Name: epicardial outgrowth culture assay and ex vivo assessment of epicardial-derived cell migration
Uploaded: 2016-03-18T14:00:00.000+00:00
Duration: 7 min 44 s
Description: Watch this Scientific Journal Video about Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration at JoVE.com

EMS는 건강 (NIH)의 국립 연구소에서 보조금에 의해 지원되었다 [부여 번호 R01HL120919] 미국 심장 협회 [허가 번호 10SDG4350046] 국립 보건원 [허가 번호 UL1 TR000042]에서 로체스터 CTSA 수상의 대학; 그리고 AAB CVRI에서 시작 기금. MAT는 하워드 휴즈 의학 연구소 메드 - 속 - 대학원 이니셔티브에서 의학 및 치과 로체스터 대학의 대학에 교부금에 의해 부분적으로 지원되었다; 그리고 NIH [허가 번호 GM068411]에서 기관 루스 L. Kirschstein 국가 연구 서비스 상.

참고 : 마우스 모든 실험은 로체스터 대학 동물 자원에 대학위원회에 의해 승인되었다. 1 심 외막 파생물 문화 분석 (그림 1A) <ol><li> 준비 <ol><li> 5 % 소 태아 혈청 (FBS), 1 % 페니실린 / 스트렙토 마이신 (PEN / 패 혈성) 중간 (199) (M199)를 보충하여 주 외막 세포 격리 5 ml의 배지 A를 준비한다. </li><li> 매체 사전 따뜻한 100ml를 37 ° C의 물을 욕조에 행크스 &#39;균형 소금 솔루션 (HBSS). </li><li> 콜라겐 - 코팅 된 챔버 슬라이드를 30 분 동안 실온으로 가온하도록 허용. </li><li> 챔버 슬라이드의 각 웰에 100 ㎕의 매체 A를 추가하고 부드럽게 고르게 코트 콜라겐 표면에 회전합니다. 8-12 우물을 반복합니다. 코팅 챔버 후 용지를 제거합니다. </li><li> 분취 액을 50 ㎖의 HBSS를 각각 함유하는 두 개의 10cm 2 플레이트로 HBSS를 예열. </li></ol></li><li> 11.5 일 후 교미 (DPC)에서 임신 댐에서 배아 마음을 격리 할 것.(30) <ol><li> 복강 내 주사를 통해 13 ㎎ / ㎖ 케타민 / 0.88 밀리그램 / 1 배 둘 베코 인산염 완충 식염수 (DPBS)의 ㎖의 자일 라진 칵테일의 0.5 ml의 마우스를 마취. 발가락 핀치 테스트를 사용하여 적절한 마취를 확인합니다. 부드러운 핀치 마우스가 응답 여부를 결정하기에 충분하다. 모든 이동이나 발 철회은 동물이 충분히 수술을 할 마취되지 않음을 나타냅니다. 자궁 전위에 의해 안락사. </li><li> 최대 복부 측면에 대향하는 마우스를 놓고 머리에 의한 오염을 줄이기 위해 70 % 에탄올로 복부를 스프레이. </li><li> 집게로 피부를 조이고 수술 가위로 복부에 횡 절개를 잘라. 단단히 피부를 누른 다음, 머리와 꼬리를 향해 반대 방향으로 간격을 당깁니다. </li><li> 집게로 복막을 조이고 복강을 노출 가위로 잘라. </li><li> 조심스럽게 mesometrium을 따라 절단하여 탈락을 제거합니다. 하는 해부 탈락 이동 처음에 HBSS를 미리 예열10cm 2 판. </li><li> 배아 사이에 절단하여 탈락을 분리합니다. </li><li> 해부 현미경 미리 예열 HBSS로 두 번째 10cm 2 판에 배아를 전송합니다. 조심스럽게 다음 배아 목을 벨의 배외 (extraembryonic) 조직과 난황 주머니를 제거합니다. </li><li> 집게와 흉부 벽을 조이고 흉강을 노출, 중간 선에서 떨어져 조직을 찢어. </li><li> 심장 뒤 집게를 놓습니다. 유출 관을 잡고 멀리 배아의 마음을 잡아 당깁니다. 아직 장착되어있는 경우, 심장에서 폐 기관과 폐를 분리합니다. </li></ol></li><li> 콜라겐 코팅 슬라이드 하나의 웰에 마음을 전송하고 (그림 1B)를 그 지느러미면을 아래로 놓습니다. 각각의 배아에 대한 단계를 반복 1.2.7-1.3. </li><li> 일단 모든 하트 개별 ​​웰에 이전되고, 37 ° C에서 30 분 동안 상기 챔버 슬라이드를 부화, 5 % CO 2는 콜라겐 기질에 충분한 접착을 허용한다. </li><li> 조심스럽게 추가각 심장 주위 예열 이식편 매체 A의 20 내지 50 μL. 중요 : 너무 빨리 또는 심장 위의 레벨에 미디어를 추가하지 마십시오, 그렇지 않으면 마음 콜라겐 기판에서 분리 할 수​​ 있습니다. </li><li> 문화 약 24 시간 동안 37 ° C, 5 % CO 2에서 마음 심 외막 가지를 허용합니다. 참고 :의 outgrowths는 문화의 조기 3-4로 시간 (그림 1C)를 관찰 주로 최소한의 중간 엽 세포 오염 (도 1D, E)과 자갈이 깔린 형태를 표시 중피 세포로 구성 될 수있다. 대표적인 결과는 카메라가 장착 된 해부 현미경을 사용하여 획득 하였다. </li></ol> 심 외막의 outgrowths 2. 유전 적 절제 및 EMT의 유도 주의 : 승인 된 바이오 안전성 가이드 라인에 따라주의 아데노 바이러스를 처리합니다. <ol><li> 15 ml의에게 매체 B를 준비 수욕에서 37 ° C로 사전 따뜻하고 (M199은 1 % FBS, 1 % 펜 / 연쇄상 구균 보충). </li><li> 의 절단을 위해floxed 대립 유전자는 Cre 호텔의 재조합 효소를 발현하는 아데노 바이러스 2.5 × 104 PFU / ㎖ (광고 / Cre 호텔) 또는 제어 바이러스에 보충 이식편 매체 B를 준비합니다. 주 : 후보 유전자의 아데노 바이러스 매개 과발현은 또한 기능 표현형의 증가를 평가하기 위해 수행 될 수있다. 바이러스 역가가 최종 사용자에 의해 결정되어야한다. </li><li> 조심스럽게 집게를 사용 부산물 문화의 심장 외막 고갈 마음을 제거합니다. 나중에 RNA 분리 및 유전자 발현 분석을 위해 -80 ° C에서 1.5 ml를 800 ㎕의 트리 졸와 튜브 및 저장소로 전송 마음입니다. </li><li> 혈액 세포와 과잉 세포 파편을 제거하는 DPBS 잘 각을 씻으십시오. </li><li> 각 가지 문화 500 μl를 아데노 바이러스 (들)로 보충 이식편 매체 B를 추가하고 37 ° C, 5 % CO 2에서 24 시간 동안 배양한다. </li><li> EMT 유도를 들어, 미디어를 제거하고 재조합 형질 전환 성장 인자 (TGF)로 보충 37 ° C 이식편 매체 B -β1 [10 NG / ㎖] 또는 차량 (4 MM의 시간과 보충ydrochloric 산 (염산)를 함유하는 1 ㎎ / ㎖ 소 혈청 알부민 (BSA)). 37 ° C에서 추가로 24 시간 동안 배양 외식, 5 % CO 2. 유전자 / 발현 분석 단백질 또는 후속 프로토콜에 설명 된대로 면역 세포를 진행합니다. 참고 : 심 외막 EMT의 유도가 0.5 NG / ㎖에 이르기까지 TGF-β1의 다양한 농도로 자극 한 - 10 NG / ㎖ 26,31-33. 리간드의 높은 농도는 모든 TGF-β 수용체에 결합하는 비 특정 될 수 있습니다. TGF-β1의 농도는 특정 실험의 목표를 반영해야한다. </li></ol> 심 외막의 outgrowths 3. 유전자 발현 분석 <ol><li> 이전에 트리 졸 (2.2)에 저장 해동 심장 외막 고갈 된 마음입니다. </li><li> EPDC 문화에서 대기음 미디어와는 DPBS로 두 번 씻는다. </li><li> 문화를 이식편하는 800 ㎕를 실온 트리 졸을 추가합니다. </li><li> 객실 temperatu에서 5 분 동안 트리 졸의 심장 외막 고갈 마음과 EPDC 문화를 품다<html> 레. 최대 피펫 및 열 배 아래로 용해 샘플을 균질화 할 수 있습니다. 참고 : 마음이 완전히 균질화 더 피펫을 필요로 할 수있다. </li><li> 1.5 ml의 튜브에 해물을 전송하고 제조업체의 지침에 따라 총 RNA 분리를 진행합니다. RNA 수율을 증가시키기 전에 강수량 10 μg의 글리코겐을 추가합니다. 주어진 이식편은 약 0.5 ~ 1.0 μg의 RNA를 얻을 것입니다. </li><li> DNase의 I와 오염 DNA를 제거하고 제조업체의 지침에 따라 0.5 μg의 mRNA의를 전사 역. </li><li> 녹색 SYBR 및 글리 세르 알데히드 -3- 인산 탈수소 효소 (GAPDH)에 표 1. 표준화 mRNA 수준을 설명 마커를 사용하여 심 외막 외식 및 / 또는 정량적 역전사와 EMT 유도의 순도 (QRT) - PCR (34)를 확인하고 사용 기준 식을 계산 2 - ΔΔCt 방법 35. 전형적인 결과는도 2a에 도시되어있다. </li></ol>심 외막의 outgrowths의 제목 &quot;&gt; 4. 단백질 분석 <ol><li> EPDC 문화에서 대기음 미디어와는 DPBS로 두 번 씻는다. </li><li> 10 μl의 빙냉 단백질을 용해 완충액 (50 mM 트리스 (pH 7.5), 150 mM 염화나트륨, 1 mM의 에틸렌 디아민 테트라 아세트산의 pH를 8.0, 1 % 트리톤 X-100, 1X 프로테아제 억제제 칵테일) 각 웰 챔버를 추가의 챔버 슬라이드를 배치 얼음. P200 피펫 팁에 약 하단의 ¼ 잘라 슬라이드 떨어져 세포를 긁어 나머지 조각을 사용합니다. 피펫 위를 Lyse 심 외막 세포와 1.5 ML 튜브로 전송에 이르기까지. </li><li> 30 초 ON과 OFF 사이클 빙수 조에서 5 분 동안 저 (160 W)에 용해 이식편 초음파 처리. </li><li> 10,000 XG, 4 ° C에서 10 분 동안 원심 분리 용 해물. 새로운 튜브로 상청액을 옮기고, 단백질 분석 (36)를 사용하여 단백질 농도를 결정한다. 참고 : 주어진 이식편은 최대 1.5 μg의 총 단백질을 얻을 것입니다. 우리가 발견 한 두 개의 마음에서 풀링 외식물론 당 D로드 2 μg의 단백질은 평활근 α - 굴지 (ACTA2) 및 GAPDH (9)을 감지하기에 충분하다. 다른 표적 단백질의 검출이 최종 사용자에 의해 결정된 바와 같이 여러 시료 이식편 풀링 요구할 수있다. </li></ol> 심 외막의 outgrowths 5. 면역 세포 화학 <ol><li> 이식편 문화에서 용지를 제거하고 DPBS로 두 번 씻는다. </li><li> 부드럽게 각각 C o를 -20 실온에서 5 분 또는 10 분 동안 외식 편을 각 웰에 4 % (v / v)의 파라 포름 알데히드 또는 빙냉 메탄올 500 μL를 추가하고 수정. 제조업체에서 권장하는 항체 사양에 따라 수정합니다. </li><li> 5 분 동안 세 번 정착액을 제거하고 DPBS 잘 각을 씻어. </li><li> 5 분 동안 0.1 % DPBS 500 μL (v / v) 트리톤 X-100 세포를 Permeabilize 하시려면. </li><li> 5 분 동안 세 번 permeabilization 솔루션을 제거하고 DPBS 씻어. </li><li> temperatu 방에서 30 분 동안 DPBS 10 % 혈청으로 세포를 차단레. </li><li> 제조업체의 권장 사항 및 최종 사용자에 의해 결정되는 최적의 조건에 따라 일차 항체 염색을 진행합니다. </li><li> 5 분 동안 세 번 항체 용액을 제거하고 DPBS 씻어. </li><li> 적절한 핵 염료 제조업체의 지침과 Counterstain과 당 차 항체를 적용합니다. </li><li> 5 분 동안 세 번 항체 용액을 제거하고 DPBS 씻어. </li><li> 제조업체의 지침에 따라 챔버 슬라이드 벽을 제거하고 세포에 직접 수성 장착 매체를 추가 할 수 있습니다. 세포를 통해 커버 슬립을 놓고 매니큐어로 밀봉. 반전 공 초점 주사 현미경을 사용하여 2D - 전형적인 결과를도 2b에 나타내었다. </li></ol> 6. 전의 VIVO 문화 분석 (그림 3A) <ol><li> 준비 <ol><li> 준비 12 ml를 사용하여 A 전 배양액 생체 : 둘 베코 변형 이글 중간 (DMEM) (1 1) 혼합물 : M199 10 % 보충FBS와 1 % 펜 / 패 혈성. </li><li> 37 ° C의 수조에서 미리 따뜻한 체외 배양 배지 100 ㎖의 HBSS. </li><li> 나누어지는 1 ml를 24 웰 플레이트의 8-12 우물에 매체를 따뜻하게 사전. </li><li> 전송은 각각 50 ㎖를 함유하는 두 개의 10cm 2 플레이트로 HBSS를 미리 예열. </li></ol></li><li> 12.5 DPC에서 임신 댐에서 (1.2에서 설명) HBSS에 마우스 배아의 마음을 분리합니다. </li><li> 생체 외 배양 배지를 포함하는 24 웰 플레이트의 한 웰에 각각의 마음을 전송합니다. 37 ° C, 부드러운 수동 흔들 또는 부착을 방지하기 위해 락 플랫폼을 사용하여 5 %의 CO 2의 판을 품어. 즉시 7.1 단계로 진행합니다. </li></ol> 7. 전의 VIVO 문화의 심 외막 라벨링 및 EMT 유도 <ol><li> 상기 외막 라벨 광고 / GFP 3.0 × 106 PFU / ㎖로 보충 된 37 ° C 생체 배지 12 mL로 제조한다. floxed 대립 유전자의 대상 절제, (A)의 전송 6 ml를 들어D / GFP는 새로운 15ml의 원뿔형 튜브에 배양액을 첨가. 광고 / Cre 호텔 추가 또는 1.5 × 106 PFU / ml의 최종 농도를 제어하는 아데노 바이러스. 주 : 함수의 이득은 또한 적절한 아데노 바이러스 매개 된 유전자 전달과 함께 수행 될 수있다 분석한다. </li><li> 조심스럽게 P1,000 피펫 팁을 사용하여 24 웰 플레이트의 각 웰에서 배지를 제거한다. </li><li> 부드럽게 잘 각각 아데노 바이러스 (들)이 보충 된 배지를 추가합니다. </li><li> 부드러운 락 24 시간 동안 37 ° C, 5 % CO 2의 판을 품어. </li><li> EMT 유도를 들어, 37 ° C 생체 10 NG / ㎖ TGF-β1 20 NG / ㎖, 혈소판 유래 성장 인자 (PDGF) -BB 또는 비히클을 함유하는 배지 (4 mM의 HCl을 함유 한 ㎎ / ㎖ BSA 12 ml를 준비 ). </li><li> 조심스럽게 P1,000 피펫 팁을 사용하여 24 웰 플레이트의 각 웰에서 배지를 제거합니다. 부드럽게 1 ML의 DPBS과 마음을 씻어. </li><li> DPBS를 제거하고 체외 문화에 마음을 보충 날TGF-β1 및 PDGF-BB 또는 차량을 포함 dium. </li><li> 부드러운 락 37 ° C에서 24 시간, 5 % CO 2 품어. </li></ol> 8. 냉동 보존 및 면역 전의 VIVO 문화의 <ol><li> 냉동 보존을 위해 마음을 준비합니다. <ol><li> 배지를 제거하고 얼음처럼 차가운 DPBS로 두 번 마음을 씻는다. </li><li> 각각의 심장에 4 % (v / v)의 파라 포름 알데히드의 1 ML을 추가하고 부드러운 락 4 ° C에서 2 시간 동안 고정한다. </li><li> 정착액을 제거하고 DPBS로 두 번 마음을 씻는다. 1 ml의 10 % DPBS에서 제조 (w / v)의 크로스 신선한 우물에 마음을 전송합니다. 부드러운 락 4 ℃에서 하룻밤 접시를 품어. </li><li> 조심스럽게 18 % DPBS에서 제조 (w / v)의 크로스 새로운 우물에 마음을 전송합니다. 부드러운 락 4 ℃에서 하룻밤 접시를 품어. </li><li> 조직 동결 매체를 포함하는 cryomold 각 마​​음을 전송합니다. 즉시 -80 &amp; #에서 액체 질소와 저장소를 사용하여 블록을 동결176; C. </li></ol></li><li> 양으로 대전 된 현미경 슬라이드에 그라 이오 스탯과 장소 조직 섹션을 사용하여 5 μm의에서 제 마음입니다. 스토어 염색 할 때까지 -80 ° C에서 슬라이드. </li><li> 서브 심 외막 기저막의 검출 부분에 대한 면역 조직 화학 염색을 수행합니다. <ol><li> 실온에서 적어도 30 분 동안 해동 슬라이드. </li><li> 부드러운 락 5 분 동안 DPBS에 두 번 세척하여 섹션을 재수. </li><li> 실온에서 5 분 동안 PBS에서 0.1 % (v / v) 트리톤 X-100 Permeabilize 하시려면 부. </li><li> 부드러운 락 5 분 동안 DPBS 두 번 슬라이드를 씻으십시오. </li><li> 초과 DPBS을 가릴 및 소수성 라벨 펜으로 염색 영역을 정의합니다. 실온에서 30 분 동안 DPBS 10 % 혈청으로 차단 부. </li><li> 블록에 희석 : 콜라겐 유형 IV 항체 (200 ColIV 1) 블록을 제거하고 적용 할 수 있습니다. 습도 조절 실에 4 ° C에서 밤새 품어. </li><li> 대한 DPBS에 슬라이드를 세 번 씻으부드러운 락 5 분. </li><li> DPBS과 슬라이드에 적용하고 DAPI (5,000 일) : 형광 접합 된 이차 항체 (500 일)을 희석. 실온에서 1 시간 동안 인큐베이션. GFP 구별 방출 및 여기 파장 적절한 이차 항체를 선택합니다. </li><li> 부드러운 락 5 분 동안 PBS에서 슬라이드를 세 번 씻으십시오. 마운트 매체를 장착하여 슬라이드. </li></ol></li></ol> 9. 이미징 및 정량화 전의 VIVO 문화의 <ol><li> 맹검 사용자 이미지를 가지고 스테인드 섹션을 정량화. 심장 외막 (심장의 날) 40 배 배율에서 형광 또는 공 초점 현미경을 사용하여 함께 4-5 임의의 위치에서 주어진 마음에서 이미지는 적어도 5 비 연속적인 조직 섹션. 전형적인 결과가 반전 된 공 초점 주사 현미경을 사용하여도 3b에 도시된다. </li><li> 수동 지정된 이미지 GFP 양성 세포의 총 수를 계산. GFP 포로 EPDC 마이그레이션 확인내 또는 ColIV subepicardial 기저막 이상있는 sitive 세포. GFP는 주어진 이미지에서 GFP 양성 세포의 총 수를 통해 GFP를 양성 세포 마이그레이션의 수가 셀 마이그레이션의 비율을 결정합니다. 전형적인 결과가 반전 공 초점 주사 현미경을 사용하여도 3C-D에 도시된다. </li></ol>

저자는 공개 아무것도 없어.

여기에서 우리는 가지가 기본 심 외막 세포를 분리하고 생체 심장 문화 EPDC 이동을 추적하는 자세한 방법을 설명합니다. 가지 문화를 들면, 심장 외막 고갈 마음을 제거 할 수있는 적절한 시간 실험 사이에 약간 다릅니다. 하룻밤 배양 후 외식의주기적인 모니터링이 심 외막 가지의 정도를 측정하고 섬유 아세포를 표시하기 전에 마음을 추출하는 것이 좋습니다. 순도를 보장하기 위해, 마음이 아닌 심 외막 계통의 축적을 방지하기 위해 explanting의 24 시간 내에 제거해야합니다. 유출 기관도 오염 세포 유형 27,40을 줄일 수있는 챔버 슬라이드에 마음을 전송하기 전에 두 심방을 멀리 트리밍. 태아 하트는 시간의 좁은 기간 동안 마우스 쓰레기 분리와 같은 조건에서 배양되므로 표시하기위한 시간의 outgrowths 한 심장에서 실험 내에서 서로 상대적으로 유사하다. 따라서 모든 마음 ㄴ한다이식편의 대부분은 심 외막의 outgrowths을 나타낼 때, 예를 제거. 어떤 경우에는, 세포 외막이 이식편은 실험에서 제외되어야하는 경우에 다른 사람들보다 더 강하게 수축 된 심장으로부터 효율적으로 이동하지 않는다. 혈액 세포의 축적은 종종 ​​따라서 어려운의 outgrowths 시각화하게 외막 세포 (화살표,도 1C)의 평면 단층을 은폐 할 수있다. 과도한 혈액 세포 기여를 방지하기 위해, 마음 배아에서 해부시 몇 분 동안 HBSS에 남아있을 수 있습니다. 이는 태아의 심장 챔버 슬라이드로 전송되기 전에 심장 챔버에 잔류 혈액을 펌프 할 충분한 시간을 허용한다. 또한, 첫 번째 하룻밤 배양 한 후 이식편 매체 A와 문화를 보충하는 것은 약간의 여분의 혈액을 멀리 세척과의 outgrowths를 공개하는 데 도움이 될 것입니다; 표면 장력이 중심을 일으킬 수 있지만, 매체의 수준은 심장 이상으로 상승하지 않아야기판으로부터 멀리 당겨. 강력한 외막의 outgrowths 배양 기판으로서 콜라겐 타입 I을 사용하여 관찰된다; 그러나, 다른 기판은 유기체 및 / 또는 애플리케이션에 따라 27,40-42보고되었다. 이 프로토콜을 이용하여, 일차 태아 심장 외막 세포 및 제거 매일 배지 보충 다음 4 일 동안 성공할 수있다; 그러나, 장기간 배양이 필요한 실험 디자인은 최종 사용자에 의해 결정되어야한다. 심 외막 EMT 강하게 배아 발달 동안 활성화되기 때문에, 이러한 부산물 배양 기술은 태아 세포 외막의 농축에 한정된다. 다른 그룹은 성인 심 외막 세포 43, 44를 분리하는 방법을 설명했다. 생체 마이그레이션 분석, 심장 추출 및 심 외막 세포 표지에 대한 두 가지 이유 E12.5에 권장됩니다. 첫째, E12.5 후 격리하는 마음이 큰 따라서 생존을 지원하기 위해 더 많은 혈류를 필요로한다. 영양의 단순 확산S는 큰 마음에서 기관 배양 물을 유지하기에는 충분하지 않다. 둘째, 심 외막 EMT 및 EPDC 마이그레이션 E12.5 주위에 발생합니다. 따라서, 심장 외막은 EPDC의 검출을 최대화하는 중심 추출 직후 형광 단백질을 발현하는 아데노 바이러스로 표지한다. 또한, 카르복시 디 아세테이트의 숙신 이미 딜 에스테르 (CFSE)는 이전에 심장의 외부 레이블과 EPDC 마이그레이션 10,45을 추적하는 것으로보고되었습니다. 가지 분석법 달리, 생체 외 배양 심장 외막 세포 부착 및 생장을 방지하기 위해 주기적으로 요동한다. 배양은 연속적으로 낮은 속도 설정에 로커 구비 한 배양기에서 교반 될 수있다. 사용자 장기 문화의 몇 일 이내에 심장 형태의 변화를 알 수 및 심장 격리의 72 시간 이상 분석을 피해야한다. 이 분석을 사용하여, EPDC 침공은 문화의 48 ~ 72 시간 내에 관찰된다. Cre 호텔-에 loxP 시스템 동안관상 혈관, 심근의 간질 및 심실 중격 7,22이 생체 외 기술은 서브 외막 공간의 일부 세포층에서 EPDC 이전에 한정되는 EPDC의 현지화를 매핑 생체 내에서 사용되어왔다. 따라서,이 방법은 EPDC 운동성 및 침략의 규제를 결정하는 것이 아니라 EPDC 마이그레이션의 최종 목적지를 정의하기위한 더 적합하다. 심 외막 세포 절연 부 및 생체 마이그레이션 분석은, 이득 또는 함수 접근법의 손실과 함께, 이미 EPDC 생물학 9,18,46에 영향을 줄 수있는 후보 유전자를 평가하는 데 유용 입증했다. 이 방법은 EPDC 마이그레이션의 새로운 규제를 식별하는 이득의 기능 또는 손실의 기능 화면을위한 플랫폼을 제공합니다. 이 전략은 형광 활성화 세포 분류 또는 단일 세포 RN​​A 시퀀싱과 함께, 또한 심 외막 얼룩이 조사 할 기회를 제공 할 수있다더 자세히과 EPDC 차별화. 마지막으로,이 절차의 변형이 심장 재생 의학의 목적을 위해 심 외막 세포 및 EPDC 생물 영향 소분자에 대한 화면을 개발하는데 사용될 수있다.

심장 외막은 중피 세포의 단일 층입니다 라인 심장과 영향 심장 개발, 성숙 및 수리. 분비 신호 높은 코디 교환을 통해, 심근과 외막 사이에 친밀한 대화 심장 성장 및 비 - 심장 근세포 계통 (1)의 형성에 필수적이다. 심 외막 유래 세포 (EPDC)의 상피 - 투 - 중간 엽 전이 (EMT) (2)를 통해 심 외막 세포의 일부에서 등장는 subepicardial 공간 및 기본 심근 침입, 크게 관상 동맥 혈관 벽화 세포와 심장 섬유 아 세포로 분화하고,에 조금 적게, 내피 세포 및 심근 3-9. 심 외막 EMT 및 EPDC 침입 조절 메커니즘 분비 리간드 10-13, 세포 표면 수용체 및 부착 분자 (14, 15), 가열 공기 조절기 등 다양한 분자의 조정 동작에 기인 한혀끝 - 기초 극성 16, 17, 작은 GTP 아제 18, 19, 및 전사의 lators은 2,20,21 요인. EPDC 이주의 분자 이펙터 많은 정의되었지만, 전략의 개발을 촉진 할 수있다 배아 EPDC 가동화를 자극하는 생리적 신호의 더 나은 이해를 개선 심장 수리 어른이 공정을 조작한다. EPDC 동원의 새로운 규제를 식별하기위한 연구는이 세포 인구의 정제 또는 개별 심 외막 세포의 이동을 추적에 의존하고 있습니다. 하나 WT1, Tcf21, Tbx18 및 / 또는 Aldh1a2 포함 마커 유전자의 조합은 일반적으로 태아의 심장 외막 하나를 식별하는 데 사용된다. 그러나, 이들 마커의 사용은 심 외막 세포 transdif을 겪을 때 심 외막 마커의 발현은 심장 개발의 과정 기울면 종종 손실로 EPDC 최적 아니다 마이그레이션 추적중간 엽 세포로 ferentiation. 정속 신장식 /에 loxP 시스템의 응용 프로그램은, 혈통-추적 기자와 함께 영구적으로 심장 개발하는 동안 심장 외막와 그 하위 라벨 및 성인 7,22,23에서 허혈 손상을 다음에 유용합니다. 여러 심 외막 제한 Cre 호텔 라인이 생성되어 널리 EPDC 라벨 및 조건부 유전자 삭제 전략 1하는 데 사용됩니다. 이러한 연구는 다양한 심 외막 계통의 특성 및 EPDC 운동성 및 분화의 중요한 매개체의 식별을 주도했다. 그러나, 축적 증거가 심장 외막이 전구 세포 4,24,25의 이기종 인구 제안합니다. 따라서, 심 외막 세포의 서브 세트 만이 주어진 Cre 호텔 드라이버를 사용하여 타겟팅된다. 에 관계없이 Cre 호텔 특이성의 전체 심장 외막에 레이블을하기 위해, 실험실의 수는 가지 막힌를 활용 한진짜야 시스템 또는 생체 기관 배양 방법은 충실하게 격리 또는 26 ~ 28 마커 유전자 혈통의 표현에 의존하지 않고 심 외막 세포를 레이블을. 생체 마이그레이션 연구의 경우, 배아 마음 심 외막 EMT 이전 및 녹색 형광 단백질 (GFP) 발현 아데노 바이러스 (광고 / GFP) 9,18 보충 된 배지에서 배양 격리됩니다. 이 접근법은 효​​율적인 전체 심장 외막의 표시보다는 Cre 호텔 매개 재조합에 의해 세포의 부분 집합을 허용한다. 심장의 문화는 이후 EPDC (28, 29)의 동원을 자극하는 EMT의 알려진 유도 물질에 노출되어있다. 예 생체 내 및 생체 내 분석 EPDC 마이그레이션을 운전 자세한 메커니즘을 탐구에 특히 유용한 방법이다 체외 심 외막 이식편 문화에 의해 보완된다. 여기, 우리는 epicardi의 체외 연구에 대한 기본 심 외막 세포를 분리하는 방법을 설명합니다알 EMT뿐만 아니라 생체에 대한 기관 배양 물 시스템은 EPDC 운동성 분석. 우리는 최근 유전자 EPDC 9 굴지 기반 마이그레이션을 조작하는 축 시그널링 myocardin 관련 전사 인자 (MRTF) / 혈청 반응 계수 (SRF)를 변조하여이 방법의 유용성과 견고성을 증명하고있다. 우리의 연구 결과는 EPDC 이동을 규제하기 위해 필요한 하나의 신호 전달 경로를 강조하지만,이 방법은 집합 EPDC 마이그레이션 및 차별화를 조율 메커니즘을 해명하기에 적합하다. 또한, 체외 이식편 및 생체 외 배양 시스템은 심장 재생 치료에 응용 프로그램 EPDC 동원 신규 ​​레귤레이터를 식별하는 기능 화면에서 구현 될 수있다.

<table><tbody><tr><td>Dulbecco&#039;s Modified Eagle Medium</td><td>Hyclone&amp;nbsp;</td><td>SH3002201</td><td>DMEM</td></tr><tr><td>Hanks&#039; Balanced Salt Solution</td><td>Hyclone</td><td>SH3003102</td><td>HBSS</td></tr><tr><td>Medium 199</td><td>Hyclone</td><td>SH3025301</td><td>M199</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate-Buffered Saline&amp;nbsp;</td><td>Hyclone</td><td>SH3002802</td><td>DPBS</td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Gemini&amp;nbsp;</td><td>100-106</td><td>FBS</td></tr><tr><td>Penicillin/Streptomycin Solution</td><td>Hyclone</td><td>SV30010</td><td></td></tr><tr><td>Corning Biocoat Collagen I, 4-Well Culture Slides</td><td>Corning</td><td>354557</td><td></td></tr><tr><td>Multiwell 24-well plates</td><td>Falcon</td><td>08-772-1</td><td></td></tr><tr><td>Dissecting microscope</td><td>Leica</td><td>M50</td><td>Equipped with Leica KL300 LED might source</td></tr><tr><td>Confocal miscroscope</td><td>Olympus</td><td>1X81</td><td>Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp</td></tr><tr><td>Bioruptor</td><td>Diagenode&amp;nbsp;</td><td>UCD-200</td><td></td></tr><tr><td>Transforming growth factor beta 1</td><td>R&amp;amp;D Systems</td><td>100-B-001</td><td>TGF-&amp;beta;1</td></tr><tr><td>Platelet-derived growth factor BB</td><td>R&amp;amp;D Systems</td><td>220-BB-010</td><td>PDGF-BB</td></tr><tr><td>Trizol Reagent</td><td>Applied Biosystems</td><td>15596-026</td><td>Caution, hazardous material</td></tr><tr><td>TURBO DNA-free Kit</td><td>Life Technologies</td><td>AM1907</td><td>DNaseI</td></tr><tr><td>iScript cDNA Synthesis Kit</td><td>BioRad</td><td>1708891</td><td></td></tr><tr><td>UltraPure Glycogen</td><td>Life Technologies</td><td>10814-010</td><td></td></tr><tr><td>SYBR Green</td><td>BioRad</td><td>170-8880</td><td></td></tr><tr><td>Protease inhibtor cocktail tablets</td><td>Roche</td><td>11836170001</td><td></td></tr><tr><td>Alexa Goat-anti-rabbit 488</td><td>Life Technologies</td><td>A11008</td><td>Secondary antibody</td></tr><tr><td>Alexa Goat anti-rabbit 594</td><td>Life Technologies</td><td>A-11012</td><td>Secondary antibody</td></tr><tr><td>Alexa Goat anti-mouse 594</td><td>Life Technologies</td><td>A-11005</td><td>Secondary antibody</td></tr><tr><td>Mouse anti-smooth muscle alpha actin, Cy3-conjugated&amp;nbsp;</td><td>Sigma-Aldrich</td><td>C6198</td><td>monoclonal antibody, clone 1A4</td></tr><tr><td>Mouse anti-Wilms tumor 1 (WT1)</td><td>Life Technologies</td><td>MA1-46028</td><td>monoclonal antibody, clone 6F-H2</td></tr><tr><td>Rabbit anti-ZO1</td><td>Life Technologies</td><td>40-2200</td><td>polyclonal antibody</td></tr><tr><td>Rabbit anti-Collagen Type 4</td><td>Millipore</td><td>AB756P</td><td>polyclonal antibody</td></tr><tr><td>4&#039;,6-Diamidino-2-Phenylindole, Dihydrochloride&amp;nbsp;</td><td>Life Technologies</td><td>D1306</td><td>DAPI</td></tr><tr><td>Fluorescent mounting medium&amp;nbsp;</td><td>DAKO</td><td>S3023</td><td></td></tr><tr><td>16% Paraformaldehyde solution</td><td>Electron Microscopy Sciences</td><td>15710</td><td>PFA diluted to 4% in DPBS. Caution, hazardous material</td></tr><tr><td>Sucrose</td><td>Sigma-Aldrich</td><td>S0389</td><td></td></tr><tr><td>Tissue Freezing Medium</td><td>Triangle Biomedical Sciences</td><td>TFM-B</td><td></td></tr><tr><td>Pap pen</td><td>DAKO</td><td>S2002</td><td></td></tr><tr><td>Disposable mictrotome blades&amp;nbsp;</td><td>Sakura Finetek</td><td>4689</td><td></td></tr><tr><td>Microscope slides</td><td>Globe Scientific</td><td>1358W</td><td>positively charged, 25 mm x 75 mm x 1 mm</td></tr><tr><td>Cryostat&amp;nbsp;</td><td>Leica</td><td>CM1950</td><td></td></tr><tr><td>Forceps</td><td>Fine Science Tools</td><td>11295-00</td><td></td></tr><tr><td>Surgical Scissors</td><td>Fine Science Tools</td><td>91460-11</td><td></td></tr><tr><td>Disposable base molds</td><td>Fisher Scientific</td><td>22-363-553</td><td></td></tr><tr><td>Ketamine</td><td>Hospira</td><td>NDC 0409-2051-05</td><td></td></tr><tr><td>Xylazine</td><td>Akorn</td><td>NADA 139-236</td><td></td></tr></tbody></table>

epicardial outgrowth culture assay and ex vivo assessment of epicardial-derived cell migration

심 외막 세포 선 단층 심장, 심근 세포의 증식을 자극 분비 인자를 제공하고 직접 개발 및 심혈관 질환 중에 조상 기여. 다수의 인자가 심장 외막 유래 세포 (EPDC) 동원에 연루되어 있지만, 그 이후의 이동과 분화를 지배하는 메커니즘이 제대로 이해된다. 여기, 우리는 EPDC 운동성 및 분화를 연구하는 생체 외 및 생체 전략을 제시한다. 먼저, 마우스 배아 심장에서 생장 배양 주 외막 세포를 얻는 방법을 설명한다. 또한 장기 배양 시스템에서 표지 EPDC 입체 마이그레이션을 평가하기 상세한 프로토콜을 소개한다. 우리는 심장 외막에 myocardin 관련 전사 인자의 유전 삭제 EPDC 마이그레이션을 감쇠 이러한 기술을 사용하여 증거를 제공합니다. 이 방법은 EPDC의 후보 수식을 평가하기위한 플랫폼 역할생물학은 심장 수리를 위해 유용 할 수 있습니다 EPDC 동원의 새로운 규제를 식별하는 유전 물질 또는 화학 물질 화면을 개발하는 데 사용할 수 있습니다.

심장 외막이 효율적으로 외부 위치를 활용하고 개발 소성 및 EPDC의 고유 철새 동작을 이용하여 부산물 문화 분석을 이용하여 분리 할 수​​ 있습니다. 쥐의 배아 마음 전에 아래 콜라겐 코팅 챔버 슬라이드에 심 외막 EMT 배양 등의 측에 E11.5에서 분리되어 26 (그림 1A, B). 외식 마음은 계약을 계속; 그러나, 심장 외막은 콜라겐 매트릭스 준수와 문화의 24 시간 (그림 1C)에서 심근으로부터 마이그레이션합니다. 심 외막 세포 중피 정체성 (도 1C-E)를 나타내는 조약돌 같은 형태로 떨어져 마음에서 나오는 관찰 할 수있다. 문화의 24 시간 후 심장 외막 고갈 마음은 유전자 또는 단백질 발현 분석을 위해 제거됩니다. epitheli 관찰 이외에알의 형태는 심 외막 세포 배양의 순도는 더 심 외막 제한된 유전자와 단백질 마커의 발현에 의해 검증 될 수있다. 심 외막 세포 외식은 심 외막 및 중피 마커 (Aldh1a2, Tcf21 및 WT1)와 심장 외막 고갈 된 마음 (그림 2A)에 비해 심근 유전자 (Nkx2-5 및 Myh7)의 낮은 표현의 강력한 표현을 표시합니다. 또한 신원을 확인하기 위해, 심 외막 세포 배양 후 48 시간에서 해결 된 마음 제거 각각 중피 세포와 세포 사이 꽉 접합, 37, 38 라벨을 Wilm의 종양 1 (WT1)와 조나 occludens 단백질 1 (ZO1)에 대한 항체 (와 공동 스테인드 그림 2B). 이 생장 배양 방법은 중피 세포의 비교적 높은 순도를 산출한다; 그러나, 사용자가 셀 오염의 작은 비율을 관찰 할 수있다. 섬유 아세포 및 평활근 세포의 현저한 nucle 부재와 함께 연장 중배엽 표현형을 나타낸다WT1 및 조직 꽉 접합 (그림 2C) 아칸소. 기술 해결은 비 외막 세포 오염의 양이 논의에서 전개되고 제한한다. 이식편 파생물 분석은 시험 관내에서 외막 생물학 질의 유용한 배양 시스템이다. 심 외막 세포의 가소성을 설명하기 위해, 외식은 중간 엽 세포 (26, 28)로 분화를 유도하기 위해 [10 NG / ㎖] TGF-β1 자극했다. 자극의 24 시간 후, EPDC 특히 문화 39 (빨간색 그림 2D)의 주변에, 감소 ZO1 염색 및 평활근 α - 굴지 긍정적 인 스트레스 섬유 (ACTA2 또는 SMA)의 강력한 드 노보 형성에 중간 엽 표현형을 채택한다. 반대로, 이식편의 주위에 monolaye의 중심에 더 정의 세포 간 접촉 (ZO1 녹색)와 합류 외막 세포를 섬유 집합체 스트레스대뇌 피질 굴지의 R 표시 ACTA2 단백질 발현. EMT를 겪고 외에도 EPDC 비 심근 인구의 상당 부분을 구성하는, 심근 침입과 구별된다. EPDC의 운동성은 E12.5 마음의 외부는 GFP 9,18 (그림 3A)를 발현하는 아데노 바이러스로 표시되어있다 이전에 설립 된 생체 기관 배양 시스템을 사용하여 평가 될 수있다. 레이블이 마음 EPDC 이동을 촉진하는 TGF-β1 [10 NG / ㎖] 및 PDGF-BB [20 NG / ㎖]의 존재에 3 일 동안 배양한다. 기관 배양 물을 주기적으로 배양 플레이트의 표면에 생체 하트 부착을 방지하는 회전한다. 스크래치 시험 관내 분석법으로 이동 방향과 반대로 이러한 시스템은 입체 모델의 전체 심장 외막과 EPDC 운동성 평가를 효율적으로 표시 가능하다. EPDC의 마이그레이션은 obser입니다VED 긍정적 인 심 외막 세포로 또는 ColIV (빨간색) subepicardial 기저막 (16) (도 3B, C)를 넘어 GFP의 침공으로. 이 시스템의 유틸리티를 설명하기 위해, 우리는 최근에 EPDC 9의 운동성에 영향을 미칠 수있는 MRTF / SRF 신호 축의 조작을 보여 주었다. floxed 대립 유전자의 Cre 호텔 - 중재 절단 (MRTFdKO)에 의해 Mrtfa 및 Mrtfb의 삭제는 subepicardial 공간으로 EPDC의 이동을 감쇠. 반대로 증가 EPDC 마이그레이션 및 ColIV 기저막 (도 3C, D)의 중단에 C57BL / 6 마음 결과에 MRTF-A (광고 / MRTF-A)의 발현을 강요했다. <table fo:keep-together.within-page="1"><tbody><tr><td> 유전자 </td><td> 앞으로 </td><td> 역 </td><td> NCBI의 기탁 </td></tr><tr><td> Aldh1a2 </td><td> GGCACTGTGTGGATCAACTG </td><td> TCACTTCTGTGTACGCCTGC </td&gt; <td> NM_009656 </td></tr><tr><td> GAPDH </td><td> CGTGCCGCCTGGAGAAAC </td><td> TGGGAGTTGCTGTTGAAGTCG </td><td> NM_001289726 </td></tr><tr><td> Myh7 </td><td> GTGGCTCCGAGAAAGGAAG </td><td> GAGCCTTGGATTCTCAAACG </td><td> NM_080728 </td></tr><tr><td> Nkx2-5 </td><td> GACGTAGCCTGGTGTCTCG </td><td> GTGTGGAATCCGTCGAAAGT </td><td> NM_008700 </td></tr><tr><td> Tcf21 </td><td> CATTCACCCAGTCAACCTGA </td><td> CCACTTCCTTCAGGTCATTCTC </td><td> NM_011545 </td></tr><tr><td> WT1 </td><td> ATCCGCAACCAAGGATACAG </td><td> GGTCCTCGTGTTTGAAGGAA </td><td> NM_144783 </td></tr></tbody></table> . 표 1 : 심장 외막의 분석 및 심근 제한된 유전자 발현 유전자 발현이 QRT-PCR 위스콘신에 의해 결정됩니다에 의해 심 외막 파생물 문화 순도의 검증에 사용 앞으로의 시퀀스 및 역방향 프라이머다음 매개 변수 번째 10 초 동안 95 ° C에서 변성; 30 초 동안 60 ° C에서 어닐링; 50 배 사이클을 반복합니다. <img alt="그림 1" src="/files/ftp_upload/53750/53750fig1.jpg" /> 그림 1. 파생물 배양 분석 (A) 외막 변조 및 분석을 위해 권장 막대와 심 외막 가지 이식편 분석의 개략도를 사용하여 주 외막 세포의 분리. (B - E) 이식편 분석하는 동안 다양한 시점의 대표 시야 이미지. (B) 배아 일 E11.5의 쥐 마음은 콜라겐 기판 아래로 몸 윗면을 배치됩니다. (C) 심 외막 세포 (흰색 화살촉) 문화의 3 ~ 4 시간 내 마음을 마이그레이션하기 시작합니다. 혈액 세포 (검은 색 화살표) 근처의 축적 또는 심 외막 가지 중 외식을 커버 할 수있다. (D, E) 후문화의 약 24 시간이, 마음이 제거되고 심 외막 단일 층 챔버 슬라이드에 부착 된 상태로 유지됩니다. 세포의 outgrowths는 세포의 조약돌 같은 배열과 상피 형태를 표시합니다. 스케일 바 = 250 μm의 (BD) 또는 50 μm의 (C, E). H = 마음, LA = 좌심방, LV는 = 좌심실, OFT = 유출 관, RA = 우심방, RV = 우심실. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53750/53750fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/53750/53750fig2.jpg" /> 그림 2 : 심 외막 세포 생장 순도의 평가 (A) 심장 외막 고갈 E11에서 심근 유전자 발현 (Nkx2-5 및 Myh7)에 비해 가지 문화 심 외막 제한 마커 (Tcf21, Aldh1a2 및 WT1)의 QRT-PCR 검증.. 5 마음입니다. 데이터 represenSEM ± (N = 8 그룹 당) 평균에서 t. 별표 **** P &lt;0.0001와 학생 T-test를 이용하여 통계적 유의성을 나타낸다. (B) 비자극의 outgrowths 심 외막 표현 (빨간색 WT1), 간 긴밀한 접합 (ZO1, 녹색)과 핵의 대표 공동 면역 염색 (DAPI, 청색). (C)을 가지 배양 세포 오염의 예. 심 외막 세포 (별표) 특성 중피 정체성 (핵 WT1, 빨간색) 및 조직 상피 꽉 접합 (ZO1, 녹색)와 패널의 오른쪽에 관찰된다. 중앙 (흰색 화살촉)에 인접한 세포는 최소한의 핵 WT1 단백질과 조직적 ZO1 염색과 미분 간섭 대비 (DIC) 이미지로 나타낸 신장 중간 엽 형태를, 나타낸다. (D) 외막 세포 배양 (1 ㎎ / ㎖ BSA 4 mM의 염산)으로 자극 하였다 차량 또는 TGF-β1 [10 NG / ㎖] 외막을 유도EMT. TGF-β1의 자극 이식편 또는 단일 층의 에지 또는 주변부 마이그레이션 세포 스트레스 섬유의 중심에 융합 세포의 피질 영역에 ACTA2 (적색)의 강력한 발현을 촉진한다. 세포 유착은 ZO1 (녹색)으로 표시되어 있습니다. 스케일 바 = 25 μm의 (BD). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53750/53750fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/53750/53750fig3.jpg" /> 도 3 : EPDC 운동성 생체 외 평가 (A)가 생체의 심장 배양 검정의 개략 타임 라인.. (B) 24 시간 동안 광고 / GFP (녹색)으로 형질 도입 C57BL / 6 E12.5 마음의 대표적인 5 μm의 섹션은 심장의 외부에 레이블을합니다. 예 생체 내 마음이 TGF-에 추가로 48 시간 동안 연속적으로 배양 β1 [10 NG / ㎖]및 PDGF-BB는 [20 NG / ㎖]는 EPDC 마이그레이션을 자극한다. 섹션은 subepicardial 기저막과 핵 (파란색 DAPI). 예 생체 내 마음의 문화 형태가 DIC에 의해 표시되는 레이블을 ColIV (빨간색)에 대한 공동 염색 하였다. LV = 좌심실, RV = 우심실, RA = 우심방. (C, D)를 MRTF / SRF 규제 축 변조하여 생체 마이그레이션 분석의 예시적인 애플리케이션. 이 수치는에서 [9] 수정되었습니다. - / - E12.5 마음이 Mrtfa에서 분리 하였다. Mrtfb FL / FL 배아 및 광고 / GFP 및 제어 바이러스 또는 24 시간 동안 Cre 호텔의 재조합 효소를 발현하는 아데노 바이러스로 형질 전 생체 내 문화 후 TGF-β1 자극했다 [10 NG / ㎖] 및 PDGF-BB 추가로 48 시간 동안 [20 NG / ㎖]. EPDC 운동성 (흰색 화살표)로 또는 ColIV (빨간색)을 넘어 GFP 양성 세포 (녹색)의 이동로 관찰된다. 에 Mrtfb의 삭제를 CRE 매개 &lt;EM&gt; Mrtfa - / - 마음을 제어하는 데 비해 EPDC 마이그레이션의 감쇠의 배경 (MRTFdKO) 결과. 반대로, E12.5 C57BL / 6 마​​음에 MRTF-A (광고 / MRTF-A)의 발현을 강제 EPDC 마이그레이션을 향상시킵니다. (D) % GFP 양성 세포 이동의 정량화. 데이터는 SEM (각 조건에 대한 N = 4 하트) ± 평균으로 표시하고 있습니다. 데이터가 별표 **** P &lt;0.0001와 Tukey에 사후 검사로 유의성을 나타내는 함께 일방향 ANOVA를 이용하여 분석 하였다. 스케일 바 = 200 μm의 (B) 또는 25 μm의 (C). 모든 이미지는 반전 된 공 초점 레이저 주사 현미경을 사용하여 획득 하였다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53750/53750fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration at JoVE.com

Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration

심 외막 파생물 문화 분석 및<em&gt; 전의 VIVO</em&gt; 심 외막 유래 세포 마이그레이션 평가

Here, we describe methods for isolating primary mouse epicardial cells by an outgrowth culture assay and assessing the functional migration of epicardial-derived cells (EPDC) using an ex vivo heart culture system. These protocols are suitable for identifying genetic and chemical modulators of epicardial epithelial-to-mesenchymal transition (EMT) and motility.

A single layer of epicardial cells lines the heart, providing paracrine factors that stimulate cardiomyocyte proliferation and directly contributing ...

epicardial-outgrowth-culture-assay-ex-vivo-assessment-epicardial

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration

8.2K 조회수.  University of Rochester School of Medicine and Dentistry. Here, we describe methods for isolating primary mouse epicardial cells by an outgrowth culture assay and assessing the functional migration of epicardial-derived cells (EPDC) using an ex vivo heart culture system. These protocols are suitable for identifying genetic and chemical modulators of epicardial epithelial-to-mesenchymal transition (EMT) and motility. 

비디오: Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration

Assessment of Endothelial Cell Migration After Exposure to Toxic Chemicals

Exposure to chemical substances (including alkylating chemical warfare agents like sulfur and nitrogen mustards) cause a plethora of clinical symptoms including wound healing disorder. The physiological process of wound healing is highly complex. The formation of granulation tissue is a key step in this process resulting in a preliminary wound closure and providing a network of new capillary blood vessels &#8211; either through vasculogenesis (novel formation) or angiogenesis (sprouting of existing vessels). Both vasculo- and angiogenesis require functional, directed migration of endothelial cells. Thus, investigation of early endothelial cell (EEC) migration is important to understand the pathophysiology of chemical induced wound healing disorders and to potentially identify novel strategies for therapeutic intervention.
We assessed impaired wound healing after alkylating agent exposure and tested potential candidate compounds for treatment. We used a set of techniques outlined in this protocol. A modified Boyden chamber to quantitatively investigate chemokinesis of EEC is described. Moreover, the use of the wound healing assay in combination with track analysis to qualitatively assess migration is illustrated. Finally, we demonstrate the use of the fluorescent dye TMRM for the investigation of mitochondrial membrane potential to identify underlying mechanisms of disturbed cell migration. The following protocol describes basic techniques that have been adapted for the investigation of EEC.

Investigation of early endothelial cell (EEC) migration is important to understand the pathophysiology of certain illnesses and to potentially identify novel strategies for therapeutic intervention. The following protocol describes techniques to assess cell migration that have been adapted for the investigation of EEC.

유해 화학 물질에 노출 된 후 내피 세포 이동의 평가

Exposure to chemical substances (including alkylating chemical warfare agents like sulfur and nitrogen mustards) cause a plethora of clinical symptoms ...

연구

발생학

In Vitro Culture of Epicardial Cells From Mouse Embryonic Heart

During embryogenesis, the epicardial contribution to coronary vasculature development has been very well established. Cells derived from the epicardium differentiate into smooth muscle cells, fibroblasts and endothelial cells that contribute to the formation of coronary vessels. Here we have established an in vitro culture method for embryonic epicardial cells. Using genetic labelling, we have demonstrated that the majority of the migrating cells in our explant culture are of epicardial origin. Epicardial explant cells also retain the expression of epicardial markers (Wt1 and Tbx18). Furthermore, we provide evidence that epicardial explant cells undergo epithelial to mesenchymal transition (EMT), migrate and differentiate into smooth muscle cells after Transforming growth factor beta 1 (TGF-&#946;1) treatment in a manner indistinguishable from that of epicardial cells in vivo. In conclusion, we provide a novel method for the culture of embryonic epicardial cells, which will help to explore the role of specific genes in epicardial cell biology.

In Vitro Culture of Epicardial Cells From Mouse Embryonic Heart

The epicardium is an essential source of multipotent cardiovascular progenitor cells and paracrine factors that are required for cardiovascular development and regeneration. We describe here a method to culture mouse embryonic epicardial cells.

마우스 배아 심장에서 심 외막 세포의 체외 배양에서

During embryogenesis, the epicardial contribution to coronary vasculature development has been very well established. Cells derived from the epicardium ...

공학

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature maintenance and pathological malformations can result in severe ischemic diseases, while overly abundant vascular development is associated with cancer and inflammatory disorders. A promising form of pro-angiogenic therapy is the use of angiogenic cell sources, which can provide regulatory factors as well as physical support for newly developing vasculature.
Mesenchymal Stromal Cells (MSCs) are extensively investigated candidates for vascular regeneration due to their paracrine effects and their ability to detect and home to ischemic or inflamed tissues. In particular, first trimester human umbilical cord perivascular cells (FTM HUCPVCs) are a highly promising candidate due to their pericyte-like properties, high proliferative and multilineage potential, immune-privileged properties, and robust paracrine profile. To effectively evaluate potentially angiogenic regenerative cells, it is a requisite to test them in reliable and &#34;translatable&#34; pre-clinical assays. The aortic ring assay is an ex vivo angiogenesis model that allows for easy quantification of tubular endothelial structures, provides accessory supportive cells and extracellular matrix (ECM) from the host, excludes inflammatory components, and is fast and inexpensive to set up. This is advantageous when compared to in vivo models (e.g., corneal assay, Matrigel plug assay); the aortic ring assay can track the administered cells and observe intercellular interactions while avoiding xeno-immune rejection.
We present a protocol for a novel application of the aortic ring assay, which includes human MSCs in co-cultures with developing rat aortic endothelial networks. This assay allows for the analysis of the MSC contribution to tube formation and development through physical pericyte-like interactions and of their potency for actively migrating to sites of angiogenesis, and for evaluating their ability to perform and mediate ECM processing. This protocol provides further information on changes in MSC phenotype and gene expression following co-culture.

The Aortic Ring Co-culture Assay: A Convenient Tool to Assess the Angiogenic Potential of Mesenchymal Stromal Cells In Vitro

Here, we present a novel application of the aortic ring assay where prelabelled mesenchymal cells are co-cultured with rat aorta-derived endothelial networks. This novel method allows visualization of Mesenchymal Stromal Cells (MSCs) homing and integration with endothelial networks, quantification of network properties, and evaluation of MSC immunophenotypes and gene expression.

대동맥 반지 공동 문화 분석 결과: Mesenchymal Stromal 세포에 생체 외에서 의 신생 잠재력을 평가 하는 편리한 도구

Angiogenesis is a complex, highly regulated process responsible for providing and maintaining adequate tissue perfusion. Insufficient vasculature ...

The Isolation and Culture of Primary Epicardial Cells Derived from Human Adult and Fetal Heart Specimens

The epicardium, an epithelial cell layer covering the myocardium, has an essential role during cardiac development, as well as in the repair response of the heart after ischemic injury. When activated, epicardial cells undergo a process known as epithelial to mesenchymal transition (EMT) to provide cells to the regenerating myocardium. Furthermore, the epicardium contributes via secretion of essential paracrine factors. To fully appreciate the regenerative potential of the epicardium, a human cell model is required. Here we outline a novel cell culture model to derive primary epicardial derived cells (EPDCs) from human adult and fetal cardiac tissue. To isolate EPDCs, the epicardium is dissected from the outside of the heart specimen and processed into a single cell suspension. Next, EPDCs are plated and cultured in EPDC medium containing the ALK 5-kinase inhibitor SB431542 to maintain their epithelial phenotype. EMT is induced by stimulation with TGF&#946;. This method enables, for the first time, the study of the process of human epicardial EMT in a controlled setting, and facilitates gaining more insight in the secretome of EPDCs that may aid heart regeneration. Furthermore, this uniform approach allows for direct comparison of human adult and fetal epicardial behavior.

The epicardium plays a crucial role in the development and repair of the heart by providing cells and growth factors to the myocardial wall. Here, we describe a method to culture human primary epicardial cells that enables the study and comparison of their developmental and adult characteristics.

분리와 인간 성인 그리고 태아 심장 표본에서 파생 하는 기본 Epicardial 세포의 문화

The epicardium, an epithelial cell layer covering the myocardium, has an essential role during cardiac development, as well as in the repair response of ...

En Face Endocardial Cushion Preparation for Planar Morphogenesis Analysis in Mouse Embryos

The study of the cellular and molecular mechanisms underlying the development of the mammalian heart is essential to address human congenital heart disease. The development of the primitive cardiac valves involves the epithelial-to-mesenchymal transition (EMT) of endocardial cells from the atrioventricular canal (AVC) and outflow tract (OFT) regions of the heart in response to local inductive myocardial and endocardial signals. Once the cells delaminate and invade the extracellular matrix (cardiac jelly) located between the endocardium and the myocardium, the primitive endocardial cushions (EC) are formed. This process implies that the endocardium has to fill the gaps left by the delaminated cells and has to reorganize itself to converge (narrow) or extend (lengthen) along an axis. Current research has implicated the planar cell polarity (PCP) pathway in regulating the subcellular localization of the factors involved in this process. Classically, the initial phases of cardiac valve development have been studied in cross-sections of embryonic hearts or in ex vivo AVC or OFT explants cultured on collagen gels. These approaches allow the analysis of apico-basal polarity but do not allow the analysis of cell behavior within the plane of the epithelium or of the morphological changes of migrating cells. Here, we show an experimental approach that allows the visualization of the endocardium at valvulogenic regions as a planar field of cells. This experimental approach provides the opportunity to study PCP, planar topology, and intercellular communication within the endocardium of the OFT and AVC during valve development. Deciphering new cellular mechanisms involved in cardiac valve morphogenesis may contribute to understanding congenital heart disease associated with endocardial cushion defects.

En Face Endocardial Cushion Preparation for Planar Morphogenesis Analysis in Mouse Embryos

Classically, the endocardium of the mouse embryonic valve primordium has been analyzed using transversal, coronal, or sagittal sections. Our novel approach for en face, two-dimensional imaging of the endocardium at valvulogenic regions allows planar polarity and cell rearrangement analysis of the endocardium during valve development.

엔 페이스 마우스 배아에서 평면 형태형성 분석을 위한 심내막 쿠션 준비

The study of the cellular and molecular mechanisms underlying the development of the mammalian heart is essential to address human congenital heart ...

Modified Mouse Embryonic Stem Cell based Assay for Quantifying  Cardiogenic Induction Efficiency

Differentiation of pluripotent stem cells is tightly controlled by temporal and spatial regulation of multiple key signaling pathways. One of the hurdles to its understanding has been the varied methods in correlating changes of key signaling events to differentiation efficiency. We describe here the use of a mouse embryonic stem (ES) cell based assay to identify critical time windows for Wnt/&beta;-catenin and BMP signal activation during cardiogenic induction. By scoring for contracting embryonic bodies (EBs) in a 96-well plate format, we can quickly quantify cardiogenic efficiency and identify crucial time windows for Wnt/&beta;-catenin and BMP signal activation in a time course following specific modulator treatments. The principal outlined here is not limited to cardiac induction alone, and can be applied towards the study of many other cell lineages. In addition, the 96-well format has the potential to be further developed as a high throughput, automated assay to allow for the testing of more sophisticated experimental hypotheses.

We describe the use of a mouse ES cell based assay to identify critical time windows for Wnt/&#946;-catenin and BMP signal activation during cardiogenic induction. The method provides a standardized platform that reliably quantifies cardiogenic efficiency, and it is applicable to the study of other cell lineages.

Cardiogenic 유도 효율을 Quantifying에 대한 수정 마우스 배아의 줄기 세포 기반 어세이

Differentiation of pluripotent stem cells is tightly controlled by temporal and spatial regulation of multiple key signaling pathways.  One of the hurdles ...

생물학

Electroporation-based transgenesis of Cardiac cells in mouse hearts(생쥐 심장의 심장 세포의 전기천공법 기반 형질전환)

An Efficient Transgenesis Approach for Gene Delivery in the Mouse Embryonic Heart

The mammalian heart is a complex organ formed during development via highly diverse populations of progenitor cells. The origin, timing of recruitment, and fate of these progenitors are vital for the proper development of this organ. The molecular mechanisms that govern the morphogenesis of the heart are essential for understanding the pathogenesis of congenital heart diseases and embryonic cardiac regeneration. Classical approaches to investigate these mechanisms employed the generation of transgenic mice to assess the function of specific genes during cardiac development. However, mouse transgenesis is a complex, time-consuming process that often cannot be performed to assess the role of specific genes during heart development. To address this, we have developed a protocol for efficient electroporation and culture of mouse embryonic hearts, enabling transient transgenesis to rapidly assess the effect of gain- or loss-of-function of genes involved in cardiac development. Using this methodology, we successfully overexpressed Meis1 in the embryonic heart, with a preference for epicardial cell transfection, demonstrating the capabilities of the technique.

저자 스포트라이트: 신속한 유전자 스크리닝을 위한 심장 세포 형질전환(Cardiac Cell Transgenesis)

This protocol presents a detailed methodological framework for electroporation-based transgenesis of cardiac cells in developing mouse hearts. The video assets provided here will facilitate learning of this versatile technique.

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

The mammalian heart is a complex organ formed during development via highly diverse populations of progenitor cells. The origin, timing of recruitment, ...

An Explant Assay for Assessing Cellular Behavior of the Cranial Mesenchyme

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the neural tube in a process known as neurulation. During neurulation, morphogenesis of the mesenchyme that underlies the neural plate is believed to drive neural fold elevation. The cranial mesenchyme is comprised of the paraxial mesoderm and neural crest cells. The cells of the cranial mesenchyme form a pourous meshwork composed of stellate shaped cells and intermingling extracellular matrix (ECM) strands that support the neural folds. During neurulation, the cranial mesenchyme undergoes stereotypical rearrangements resulting in its expansion and these movements are believed to provide a driving force for neural fold elevation. However, the pathways and cellular behaviors that drive cranial mesenchyme morphogenesis remain poorly studied. Interactions between the ECM and the cells of the cranial mesenchyme underly these cell behaviors. Here we describe a simple ex vivo explant assay devised to characterize the behaviors of these cells. This assay is amendable to pharmacological manipulations to dissect the signaling pathways involved and live imaging analyses to further characterize the behavior of these cells. We present a representative experiment demonstrating the utility of this assay in characterizing the migratory properties of the cranial mesenchyme on a variety of ECM components.

The cranial mesenchyme undergoes dramatic morphogenic movements that likely provides a driving force for elevation of the neural folds1,2. Here we describe a simple ex vivo explant assay to characterize the cellular behaviors of the cranial mesenchyme during neurulation. This assay has numerous applications including being amenable to pharmacological manipulations and live imaging analyses.

두개골 Mesenchyme의 셀룰러 행동을 평가하기위한 Explant 분석

The central nervous system is derived from the neural plate that undergoes a series of complex morphogenetic movements resulting in formation of the ...

심 외막 파생물 문화 분석 및

요약

더 많은 비디오 탐색

이 비디오의 챕터

유해 화학 물질에 노출 된 후 내피 세포 이동의 평가

마우스 배아 심장에서 심 외막 세포의 체외 배양에서

대동맥 반지 공동 문화 분석 결과: Mesenchymal Stromal 세포에 생체 외에서 의 신생 잠재력을 평가 하는 편리한 도구

분리와 인간 성인 그리고 태아 심장 표본에서 파생 하는 기본 Epicardial 세포의 문화

엔 페이스 마우스 배아에서 평면 형태형성 분석을 위한 심내막 쿠션 준비

Cardiogenic 유도 효율을 Quantifying에 대한 수정 마우스 배아의 줄기 세포 기반 어세이

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

두개골 Mesenchyme의 셀룰러 행동을 평가하기위한 Explant 분석