: This step has three sub-steps. For short biological parts (e.g., promoters and terminators), it is best to use the direct PCR method to insert the biological parts into a C-Brick standard vector4. The whole vector sequence is shown in the supplementary data, and the prefix and suffix sequence is shown in Figure 1 (step 2.1, below). For biological parts that can be easily obtained via PCR (e.g., with templates of genomic DNA, plasmids, or de novo synthesized DNA sequences), it is best to use the seamless assembly method to insert the biological parts into a C-Brick standard vector (step 2.2, below). For those parts obtained from BioBrick and BglBrick standards, restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation can be used to insert the biological parts into a C-Brick standard vector (step 2.3, below).
<ol>
	<li>Construction via direct PCR amplification
	<ol>
		<li>Design and order oligonucleotides for PCR amplification. 
		NOTE: The 5&#39;-end of the oligonucleotide contains the sequence of the DNA part, and 3&#39;-end of the oligonucleotide contains the vector sequence (i.e., &#34;GGATCCACTAGTCTCTAGCTCG&#34; at the 3&#39;-end of the forward strand and &#34;GGATCCTTTCTCCTCTTTCTAG&#34; in the reverse strand). Either no overhang or a ~20-bp overhang can be designed at the 5&#39;-end of the oligonucleotide. Specific examples can be found in a previous study4.</li>
		<li>Re-suspend individual oligonucleotides in ultra-pure water to a concentration of 10 &#181;M.</li>
		<li>Set up PCR reactions on ice in a 0.2 mL PCR tube: add 18 &#181;L of ultra-pure water, 25 &#181;L of 2x PCR buffer, 1 &#181;L of dNTPs (10 &#181;M), 2.5 &#181;L each of the forward and reverse primers (10 &#181;M) from step 2.1.2, 0.5 &#181;L of C-Brick standard vector (50 ng) as a template, and 0.5 &#181;L of high-fidelity DNA polymerase. Ensure that the total volume is 50 &#181;L.</li>
		<li>Place the tube directly into a thermocycler and start the thermocycler program. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Thermocycler program: one cycle for 3 min at 98 &#176;C; thirty cycles for 10 s at 98 &#176;C, 20 s at 55 &#176;C, and 2 min at 72 &#176;C; and one cycle for 10 min at 72 &#176;C. Keep the sample at 16 &#176;C.</li>
		<li>Add 9 &#181;L of the mixture from step 2.1.4 to a 1.5 mL microcentrifuge tube.</li>
		<li>Add 1 &#181;L of DpnI and incubate for 1 h in a 37 &#176;C water bath. 
		NOTE:&#12288;If the primers have no overlapping sequences, add 0.5 &#181;L of T4 polynucleotide kinase (PNK) and 0.5 &#181;L of T4 DNA ligase and incubate in a 22 &#176;C water bath for 1 h. Otherwise, if the primers contain a ~20 nt overlapping sequence, directly transform the DpnI-treated products into E. coli (DH10B)-competent cells (step 2.4). The linearized PCR product will be circularized by the recombination system in the host.</li>
		<li>Use the samples immediately or store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Construction via seamless assembly
	<ol>
		<li>Design and order oligonucleotides for PCR amplification. 
		NOTE: The 3&#39;-end of the oligonucleotide contains the terminal sequence of the DNA part, and the 5&#39;-end of the oligonucleotide contains the terminal of the linearized C-Brick standard vector sequence (i.e., &#34;CTAGAAAGAGGAGAAAGGATCC&#34; for the 5&#39;-end of the forward strand and &#34;CGAGCTAGAGACTAGTGGATCC&#34; for the 5&#39;-end of the reverse strand). Specific examples can be found in a previous study4.</li>
		<li>Re-suspend the individual oligonucleotides in ultra-pure water to a concentration of 10 &#181;M.</li>
		<li>Set up PCR reactions on ice in a 0.2 mL PCR tube: add 18 &#181;L of ultra-pure water, 25 &#181;L of 2x PCR buffer, 1 &#181;L of dNTPs (10 &#181;M), 2.5 &#181;L each of the forward and reverse primers (10 &#181;M) from step 2.2.2, 0.5 &#181;L of template (20-500 ng), and 0.5 &#181;L of high-fidelity DNA polymerase. Ensure that the total volume is 50 &#181;L.</li>
		<li>Place the tube directly into the thermocycler and run the thermocycler program. Use the samples immediately or freeze and store them at -20 &#176;C. 
		NOTE: Set the thermocycler program to: one cycle for 3 min at 98 &#176;C; 30 cycles for 10 s at 98 &#176;C, 20 s at 55 &#176;C (according to the annealing temperature of the primer), and 1 min (according to the length of the biological parts) at 72 &#176;C; and one cycle for 10 min at 72 &#176;C. Keep the sample at 16 &#176;C.</li>
		<li>Purify the PCR product using a PCR cleanup system kit; follow the manufacturer&#39;s protocol.</li>
		<li>Digest the C-Brick standard vector with BamHI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (1 &#181;g), 5 &#181;L of 10x buffer, and 1 &#181;L of BamHI to the microcentrifuge tube. Incubate for up to 2 h at 37 &#176;C in a water bath.</li>
		<li>Purify the above product using a gel cleanup system kit; follow the manufacturer&#39;s protocol.</li>
		<li>Add 2 &#181;L of linearized vector (50 ng) from step 2.2.7, 5 &#181;L of fragment (200 ng) from step 2.2.4, 2 &#181;L of 5x seamless assembly buffer, and 1 &#181;L of seamless assembly enzyme from a seamless assembly kit to a 1.5-mL microcentrifuge tube.Ensure that the total volume is 10 &#181;L.</li>
		<li>Place this in a 37 &#176;C water bath for 30 min. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Construction via restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation. 
	NOTE: For those parts obtained from the BioBrick (step 2.3.4-2.3.7) and BglBrick (step 2.3.1-2.3.3) standards, restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation can be used to insert the biological parts into a C-Brick standard vector.
	<ol>
		<li>Digest the BglBrick standard parts with BamHI and BglII: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (2 &#181;g), 5 &#181;L of 10x buffer 3, 0.5 &#181;L of BamHI, and 0.5 &#181;L of BglII to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Run a 1% agarose gel electrophoresis and purify the fragment using a gel cleanup system kit.</li>
		<li>Ligate the fragment and the C-Brick standard vector: add 2 &#181;L of linearized vector (50 ng) from step 2.1.12 and 6 &#181;L of fragment (200 ng) from step 2.3.3 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10 x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Digest the BioBrick standard parts with XbaI and SpeI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (2 &#181;g), 5 &#181;L of 10x buffer, 0.5 &#181;L of XbaI, and 0.5 &#181;L of SpeI to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Digest the C-Brick standard vector with XbaI and SpeI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (1 &#181;g), 5 &#181;L of 10x buffer, 0.5 &#181;L of XbaI, and 0.5 &#181;L of SpeI to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Run a 1% agarose gel electrophoresis and purify the fragment from step 2.3.4 and the linearized vector from step 2.3.5 with a gel cleanup system kit; following the manufacturer&#39;s protocol.</li>
		<li>Ligate the fragment and the C-Brick vector: add 2 &#181;L of linearized vector (50 ng) from step 2.3.5 and 6 &#181;L of fragment (200 ng) from step 2.3.4 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Add 10 &#181;L of the products from step 2.1.8, 2.2.9, 2.3.3, or 2.3.7 for chemical transformation into the competent cells of E. coli (DH10B).</li>
	<li>Pick-up several clones to a 5-mL liquid Luria-Bertani (LB) tube and incubate at 37 &#176;C on a shaker (220 rpm) overnight.</li>
	<li>Extract the plasmid using a plasmid preparation kit; follow the manufacturer&#39;s protocol.</li>
	<li>Identify the correct clones by Sanger sequencing11.</li>
</ol>
3. C-Brick Assembly (Figure 2)
<ol>
	<li>Digestion of the C-Brick vector with Cpf1
	<ol>
		<li>Add 22.5 &#181;L of RNase-free water, 4 &#181;L of 10x Cpf1 buffer, 10 &#181;L of the plasmid from step 2.6 (1 &#181;g), 0.5 &#181;L of RRI, and 1 &#181;L of Cpf1 (5 &#181;M) to a 1.5-mL microcentrifuge tube. 
		NOTE: Cpf1 can be purchased commercially or purified following the protocol in a previous study4.</li>
		<li>To insert a foreign DNA fragment into the T1 and T2 sites, add 1 &#181;L of crRNA-T2 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 30 min. Add 1 &#181;L of crRNA-T1 (10 &#181;M) and Cpf1 (5 &#181;M) for another 30 min. 
		NOTE: Alternatively, to insert a foreign DNA fragment into the T3 and T4 sites, add 1 &#181;L of crRNA-T3 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 30 min. Add 1 &#181;L of crRNA-T4 (10 &#181;M) for another 30 min.</li>
		<li>Add 1 &#181;L of thermosensitive alkaline phosphatase and incubate the tube in a 37 &#176;C water bath for another 1 h.</li>
		<li>Run an agarose gel electrophoresis and purify the vector using a gel cleanup system kit. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Digestion of the DNA fragment with Cpf1
	<ol>
		<li>Add 21.5 &#181;L of RNase-free water, 4 &#181;L of 10x Cpf1 buffer, 10 &#181;L of plasmid from step 2.6 (2 &#181;g), 0.5 &#181;L of RRI, and 2 &#181;L of Cpf1 (5 &#181;M) to a 1.5-mL microcentrifuge tube.</li>
		<li>To insert a foreign DNA fragment into the T1 and T2 sites, add 1 &#181;L of crRNA-T1 (10 &#181;M) and 1 &#181;L of crRNA-T3 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 2 h. 
		NOTE: Alternatively, add 1 &#181;L of crRNA-T2 (10 &#181;M) and 1 &#181;L of crRNA-T4 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 2 h.</li>
		<li>Run an agarose gel electrophoresis and purify the fragment using a gel cleanup system kit. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>C-Brick assembly and further verification
	<ol>
		<li>Ligate the foreign DNA fragment and C-Brick vector: add 2 &#181;L of the linearized vector (50 ng) from step 3.1.4 and 6 &#181;L of the DNA fragment (200 ng) from step 3.2.3 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Add 10 &#181;L of the ligation products (step 3.3.1) for chemical transformation into E. coli (DH10B)-competent cells.</li>
		<li>Add several clones to a 5 mL liquid LB tube and incubate overnight on a shaker at 220 rpm and 37 &#176;C.</li>
		<li>Extract the plasmid using a plasmid preparation kit; follow the manufacturer&#39;s protocol.</li>
		<li>Identify correct clones by Sanger sequencing11.</li>
	</ol>
	</li>
	<li>Perform a new round of C-Brick assembly. Correct clones from step 3.3.4 can be used as a new C-Brick vector or DNA part for further iterative C-Brick assembly, following the same protocol from steps 3.1-3.3. 
	NOTE: T2&#39; and T3&#39; sites are designed as the backup of T2 and T3 sites (Figure 1a). For plasmids obtained from step 2.3.7, only T2&#39; and T3&#39; can be used for the C-Brick standard assembly.</li>
</ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

The authors have nothing to disclose.

This protocol describes a procedure for the DNA assembly standard C-Brick. The most important step in this protocol is the linearization of the C-Brick standard vector; incomplete cleavage of the vector could seriously affect the success rate. Additionally, although Cpf1 mainly cleaves target DNA sequences in the &#34;18-23&#34; cleavage pattern, inaccurate cleavage near the two bases was also detected4, which can cause a small number of mutations after DNA assembly. Therefore, Sanger sequencing is needed to verify the assembled construct.
The efficiency of the C-Brick assembly is lower than traditional restriction enzyme and ligation methods that have been described in a previous study4. The major reason affecting the assembly efficiency may be the inaccurate cleavage characteristics of Cpf1. In the future, improvements to the cleavage accuracy can be extremely useful for the standard and are currently being explored.
C-Brick is also partially compatible with the BglBrick and BioBrick standards. For example, BglBrick parts can be cut with BglII and BamHI and then inserted into the BamHI site of a C-Brick standard vector, generating a C-Brick part. However, the insertional direction of the BglBrick part should be verified, and there would be a &#34;GGATCT&#34; scar after assembly. When a C-Brick DNA part is obtained from a BioBrick part (i.e., with XbaI and SpeI digestion), both T2 and T3 sites will be destroyed, and two backup Cpf1 target sequences (T2&#39; and T3&#39;) can be used.
As the Cpf1 cleavage requires sgRNA, which is extremely sensitive to RNase, all materials should be RNase-free. Currently, all C-Brick standard vectors, RNase-free Cpf1 nucleases, and crRNAs can be ordered commercially12. Therefore, the procedures for C-Brick are actually as simple as those of the BioBrick standard.
In the past few years, several useful DNA assembly methods have been developed and are widely used, including Golden Gate Assembly13, Gibson Assembly14, and others15. However, as DNA assembly standards have the potential to provide cost-effective, reliable, high-throughput, and automatic assembly reactions5, standards may facilitate the construction and testing of newly designed or re-designed genes, genetic circuits, and pathways15,16,17, especially in the field of synthetic biology. Among the currently published DNA assembly standards, the C-Brick standard has both obvious advantages and disadvantages4 (i.e., the ligation efficiency). If the ligation efficiency is improved, the standard can be widely adopted in the future.

The standardization of DNA biological parts is important for the development of synthetic biology1. The development of a DNA assembly procedure can replace ad hoc experimental designs and remove many of the unexpected outcomes that arise during the assembly of genetic components into larger systems. The BioBrick standard (BBF RFC 10) was one of the earliest proposed DNA assembly standards. It uses the prefix sequence (containing EcoRI and XbaI cutting sites) and the suffix sequence (containing SpeI and PstI cutting sites)2,3. Because XbaI and SpeI have complementary cohesive ends, BioBrick DNA parts that are cut with XbaI and SpeI can be joined together, generating a new BioBrick for further iterative assembly.
Some defects have been identified with the use of the BioBrick standard4. For example, it produces an 8-bp scar between the DNA parts, which does not allow for the construction of in-fusion proteins. Besides, the four abovementioned types of 6-bp restriction sites must be removed from the DNA parts, which is very inconvenient. The BglBrick standard was established to solve the first problem5. It creates a 6-bp &#34;GGATCT&#34; scar, producing Gly-Ser and allowing for the fusion of multiple proteins or protein domains. iBrick was developed to deal with the second problem6. It uses homing endonucleases (HEs) that recognize long DNA sequences. As the HE recognition sites rarely exist in natural DNA sequences, the iBrick standard can be used for the direct construction of iBrick parts without modifying their DNA sequences. However, the iBrick standard leaves a 21 bp scar between the DNA parts, which might be the reason for its unpopularity.
In recent years, the clustered regularly interspaced short palindromic repeats (CRISPR) system has developed rapidly7,8. Among the CRISPR-associated (Cas) proteins, Cas9 endonuclease from Streptococcus pyogenes is now widely used. It mostly introduces double-stranded DNA breaks (DSBs) with blunt ends9.
In 2015, Zhang and coworkers characterized Cpf1 (CRISPR from Prevotella and Francisella 1) for the first time. It belongs to the class 2 type V CRISPR-Cas system and is a CRISRP RNA (crRNA)-guided endonuclease10. Unlike Cas9, Cpf1 introduces a DSB with a 4 or 5 nt 5&#39; overhang10. Based on this characteristic, Cpf1 was used to develop a DNA assembly standard, C-Brick4. On a C-Brick standard vector, four Cpf1 target sites of prefixed T1/T2 and suffixed T3/T4 flank the biological parts; this is similar to the BioBrick standard. As the cleavage of T2 and T3 sites produces complementary sticky ends, it is possible to perform the iterative assembly of DNA parts while generating a &#34;GGATCC&#34; scar between the parts. Notably, the C-Brick standard has two main advantages: recognizing long target sequences and leaving short scars. The 6 bp &#34;GGATCC&#34; scar generated by C-Brick encodes Gly-Ser, which allows for the construction of fusion proteins. Moreover, the C-Brick standard is also partially compatible with the BglBrick and BioBrick standards.

<table border="0" cellpadding="0" cellspacing="0" width="828">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Comercial Oligonucleotide</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;"></td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Taq PCR Buffer</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">#J40928</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ultra Pure Distilled Water</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">10977-015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x RNA Transcription Buffer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">K0441</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T7 RNA polymerase</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EP0111</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">NTP mixture</td>
			<td style="width:160px;">Sangon</td>
			<td style="width:161px;">#ND0056</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RRI(Recombinant RNase Inhibitor)</td>
			<td style="width:160px;">Takara</td>
			<td style="width:161px;">2313A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RNA Clean &#38; Concentrator-5</td>
			<td style="width:160px;">Zymo Research</td>
			<td style="width:161px;">R1015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">UV-Vis Spectrometer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">Nano-Drop 2000c</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">2x Phanta Max Buffer</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">PB505</td>
			<td>PCR buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">dNTPs</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">AD101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:316px;">Phanta Max Super-Fidelity DNA Polymerase</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">P505-d1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ezmax for One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">24303-1</td>
			<td>seamless assembly kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x Buffer for Ezmax One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32006</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI-HF</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BglII&#160;</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0144L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">XbaI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0145L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SpeI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3133L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Buffer 3</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#B7003S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x CutSmart Buffer</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x T4 DNA ligase Buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32002</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 PNK</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32206</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 DNA ligase</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32210</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">DpnI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R01762</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SV Gel and PCR clean-up system</td>
			<td style="width:160px;">Promega</td>
			<td style="width:161px;">A9282</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Plasmid Mini Kit I</td>
			<td style="width:160px;">Omega</td>
			<td style="width:161px;">D6943-02</td>
			<td>plasmid preparation kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermosensitive alkaline phosphatase&#160;</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EF0651</td>
			<td>FastAP</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Cpf1 buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32008</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Cpf1</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32105</td>
			<td>FnCpf1</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermocycler</td>
			<td style="width:160px;">Applied Biosystems</td>
			<td style="width:161px;">veriti 96 well</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">C-Brick standard vector</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">98101</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">E. coli [DH10B]</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">18297010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (tryptone)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0042</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (yeast extract)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0021</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (NaCl)</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;">B126BA0007</td>
			<td></td>
		</tr>
	</tbody>
</table>

protocols for c-brick dna standard assembly using cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this characteristic, Cpf1 has been used for the establishment of a DNA assembly standard called C-Brick, which has the advantage of long recognition sites and short scars. On a standard C-Brick vector, there are four Cpf1 recognition sites &#8211; the prefix (T1 and T2 sites) and the suffix (T3 and T4 sites) &#8211; flanking biological DNA parts. The cleavage of T2 and T3 sites produces complementary sticky ends, which allow for the assembly of DNA parts with T2 and T3 sites. Meanwhile, a short &#34;GGATCC&#34; scar is generated between parts after assembly. As the newly formed plasmid once again contains the four Cpf1 cleavage sites, the method allows for the iterative assembly of DNA parts, which is similar to those of BioBrick and BglBrick standards. A procedure outlining the use of the C-Brick standard to assemble DNA parts is described here. The C-Brick standard can be widely used by scientists, graduate and undergraduate students, and even amateurs.

This protocol demonstrated the assembly of three chromoprotein cassettes (cjBlue (BBa_K592011), eforRed (BBa_K592012), and amilGFP (BBa_K592010)). First, the coding sequences of the three abovementioned genes and terminators were individually cloned into a C-Brick standard vector. Short DNA parts, promoter and terminator, were introduced into the C-Brick vector through PCR amplification using primers containing the short DNA parts on the 5&#39; terminal. This was followed by the self-ligation method. Three chromoprotein-encoding sequences were first de novo synthesized and then cloned into the C-Brick standard vector through seamless assembly. The primers were described in a previous study4.
After that, cjBlue, eforRed, and amilGFP sequences were ligated with terminator and promoter sequences in the same procedure shown in Figure 2. Correct constructs were transformed into E. coli, demonstrating beautiful colors (Figure 3a). Subsequently, two color-expression cassettes were further assembled with the C-Brick standard to create more colors (i.e., the red color from amilGFP plus eforRed, the green color from amilGFP plus cjBlue, and the light purple color from eforRed plus cjBlue; Figure 3b).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55775/55775fig1.jpg" /> 
Figure 1: C-Brick Standard Interface DNA Sequence and C-Brick Standard Vector. (a) The sequence of the C-brick standard interface-T1, T2, T3, T4, T2&#39;, T3&#39;-can be recognized by its corresponding crRNA and then introduced into a 5&#39; overhang using Cpf1. The cleavage of T2 and T3 (or T2&#39; and T3&#39;) sites produces complementary overhangs. With the eight restriction sites designed, the C-Brick standard is partially compatible with BioBrick and BglBrick. (b) Plasmid map for the C-Brick standard vector with restriction digestion sites. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55775/55775fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55775/55775fig2.jpg" /> 
Figure 2: The Workflow for DNA Assembly in the C-Brick Standard. Cpf1-digested T2 and T3 target sites produce complementary cohesive ends of &#34;GGATC&#34; and &#34;GATCC,&#34; respectively, which can be ligated to generate a short &#34;GGATCC&#34; scar. Detailed procedures can be found in step 3 in the text (&#34;C-Brick assembly&#34;). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55775/55775fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/55775/55775fig3.jpg" /> 
Figure 3: Colorful Bacterial Pigments Produced by E. coli Harboring Constructs Assembled in the C-Brick Standard. (a) Three chromoproteins were expressed in E. coli grown on a plate. Bacteria with no chromoproteins (negative control) are shown on the 4th plate. (b) Three chromoproteins and three assembled dual chromoproteins were expressed in E. coli grown in liquid LB medium. From 1 to 6, the constructs expressed eforRed (1), amilGFP (2), cjBlue (3), amilGFP plus eforRed (4), amilGFP plus cjBlue (5), and eforRed plus cjBlue (6). The colorful bacteria on a single plate or in a single microcentrifuge tube were cultured from a single sequence-verified clone. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55775/55775fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>name</td>
			<td colspan="3">sequence</td>
		</tr>
		<tr>
			<td>T7-F</td>
			<td colspan="3">GAAATTAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>T7-T1-R</td>
			<td colspan="3">gaattcagtagaaagttgcgataaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC</td>
		</tr>
		<tr>
			<td>T7-T2&#39;-R</td>
			<td colspan="3">ctagagtaaagcttgaattcagtaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC</td>
		</tr>
		<tr>
			<td>T7-T2-R</td>
			<td colspan="3">ggatcctttctcctctttctagagATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC</td>
		</tr>
		<tr>
			<td>T7-T3-R</td>
			<td colspan="3">ggatccactagtctctagctcgaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC</td>
		</tr>
		<tr>
			<td>T7-T3&#39;-R</td>
			<td colspan="3">ctctagctcgagaaattcaaggaATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC</td>
		</tr>
		<tr>
			<td>T7-T4-R</td>
			<td colspan="3">ttcaagggaaactgcagctagctATCTACAACAGTAGAAATTCCCTATAGTGAGTCGTATTAATTTC</td>
		</tr>
	</tbody>
</table>
Table 1: Oligos for the Preparation of the crRNA Transcription Templates used in this Study. T7-F was the top-strand oligonucleotide, and the others were the bottom-strand oligonucleotides. The lowercase bases in the sequence will be transcribed into the guide sequence in crRNA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>names</td>
			<td colspan="3">RNA sequences (5&#39;-3&#39;)</td>
		</tr>
		<tr>
			<td>crRNA-T1</td>
			<td colspan="3">GGGAAUUUCUACUGUUGUAGAUUUAUCGCAACUUUCUACUGAAUUC</td>
		</tr>
		<tr>
			<td>crRNA-T2</td>
			<td colspan="3">GGGAAUUUCUACUGUUGUAGAUCUCUAGAAAGAGGAGAAAGGAUCC</td>
		</tr>
		<tr>
			<td>crRNA-T3</td>
			<td colspan="3">GGGAAUUUCUACUGUUGUAGAUUCGAGCUAGAGACUAGUGGAUCC</td>
		</tr>
		<tr>
			<td>crRNA-T4</td>
			<td colspan="3">GGGAAUUUCUACUGUUGUAGAUAGCUAGCUGCAGUUUCUCCUUGAA</td>
		</tr>
		<tr>
			<td>crRNA-T2&#39;</td>
			<td colspan="3">GGGAAUUUCUACUGUUGUAGAUUACUGAAUUCAAGCUUUACUCUAG</td>
		</tr>
		<tr>
			<td>crRNA-T3&#39;</td>
			<td colspan="3">GGGAAUUUCUACUGUUGUAGAUUCCUUGAAUUUCUCGAGCUAGAG</td>
		</tr>
	</tbody>
</table>
Table 2: The crRNA Sequences used in this Study. The crRNAs were produced through the in vitro transcription in step 1 in the text (&#34;Preparation of crRNA&#34;).

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR-associated protein Cpf1 can be guided by a specially designed CRISPR RNA (crRNA) to cleave double-stranded DNA at desired sites, generating sticky ends. Based on this characteristic, a DNA assembly standard (C-Brick) was established, and a protocol detailing its use is described here.

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Nanyang Technological University

Research

JoVE Journal

Genetics

8.2K Views.  Chinese Academy of Sciences. CRISPR-associated protein Cpf1 can be guided by a specially designed CRISPR RNA (crRNA) to cleave double-stranded DNA at desired sites, generating sticky ends. Based on this characteristic, a DNA assembly standard (C-Brick) was established, and a protocol detailing its use is described here.

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand genome maintenance mechanisms. Since recruitment and exchange of proteins at lesions are highly dynamic, their study requires the ability to generate DNA damage in a rapid and spatially-delimited manner. Here, we describe procedures to locally induce DNA damage in human cells using a commonly available laser-scanning confocal microscope equipped with a 405 nm laser line. Accumulation of genome maintenance factors at laser stripes can be assessed by immunofluorescence (IF) or in real-time using proteins tagged with fluorescent reporters. Using phosphorylated histone H2A.X (&#947;-H2A.X) and Replication Protein A (RPA) as markers, the method provides sufficient resolution to discriminate locally-recruited factors from those that spread on adjacent chromatin. We further provide ImageJ-based scripts to efficiently monitor the kinetics of protein relocalization at DNA damage sites. These refinements greatly simplify the study of the DDR dynamics.

Studying DNA damage repair kinetics requires a system to induce lesions at defined sub-nuclear regions. We describe a method to create localized double-stranded breaks using a laser-scanning confocal microscope equipped with a 405 nm laser and provide automated procedures to quantify the dynamics of repair factors at these lesions.

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Assessing Stem Cell DNA Integrity for Cardiac Cell Therapy

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data in all cells, including stem cells, and its integrity is fundamental to its regenerative ability. Stem cells undergo rapid propagation in labs to achieve the necessary numbers for transplantation. Accelerated cell growth leads to the loss of DNA integrity by accumulated metabolites, such as reactive oxygen, carbonyl, and alkylating agents. Transplanting these cells would result in poor engraftment and regeneration of the deteriorating organ. Moreover, transplanting DNA-damaged cells leads to mutations, DNA instability, cellular senescence, and possibly, life-threatening diseases such as cancer. Therefore, there is an immediate need for a quality control method to evaluate the cell's suitability for transplantation. Here, we provide step-by-step protocols for the assessment of the DNA integrity of stem cells prior to cell transplantation.

Here, we provide a detailed description of an experimental setup for an analysis of the assessment of DNA integrity in stem cells prior to cell transplantation.

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data ...

High-Throughput DNA Plasmid Multiplexing and Transfection Using Acoustic Nanodispensing Technology

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often performed at low throughput, it is moreover time-consuming and error-prone, even more so when multiplexing several plasmids. We developed an easy, fast, and accurate method to perform cell transfection in a 384-well plate layout using acoustic droplet ejection (ADE) technology. The nanodispenser device used in this study&#160;is based on this technology and allows precise nanovolume delivery at high speed from a source well plate to a destination one. It can dispense and multiplex DNA and transfection reagent according to a predesigned spreadsheet. Here we present an optimal protocol to perform ADE-based high-throughput plasmid transfection which makes it possible to reach an efficiency of up to 90% and a nearly 100% cotransfection in cotransfection experiments. We extend initial work by proposing a user-friendly spreadsheet-based macro, able to manage up to four plasmids/wells from a library containing up to 1,536 different plasmids, and a tablet-based pipetting guide application. The macro designs the necessary template(s) of the source plate(s) and generates the ready-to-use files for the nanodispenser and tablet-based application. The four-steps transfection protocol involves i) a diluent dispense with a classical liquid handler, ii) plasmid distribution and multiplexing, iii) a transfection reagent dispense by the nanodispenser, and iv) cell plating on the prefilled wells. The described software-based control of ADE plasmid multiplexing and transfection allows even nonspecialists in the field to perform a reliable cell transfection in a fast and safe way. This method enables rapid identification of optimal settings for a given cell type and can be transposed to higher-scale and manual approaches. The protocol eases applications, such as human ORFeome protein (set of open reading frames [ORFs] in a genome) expression or CRISPR-Cas9-based gene function validation, in nonpooled screening strategies.

This protocol describes high-throughput plasmid transfection of mammalian cells in a 384-well plate using acoustic droplet ejection technology. The time-consuming, error-prone DNA dispensing and multiplexing, but also the transfection reagent dispensing, are software-driven and performed by a nanodispenser device. The cells are then seeded in these prefilled wells.

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often ...