건강 5T32AI7493-20과 5R01AI089337-03 부여의이 작품은 국립 연구소에 의해 부분적으로 지원되었다. 자금 제공자는 연구 설계, 자료 수집 및 분석, 게시하는 결정, 또는 원고의 준비를 전혀 역할을 없었다.

승인 된 프로토콜 번호 101109272에서 본원에 기재된 버밍엄 기관 동물 사용 및 관리위원회에서 알라바마 대학은 마우스의 사용을 승인했다. 1. 유전 건설 수정 된 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 항원 캡시드-설립 전략 <ol><li> 셔틀 플라스미드의 건설 HVR1-KWAS-HVR5-그의 6 / pH5S <ol><li> hexon5 유전자의 AccI로 제한 효소 부위 사이 AgeI 합성 DNA 서열 HVR1-KWAS을 함유하는 플라스미드를 주문한다. </li><li> 37 ℃에서 3 시간 동안 효소 AgeI (6 단위)과 AccI (6 단위)으로 합성 된 조각 (HVR1-KWAS)의 6 μg의 다이제스트. 전기 영동에 의한 2 % 아가로 오스 겔에서 분해 단편을 해결 한 제조사의 프로토콜에 따라 DNA 겔 추출 키트 단편을 정제. </li><li> 삽입의 몰 비율을 바탕으로 3에서 벡터에 : 1, T4 DNA 리가 아제와 리가 B를 사용uffer는 이전에 구축 셔틀 플라스미드 100 NG로 조각 (HVR1-KWAS)의 12 NG를 결찰하는 HVR5-그의 6 / pH5S 2 시간 동안 실온에서 10 μL 볼륨 17, AgeI 및 AccI의 사이트를 통해. </li><li> (1800 V에서) electroporator에 electrocompetent DH5α 세포의 50 μL로 결찰 제품의 10 μL 중 1 μl를 변환. 형질 전환 된 DH5α 세포를 SOC 배지 950 μl를 넣고 300rpm으로하여, 37 ° C에서 1 시간 동안 혼합물을 배양한다. 카나마이신을 포함하는 루리아 - 베르 타니 (LB) 한천에 1 ml의 혼합물을 100 ~ 200 μl를 확산하고 37 ℃에서 O / N을 품어. <ol><li> ~ 조각 HVR1-KWAS를 대상으로 PCR 10 식민지를 화면으로, 앞으로 프라이머 (TATGTGTGTCATGTATGCGT)를 혼합 (제조사의 프로토콜에 따라) PCR 마스터 믹스 솔루션에 프라이머 (GGAGGCCCACTTGTCCAGCTC) 단일 DH5α 식민지 역. PCR 마스터 믹스 솔루션과 함께 제공되는 설명서를 참조하여 열 순환기에 샘플을 실행. </li><li> 섹션 1.1.4.1에서 상영 클론의 조각 HVR1-KWAS을 시퀀싱하는 정방향 프라이머 (TATGTGTGTCATGTATGCGT)를 사용합니다. </li></ol></li></ol></li><li> 플라스미드 pAd5 / 건설 H5-HVR1-KWAS-HVR5-그의 6 <ol><li> 다이제스트 6 μg의 HVR1-KWAS-HVR5-그의 6 / 37 ° C에서 3 시간 동안 효소를 EcoRI (6 단위)과 PmeI (6 대)와 pH5S 및 상동 재조합 무기와 이중 수정 hexon5 유전자를 포함하는 단편을 정제, 로 단계 1.1.2에 명시된. 백본 플라스미드 SwaI와 pAd5 / ΔH5 (GL) 16 선형화. </li><li> 셔틀 플라스미드에서 대상 단편 100 NG와 (1800 V에서) electroporator의 상동 재조합에 대한 electrocompetent BJ5183 세포의 50 μL에 선형화 pAd5 / ΔH5 (GL) 백본의 100 NG를 공동-변환. 형질 전환 된 세포에 SOC 매체의 950 μl를 추가하고 37 ℃, 300 rpm에서 1 시간 동안 혼합물을 품어. 1 ml의 혼합물의 200 μL - (100)를 확산37 ℃에서 O / N 항온 처리 용 카나마이신 (최종를 50㎍ / ㎖)을 함유하는 LB 한천. <ol><li> 선택 ~ 3 ㎖에 10 작은 식민지 진탕 (250 rpm으로, 37 ° C)에서 O / N 배양을위한 카나마이신 (최종 50 μg의 / ㎖)를 포함하는 액체 LB. 문화 플라스미드의 압축을 풉니 다. 단계 1.1.4.1에 도시 된 바와 같이, 단편 HVR1-KWAS을 대상으로 10 콜로니를 선별하기 위해 PCR 분석을 사용한다. </li><li> 백본 게놈의 PIX 단편을 대상으로 PCR 분석에 의해 같은 식민지를 화면으로, 앞으로 프라이머 (AGCTGTTGGATCTGCGCCAGCAGGTT)를 혼합, (제조사의 프로토콜에 따라) PCR 마스터 믹스 솔루션에 프라이머 (CCAAACAGAGTCTGGTTTTTTATTTAT) 단일 BJ5183 식민지 역. PCR 마스터 믹스 솔루션과 함께 제공되는 설명서를 참조하여 열 순환기에 샘플을 실행합니다. </li><li> pAd5 / H5-HVR1-KWAS-HVR5-그의 6으로 PCR을 두 번 긍정적 인 식민지를 지정합니다. </li></ol></li><li> 에 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 100 NG를 변환단계 1.1.4에 도시 된 바와 같이 세포를 DH5α한다. <ol><li> 단계 1.1.4.1에 도시 된 바와 같이, 단편 HVR1-KWAS을 대상으로 10 ~ 콜로니를 선별하기 위해 PCR 분석을 사용한다. </li><li> 단계 1.2.2.2에 도시 한 바와 같이, 백본 PIX 게놈 단편을 표적으로 동일한 콜로니를 선별하기 위해 PCR 분석을 사용한다. </li><li> pAd5 / H5-HVR1-KWAS-HVR5-그의 6 조각 HVR1-KWAS을 시퀀싱하는 정방향 프라이머 (TATGTGTGTCATGTATGCGT)를 사용합니다. </li></ol></li></ol></li></ol> 수정의 Ad5 바이러스 성 벡터의 Ad5 / 2. 준비 H5-HVR1-KWAS-HVR5-그의 6 <ol><li> 고 글루코스 DMEM로 FBS (최종 10 %), 100X 비 필수 아미노산 (최종 0.1 mM)을 200 mM의 L- 글루타민 (최종 2 mM)을하고 페니실린 / 스트렙토 마이신 용액 (최종 1 %)을 첨가하여 완전한 배지를 구성 . (85 % 습윤 조건하에 37 ℃ 및 5 % CO2) 배양기에서 완전 배지에서 인간 배아 신장 (HEK293) 세포를 유지한다. </li><li> 바이러스는했습니다의 구조ctor에의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 <ol><li> 완전 배지 및 배양 O / N 5 mL를 함유 한 T-25 플라스크에 종자 HEK293 세포를 3.0 × 106 80 %와 합류 단층을 달성했다. </li><li> 15 μg의 선형화 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 3 시간 동안 37 ° C에서 제한 효소 PACI (15 대)와 100 μL 볼륨에서. <ol><li> 추출 선형화 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 페놀 동량 (1 분 동안 10,000 XG) 회 반응을 원심 분리하여 클로로포름 : 내의 흄 후드 이소 아밀 알코올 (: 24 일 25시 비율) 및 혼합 된 용액 (100 % 에탄올 300 μL 및 나트륨 아세테이트 10 μL) 및 70 % 에탄올 700 μL 순차 원심 분리 (10 분 동안 10,000 XG)에 의해. 각각의 원심 분리 단계에서 상층 액을 버린다. </li></ol></li><li> 정제 된 플라스미드 ~ 증류수 또는 트리스 - EDTA (TE) 버퍼의 40 μl를 재현 탁. 광학 드를 측정함으로써 플라스미드 DNA를 정량nsity 260 nm의 (OD). </li><li> 제조업체의 설명서에 따라, T-25 플라스크 상업 ​​리포좀 형질 전환 시약과 선형화 된 플라스미드의 3 μg의를 형질. 6 시간 배양 인큐베이터에서 후 형질 전환 이후의 배양에 완전한 매체와 형질 매체를 변경합니다. 각각의 바이러스 성 플라크 형성 할 때까지, 모든 2-3일 완전한 매체를 대체하여 형질 전환 된 세포를 유지한다. </li><li> 플라크는 전체 세포 병변 효과 (CPE)를 개발할 경우, 무균 후드 플라스크 오프 나머지 세포를 긁어, 4 ° C에서 10 분 동안 300 XG에 매체를 원심 분리하여 수확 된 세포 용 해물. 2 % FBS를 함유하는 배지 ~ 1 ㎖ 중의 세포 펠렛을 일시 중단하고, 동결 - 해동 네 배 세포 파괴. 4 ℃에서 10 분 동안 10,000 XG에 해물을 원심 분리 한 후 구출 바이러스를 포함하는 상층 액을 수집합니다. </li></ol></li><li> 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6의 대규모 전파 <ol><li> 일을 전파T-25 플라스크에서 전체 용해질을 1/3로 감염시켜 무균 후드 HEK293 세포를 포함하는 T-75 플라스크에서 E 바이러스. 전체 CPE는 문화 인큐베이터에서 2~3일 내에서 개발을 허용합니다. 단계 2.2.5에 명시된 해물 상층 액을 수확. </li><li> 바이러스 전파 환경에 따라, T-75 플라스크에서 전체 용해질 1/2로 감염시켜 무균 후드 1-3 T-175 플라스크에서 바이러스를 전파. 전체 CPE는 문화 인큐베이터에서 2~3일 내에서 개발을 허용합니다. 단계 2.2.5에 명시된 해물 상층 액을 수확. </li><li> 이전 T-175 플라스크 (들)에서 전체 해물에 1/2 감염에 의해 멸균 후드에 한 12 이상의 T-175 플라스크에 바이러스를 전파. 바이러스 전파 조건 및 필요한 바이러스의 양에 기초하여 플라스크 사용량을 결정한다. 전체 CPE는 문화 인큐베이터에서 2~3일 내에서 발생하는 경우 단계 2.2.5에 명시된 해물 상층 액을 수확. </li></ol></li><li> 을 정제세슘 클로라이드의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 가스화 <ol><li> 5 mM의 HEPES에서 협동 학습 솔루션의 두 가지 밀도 준비 : 1.33 ml의 G / 및 1.45 ㎍ / ㎖, CSCL과의 접촉을 피하고있다. </li><li> CSCL의로드 4 ml의 멸균 초 원심 분리기 튜브 (1.33 ㎍ / ㎖), 부드럽게 튜브의 바닥에 대한 CSCL의 4 ㎖ (㎍ / ㎖ 1.45)를로드합니다. 로드 천천히 멸균 후드에 그라디언트의 상단에 해물 상층 액 4 mL를. </li><li> 결함 / 높은 바이러스 밴드에서 성숙 / 낮은 바이러스 밴드를 분리하기 위해 4 ℃에서 3 시간 동안 110,000 XG에서 튜브를 원심 분리기. 33 G 바늘로 무장 한 3 ML의 주사기를 사용하여 낮은 밴드를 수집하고 멸균 후드에 4 ml의 볼륨에 5 mM의 HEPES와 함께 밴드를 희석. </li><li> 단계 2.4.2에 기술 된 바와 같이 두 개의 협동 학습 솔루션의 밀도와 바이러스의 희석 밴드와 다른 튜브를 넣습니다. 4 ℃에서 11 만 XG의 O / N에서 튜브를 원심 분리기. 단계 2.4.3에 설명 된대로 바이러스 밴드를 수집합니다. </li><li> dialys에서 수집 된 바이러스 용액을 주사멸균 후드에 33 G 바늘로 무장 한 3 ML의 주사기에 의해 카세트입니다. </li><li> 1X 투석 완충액 700 ㎖ 중의 카세트를 배치 (1 L의 레시피 10 배 PBS 100 ㎖, 100 % 글리세롤 100 ㎖ 및 증류수 800 ㎖; 0.22 μm의 필터를 통해 버퍼를 필터링) 및 투석 버퍼를 교체 매 3 4 시간에 대한 시간. 니들 주사기를 사용하여 투석 된 바이러스 용액을 대기음. </li></ol></li></ol> 구출 바이러스 성 벡터의 3. 검증 <ol><li> 바이러스 성 벡터 적정의 <ol><li> (10)와 1 : 바이러스 물리적 역가를 들어, 바이러스 및 하나의 투석 완충액 (배경 제어) 모두 희석 바이러스 용해 완충액에서 20 (10 % SDS에서 트리스 EDTA) 작은 튜브, 및 56 ℃에서 모든 튜브 부화 10 분. </li><li> biophotometer 켜고 OD 260 nm에서 흡광도의 모드를 설정합니다. &quot;빈&quot;아래를 클릭하여 배경 신호를 균형 : 희석 투석 버퍼 (10 일)를 사용합니다. biophotometer의 SCR의 유형 &quot;10 + 90&quot;EEN 및 희석 바이러스의 신호 (10 1) 판독. </li><li> 단계 3.1.2의 방법에 따라, 대신 biophotometer 화면에서 &quot;5 + 95&quot;을 입력 : 희석 된 바이러스의 신호 (20 일)을 참조하십시오. 1.1 × 12 개의 바이러스 판독 숫자를 곱하면 두 희석에서 두 개의 개별 역가에 근거 부사장 / ㎖로 단위로 평균 역가를 계산한다. </li><li> 감염성 바이러스 역가 (IP / ㎖)을 위해 10 일 후 감염에 HEK293 세포에 감염 깊이를 결정하기 위해 통계적 KARBER TCID (50)을 사용하여 방법 14 (dpi)로 </li></ol></li><li> 바이러스 벡터에 항원 노출 디스플레이의 평가 <ol><li> 코트 ELISA 플레이트에 바이러스 벡터 및 표준 ELISA 법 (14)의 나머지 단계를 진행합니다. 통합 항원 (14)에 대응의 검출에 대한 인간의 안티 gp41 (2F5) 단일 클론 항체 (단클론 항체) 및 마우스 항 - 그의 태그 단클론 항체를 사용합니다. </li><li> denatu에 바이러스 벡터를 해결붉은 단백질 겔 전기 영동 (SDS-PAGE) 및 웨스턴 블롯 표준 방법 (14)의 나머지 단계를 진행. 통합 항원 (14)에 대응의 검출에 대한 인간의 안티 gp41 (2F5) 단일 클론 항체 (단클론 항체) 및 마우스 항 - 그의 태그 단클론 항체를 사용합니다. </li></ol></li><li> 의 Ad5-positve 혈청을 우회 할 수있는 능력에 벡터의 생체 외 평가 <ol><li> 문화 인큐베이터 (37 ° C, 5 % CO 2 85 % 미만 가습 조건)에 완전 배지에서 헬라 세포를 유지한다. FBS (최종 10 %), 200 mM의 L- 글루타민 (2 mM의 최종) 및 최소 필수 중간 이글 (MEME)로 페니실린 / 스트렙토 마이신 용액 (최종 1 %)을 첨가하여 완전한 배지를 구성한다. </li><li> 1 × 6 전지에서 6 웰 플레이트에서 씨앗 헬라 세포 / 웰, 2 시간 동안 문화 인큐베이터 (37 ° C, 5 % CO 2 85 % 미만 가습 조건)에서 번호판을 품어. (바이러스 벡터의 5 IP / 셀과의 Ad5 양성 혈청 (0.1 μL 0 μL)을 품어AD5 또는의 Ad5 / H5-HVR1-KWAS-HVR5-그의 1 시간 동안 배양 인큐베이터 6) 세포를 포함하는 6 웰 플레이트에 혼합물을 추가하기 전에. </li><li> 24 시간이 (HPI)를 감염 게시물, 용해 완충액 0.5 ㎖에 한 번 PBS와를 Lyse 세포와 세포를 씻어. 5 분 15,000 XG에 원심 분리기와 뜨는를 수집합니다. 바이러스는 루시페라아제 유전자가 포함되어 있기 때문에, 루시페라아제 신호 판독 용 루시페라아제 기질 100 ㎕와 20 ㎕의 상등액을 섞는다. </li></ol></li></ol> 구출 바이러스 성 벡터의 4. 면역 학적 평가 <ol><li> 의 Ad5과의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 : 두 예방 접종 그룹을 준비합니다. <ol><li> 이주의 간격으로, 상동 &quot;프라임 - 부스트&quot;면역 요법에, 1 × 10 VP / 마우스에서 바이러스 근육 (N = 8 / 그룹) 마우스를 주입한다. </li><li> 2 주마다 주사를 게시에서, 동물 란셋 (5mm 팁 길이)에 출혈 뺨에 의해 마취없이 마우스를 피1.5 ml의 튜브에 혈액을 수집합니다. </li></ol></li><li> 상하 반전에 의해 튜브에 혈액을 혼합하고, 실온에서 30 분 동안 배양 한 피. 5 4 ° C에서 분, 새로운 1.5 ml의 튜브로 전송 혈청 (상단 층) 10,000 XG에서 튜브를 스핀. <ol><li> 5 4 ° C에서 최소 및 전송 혈청 10,000 XG에서 새로운 튜브를 스핀 새로 -80 ℃에서 저장을위한 1.5 ml의 튜브를 표시합니다. </li></ol></li><li> 혈청 기반 ELISA에 의한 항원 특이 체액 성 면역의 평가 <ol><li> 그의 펩타이드 (1 mM의에서 주) 및 HIV-1 펩타이드 (1 mM의에서 주) 별도로 100에 희석. </li><li> mM의 탄산 완충액 (pH 9.5)의 10 μM에서 펩티드 코팅 농도를 달성한다. 코트 별도로 4 ℃에서 판 O / N을 잘 당 100 μL를 추가하고 배양에 의해 희석 된 펩티드와 ELISA 플레이트. </li><li> PBST 5 % BSA에서 1 시간 동안 200 / μL 잘 블록에서 네 번 PBST로 접시를 씻으십시오. 1 판에 마우스 혈청을 적용 : 100 희석을 차단 버피에FER, 100 μL / 웰. 실온에서 2 시간 배양을 위해 품어. </li><li> 사 회 PBST로 접시를 씻으십시오. / 웰 100 μL의 블로킹 완충액에서 실온에서 30 분 동안 배양함으로써 플레이트를 차단. </li><li> 100 μL에서 / 잘 개별적으로 그의 펩타이드 및 HIV-1 펩티드로 코팅 된 플레이트에 모두 : (차단 버퍼에 5000 1) 염소 항 - 마우스 IgG-HRP를 적용합니다. 실온에서 2 시간 동안 품어. PBST로 접시를 씻으십시오. </li><li> 30 분 동안 HRP 기판에 배양 한 후 OD450의 nm에서 번호판을 읽어보십시오. </li></ol></li></ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

저자가 공개하는 게 없다.

백신의 개발을위한 변형 된 Ad5에 전통적인 유전자 전략의 애플리케이션은 주로 기인 된 Ad5 PEI 4,6-와 연관된 병목 감소되었다. 이 병목 현상은 부분적으로이 전략의 Ad5 NABS에 의해 중화을 회피 할 수 있기 때문에 항원 - 중 - 관심의 Ad5의 중화 에피토프를 대체하여, 다른 항원 캡시드-설립 전략 (그림 1A)의 응용 프로그램에 의해 감소하고, 강력한 면역의 생성을 촉진 할 수있다 통합 된 항원 -의 이익에. 본 연구에서는 수정 된 이가 바이러스 벡터의 생성의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 개념 예 (그림 1B)로 도입되었다. 프로토콜 섹션 1.1.1에 해​​당하는 주문 플라스미드의 합성 단편 hexon5의 HVR1 로케일에서 HIV-1 gp41 짧은 유전자 치환을 포함한다. 부분 gp41 유전자는 대체 에피토프 ELDKWAS을 인코딩아미노산 hexon5 (14)의 139-144에서 부분 HVR1. ELDKWAS는 HIV-1 gp41 (19)의 강력한 중화 에피토프이다. 복제시에, 두 가지 중요한 단계가 있었다. 프로토콜 섹션 1.1.1에서 유전자 단편의 관심을 합성 할 때 한 두 단계는 제한 효소의 선택이었다. 두 효소의 선택은 조건부 수정할 광고 캡시드의 위치, 즉에 따라 달라집니다. 본 연구에서는 KWAS를 포함하는 유전자 단편은 hexon5 단백질의 HVR1으로 통합 지정되었다. 제한은 AgeI 및 AccI는 N 말단과 C 말단이 HVR1 로케일 영역의 측면에 별도로 존재하고, 따라서 AgeI 및 AccI 개별적 N 말단 및 C-에 넣어되도록 선택 하였다 단편 HVR1-KWAS에 존재하지 않는 효소 합성 조각 HVR1-KWAS의 말단. hexon는 중화 항원이 hexon 12, 18, ​​20, 22의 모든 HVRS에있는 주요 광고 NABS의 목표 및 hexon 별이기 때문에 가능하다 일이항원 캡시드-설립 전략 전자 hexon 수정의 Ad5 벡터는 시험 관내에서의 Ad5 양성 혈청에 의해 중화을 우회 할 수있는 능력을 확보하고, 호스트 심지어의 Ad5 PEI 수 있습니다. 본 연구에서는 가의 바이러스 벡터에 모두 HVR1과 HVR5은의 Ad5 양성 혈청으로 중화의 탈출에 기여할 수있다. 다른 중요한 단계는 프로토콜의 1.2.2 절에 있었다. LB 한천에 공동 형질 전환 혼합물의 O / N 항온 처리 한 후, 성장 BJ5183 콜로니 O / N에 대한 액체 LB에서 즉시 배양 될 필요 플라스미드 즉시뿐만 BJ5183 세포로부터 추출 될 필요가있다. BJ5183 세포에서 재조합 플라스미드가 안정되지 않기 때문에 절차를 지연 시키면 가능성, 잠재적 인 재조합 및 돌연변이로 이어질 것입니다. 상동 재조합에서 올바른 플라스미드를 안정하고 정확한 게놈 종을 유지하기 위해 DH5α로 변환 될 필요가있다. 복제 후, 두 개 더 중요한 단계가 있었다.프로토콜 섹션의 첫 번째 단계는 형질 전환에 관한 것입니다. 이는 백본 플라스미드 E1 유전자를 삭제하면의 Ad5 E1 (HEK293)를 발현하는 세포 내로 재조합 광고 백본 플라스미드를 형질 감염시킬 필요가있다. 프로토콜 2.3의 다른 단계는 바이러스 업 스케일링에 관한 것입니다. 바이러스 업 스케일링의 기본 절차는 T-75 플라스크에와 T-175 플라스크에 T-25 플라스크에서 표준 바이러스 업 스케일링의 원리를 따른다. 그러나 사용 플라스크 (T-75 및 / 또는 T-175)의 수는 바이러스, 바이러스 감염에 의한 CPE 개발, 필요한 바이러스의 양의 성장 속도에 의존한다. 항원 캡시드-설립 전략은 광고 수정에 폭 넓은 응용이 가능합니다. 이 전략으로, 그것은 수정 또는 hexon 2,4,20, 펜톤 기지 (21) 섬유 (22) 등 다른 주요 캡시드 단백질에 이종 항원을 포함하는 것이 가능하다. 캡시드 작은 단백질 PIX의 C 말단은 heterol에 대한 약속을 보여 주었다ogous 항원 / 펩타이드 결합 21,23. 단일 수정 외에,이 전략과 광고에 여러 수정은 성공을 달성했다. 예를 들면 이가의 세대의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 HVR1과 hexon5의 HVR5 및 HVR1 및 HVR2 또는 HVR1 및 하나에 장 바이러스의 종류 (71)의 두 중화 항원의 결합 모두 포함 과정으로이 연구에서 HVR4, 또는 HVR1 및 hexon3 24 HVR5. 이러한 예는 유전자 치료 또는 예방 접종 접근법의 목적으로 광고의 다른 혈청 형에 hexon 수정의 가능성을 의미한다. 우리의 데이터는 hexon와 PIX (게시되지 않은 데이터)에 두 트리파노소마 (Trypanosoma) cruzi 항원 결정기의 포함 과정을 보여 주었다. 이 전략은 또한 예방 접종 또는 유전자 치료 방법 중 하나에 대한 키메라 광고 벡터를 만들기 위해 확장되었습니다. 예 hexon3 16 hexon5 전환하여 키메라 Ad5H3의 세대, 키메라 Ad3H7의 생성 hexon3 위스콘신을 전환하여제 25을 hexon7, AD4 및 섬유 (26)의 Ad5 섬유로 대체함으로써 키메라 Ad5F4의 생성. 본 연구에서는 가의의 Ad5 / H5-HVR1-KWAS-HVR5은 - 그의 6은 통합 항원 -의 이익에 특정 체액 성 면역 반응을 던져 선수를 보여 주었다. 우리의 현재 프로젝트 ASP2 특정 CD8 T 세포 반응이 크게 항원 캡시드 혼입 전략, 단백질 IX의 Ad5의 (PIX)로 ASP2 펩티드를 혼입시킴으로써 생성 된 벡터의 Ad5-PIX-ASP2로 면역화하여 프라이밍 것을 보여 (데이터는 보이지 않음). ASP2이, 또한 amastigote 표면 단백질 2라는 이름의, digenetic 세포 내 원생 동물 기생충 트리파노소마 (Trypanosoma)의 cruzi (T. cruzi) (27)의 면역 항원이다. 이 새로운 실험 결과는 광고 벡터화 백신에 항원 캡시드-설립 전략의 응용 프로그램이 휴대 immun 또한뿐만 아니라 체액 성 면역 반응을 유도 할 수 있지만, 우리의 지식을 확장항원 -의 이익에 특정 전자 응답. 기존의 유전자 전략에 비교적 유리하지만, 항원 캡시드-설립 전략은 세 가지 단점이있다. 첫째, 한 기존의 전략처럼 유전자의 관심의 결합을 허용 할 수 없습니다. 그것은 hexon5에 항원 캡시드-설립 전략이 최대 80 아미노산 HVR1에서 (AA), HVR5 77 AA와 HVR2이 57 AA의 삽입을 허용 것으로보고되었다. 그중 HVR1는 통합에 가장 관대 한 로켈입니다. 그러나, 작은 캡시드 단백질 PIX 1000 아미노산 (28)의 삽입을 수용 할 수있다. 둘째, 일부 항원 - 중 - 관심 성격으로 인해 광고 바이러스의 구조적 배열을 방해하는 것 같은 요금 및 아미노산의 힘과 요인, 광고 캡시드 단백질로 통합에 실패합니다. 이 경우, 해당 스페이서의 도입 일을 도울 수있다 항원 관심 - 연결된전자 성공적인 통합 4. 셋째, 일부 HVR 로케일에 포함 과정은, 예., HVR6 또는 HVR7이 가능한 바이러스 벡터 (12)의 실패 발생의 원인이됩니다. 장점과 단점을 모두 전략 주어 두 전략의 두 가지 전략에서 현명한 선택 또는 조합을 특정 조건 / 요구에 의존 할 것이다. 전략을 모두 빗질의 예는,의 Ad5 / HVR2-MPER-L15 (개그)의 생성해진다 막 인접 외부 지역 항원 캡시드-설립 전략 hexon5의 HVR2에 통합 HIV-1 gp41was의 (MPER) 과 HIV-1 개그 유전자는 기존의 유전자 전략 2의 Ad5의 E1 유전자 로케일을 대체하기 위해 삽입되었다.

인간 아데노 바이러스 (AD)는 이중 가닥 DNA 게놈을 포함하는 뉴 클레오 캡시드 면체와 중형, 비 - 외피 바이러스이다. 광고는 일곱 그룹으로 분류 (G 통해)와, 아데노 바이러스 제품군에 속한다. 각 그룹은 다른 혈청 형의 바이러스가 포함되어 있습니다. 그룹 C에서, 아데노 바이러스, 이는 혈청 형 5의 (의 Ad5)의 가장 광범위하게 연구되어 왔으며 가장 널리 유전자 치료 백신과 같은 벡터화에 대한 적용 방법. 전통적인 유전자 전략 개발 및 유전자의 관심을 가진 바이러스 초기 유전자의 변위 특징으로 된 Ad5 변형, 적용, 및 유전자의 관심 숙주에서의 발현 집중되었다. 예를 들면 유인원 면역 결핍 바이러스 1 회전 유전자 초기 유전자 3 (E3)을 대체하여 pENV9 / Ad5hrΔE3의 건설이다, 인간 면역 결핍의 개그 유전자 초기 유전자 1 (E1)을 대체하여 AdCMVGag의 건설바이러스 (HIV) 2, 락 Z 유전자 3 (E1)를 교체하여 광고 락 Z의 건설. 의 Ad5에 전통적인 유전자 전략의 광범위한 애플리케이션은 다음의 장점에 의존의 Ad5, 바이러스 및 바이러스 증식에 가능한 유전자 공학, 외래 유전자 삽입의 대형 숙박 시설과의 Ad5 4,5의 안전을 위해 호스트 다양한. 그러나,이 전략을 이용하여 벡터화 된 Ad5-임상 치료의 감소는 효능의 Ad5 어린이와 어른의 4,6- 중 대다수 만연해 때문에, 주로의 Ad5 PEI과 연관 매핑 된 주요 병목왔다. 의 Ad5의 주요 병목 현상을 극복하기 위해, 주요 목적은 PEI의 Ad5를 우회 대체 전략을 개발하는 것이다. 이러한 중화 항체 (NABS) 8-10 및 CD8 + T 세포 반응 등의 선천성 면역 7, 적응 면역이의 Ad5에 대하여 (10)는 공동 것으로 나타났다의 Ad5 NABS가의 Ad5 PEI 10, 11에 기여에서 지배적 인 역할을 할 것으로 나타나는으로의 Ad5 PEI에 ntribute. 또한,의 Ad5의 주요 단백질 hexon, 섬유 및 펜톤 기본 포함 캡시드 단백질에있는 대상 에피토프를, NABS. 그중 hexon는의 Ad5 NABS 8,11-13의 주요 대상입니다. 이러한 발견에 기초하여, 혁신적인 캡시드 항원 혼입 전략이 도입되었다. 이 새로운 전략은 NABS하고 효율적인의 Ad5 벡터 행정에 의해 감소​​ 된 인식으로 이어지는, 단백질-의 관심의 Ad5 중화 에피토프를 이동 또는 마스크의 Ad5 캡시드 단백질에의 교체 또는 통합을 강조한다. 그것은 또한 호스트가 직접 면역 시스템 4,14,15 항원에 관심 - 제시하여 강력한 체액 성 면역 및 세포 면역 효능을 유도 할 수 있기 때문에 도움이 전략이 경쟁력 있음을 주목할 만하다. 이러한 전략에 기초하여, 분자 클로닝 및 재조합 바이러스 벡터 광고 구조는 구조적으로 분할 될 수있다네 가지 주요 단계로, (a) 중 중합 효소 연쇄 반응 (PCR) 또는 합성에 의해 유전자의 관심 단편의 제조; (b) 아데노 백본 유전자 단편의 관심과 상 동성 암을 포함하는 셔틀 플라스미드 내로 유전자 단편의 라이 게이션; (c)에 의한 상동 재조합 공동 바뀌는 선형화 된 플라스미드 백본 pAd5 / ΔH5 (GL) 16 유전자의 관심 단편을 포함하는 셔틀 플라스미드; (D) 선형화 재조합 아데노 바이러스 플라스미드의 형질은 항원 - 중 - 관심 통합 재조합 광고 벡터를 구출한다. 우리 그룹과 일부 다른 사람은 다른 감염성 병원균에 대한 광고 벡터화 백신 개발이 대안 광고의 통합 전략을 드리고 있습니다. 우리는 재조합 광고 벡터의 생성을보고 광고 - HVR1-LGS-자신의 Ad5의 hexon (hexon5)의 HVR1 로케일로 그의 태그가 HIV-1 항원 (V3)을 통합하여 6 -V3. 이 생성 된 벡터는 STR 트리거V3 에피토프 4 특정 옹 체액 성 면역 반응. 우리는 또한 hexon5 2의 HVR2 로케일로 HIV-1 막 인접 ectodomain 영역 (MPER)를 통합하여의 Ad5 / HVR2-MPER-L15ΔE1의 개발을보고했다. 또한, 닥터 서주의 그룹 애드 혈청 형 3 (AD3) 벡터화 백신, 즉. 개발이 광고 혼입 전략의 장점을 사용한, AD3의 HVR1으로 엔테로 바이러스 71의 중화 에피토프 SP70을 통합하여 바이러스 벡터 R1SP70A3의 세대 hexon (hexon3). R1SP70A3은 엔테로 바이러스 (71) 도전 (15)에 대한 보호의 높은 비율로 이어질 에피토프 SP70에 특정 강한 NABS 및 IFN-γ 생산을 생성. 기술 참조의 목적을 위해, 우리의 연구는 HVR1에 HIV-1 항원을 통합하여 가의의 Ad5 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6의 생성에 초점을 질적 항원 캡시드-설립 전략을 이용했다다 hexon5의 HVR5에 자신의 태그입니다. 생성 된 바이러스 벡터는 또한 면역 학적으로 평가 하였다. 항원 캡시드-설립 전략은 다른 감염성 질병에 대한의 Ad5-벡터화 예방 접종 방법의 발전으로 활용 될 수있다.

<table><tbody><tr><td>1x DPBS</td><td>Thermo Scientific</td><td>SH30256.01</td><td>for cell spliting&amp;nbsp;</td></tr><tr><td>10x DPBS</td><td>Thermo Scientific</td><td>SH30378.02</td><td>for dialysis buffer preparation</td></tr><tr><td>glycerol</td><td>SIGMA</td><td>G5516-1L</td><td>for dialysis buffer preparation</td></tr><tr><td>SDS</td><td>BIO-RAD</td><td>161-0301</td><td>for virus lysis buffer preparation</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Thermo Scientific</td><td>SH30910.03</td><td>component of culture medium</td></tr><tr><td>100x Non-Essential Amino Acids&amp;nbsp;</td><td>Thermo Scientific</td><td>SH30238.01</td><td>component of culture medium</td></tr><tr><td>200 mM L-glutamine</td><td>Cellgro</td><td>25-005-CI</td><td>component of culture medium</td></tr><tr><td>penicillin/streptomycin solution&amp;nbsp;</td><td>Cellgro</td><td>30-002-CI</td><td>component of culture medium</td></tr><tr><td>DMEM with high glucose</td><td>Thermo Scientific</td><td>SH30081.01</td><td>for HEK293 cell culture</td></tr><tr><td>Minimum Essential Medium Eagle</td><td>SIGMA</td><td>M5650</td><td>for HeLa cell culture</td></tr><tr><td>phenol:chloroform:isoamyl alcohol&amp;nbsp;</td><td>SIGMA</td><td>P3803-100ML</td><td>for large size of DNA purification</td></tr><tr><td>cesium chloride&amp;nbsp;</td><td>Research Products International Corp.</td><td>C68050</td><td>for virus purificiation</td></tr><tr><td>HEPES</td><td>Cellgro</td><td>25-060-CI</td><td>for CsCl solution preparation</td></tr><tr><td>HEK293</td><td>ATCC</td><td>51-0036</td><td>for virus rescue and upscale</td></tr><tr><td>HeLa</td><td>ATCC</td><td>CCL-2</td><td>for neutralization assay</td></tr><tr><td>T-25 flask</td><td>Thermo Scientific</td><td>156367</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>T-75 flask</td><td>CORNING</td><td>430641</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>T-175 flask</td><td>Thermo Scientific</td><td>159910</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>Ultracentrifuge</td><td>BECKMAN</td><td>NA</td><td>for virus purification</td></tr><tr><td>Ultracentrifuge tube</td><td>BECKMAN</td><td>344059</td><td>for virus purification</td></tr><tr><td>dialysis cassette&amp;nbsp;</td><td>Thermo Scientific</td><td>66380</td><td>for virus dialysis</td></tr><tr><td>ELISA plate</td><td>Thermo Scientific</td><td>442404</td><td>for ELISA</td></tr><tr><td>human anti-gp41 (2F5) mAb</td><td>NIH AIDS Reagent Program</td><td>1475</td><td>for immunological assays</td></tr><tr><td>mouse anti-His tag mAb</td><td>GenScript</td><td>A00186</td><td>for immunological assays</td></tr><tr><td>SOC medium</td><td>CORNING</td><td>46-003-CR</td><td>for transformation</td></tr><tr><td>PCR master mix solution</td><td>QIAGEN</td><td>201445</td><td>for PCR</td></tr><tr><td>Animal lancet (point length at 5 mm)</td><td>MEDIpoint</td><td></td><td>for mice bleeding&amp;nbsp;</td></tr><tr><td>Biophotometer</td><td>Eppendorf</td><td></td><td>for virus physical titer titration</td></tr></tbody></table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

아데노 바이러스 혈청 형 5 (의 Ad5)를 광범위하게 백신 개발을위한 기존의 형질 전환 방법으로 수정되었습니다. 임상 시험 전통적으로 이러한 변형 된 Ad5 벡터의 감소 효능은 주로 인구 중 대다수의 Ad5 기존 면역성 (PEI)과 상관 될 수있다. 의 Ad5 PEI의 우려를 해결하여의 Ad5-벡터화 백신 개발을 촉진하기 위해, 혁신적인 항원 캡시드-설립 전략은 사용되어왔다. 이 전략의 장점으로, 우리가 처음 hexon 셔틀 건설의 Ad5가-벡터화 플라스미드 HVR1-KWAS-HVR5 - 그 이전에 건설 셔틀 플라스미드 HVR5-그의 6 / pH5S에 가변 영역 (HVR) hexon의 1 서브 클로닝하여 6 / pH5S, 그의 6 태그 HVR5에 통합했다있다. HIV 에피토프를 함유 ELDKWAS HVR1이 DNA 단편을 합성 하였다. HVR1-KWAS-HVR5-그의 6 / pH5S 후 선형 및 선형 백본 플라스미드 pAd5 / ΔH5 (GL)와 공동으로 형질 전환상동 재조합합니다. pAd5가 / H5는-HVR1이-KWAS-HVR5이-그의 6 세포로 형질 전환 된이 재조합 플라스미드는 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6을 생성합니다. 이 벡터는 실제 바이러스 역가 (VP / ㎖)로 표시 질적 니스 전염성 역가 (IP / ㎖) 및 대응 VP / IP 비율을 갖도록 검증 하였다. 모두 HIV 에피토프와 그의 6 태그는 표면에 노출 된 Ad5 캡시드에 있었고, 자신의 에피토프 특정 항원을 유지했다. 중화 분석은 시험 관내에서의 Ad5 양성 혈청에 의해 중화를 우회하기 위해이 가의 벡터의 능력을 나타내었다. 마우스 예방 접종은 HIV 에피토프 6 그분에 강력한 체액 성 면역 특정의 생성을 보여 주었다. 이 원리 증명 연구 캡시드 항원 혼입 전략과 연관된 프로토콜을 실행 가능하게 상이한 캡시드 단백질을 수정의 Ad5-벡터화 백신의 생성을 위해 이용 될 수 있다고 제안했다. 이 프로토콜은 심지어 수 f를urther 희토류 혈청 형 아데노 - 벡터화 백신의 생성을위한 개질.

캡시드 항원 혼입 전략 (도 1a)은 이가의 Ad5 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5 그의-6를 생성하는데 이용되었다. 첫째, 셔틀 플라스미드 HVR1-KWAS-HVR5-그의 6 / pH5S가 이전 건설 셔틀 플라스미드 HVR5-그의 6 / pH5S 17에 HVR1-KWAS 단편을 서브 클로닝에 의해 건설되었다. 둘째, 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6 (14) &quot;를 EcoRI-HVR1-KWAS-HVR5-을 His6-PmeI&quot;의 조각과 SwaI - 선형화 pAd5 / ΔH5 사이의 상동 재조합에 의해 건설되었다 (GL ) (16) (그림 1B). PACI의 형질 소화 pAd5 / H5-HVR1-KWAS-HVR5-그의 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 (14)의 구조에 T-25 플라스크 리드에 6. 구조 된 바이러스 벡터는 대규모 전파 및 협동 학습 구배 초 원심 분리기의 2 사이클에 의해 정제 하였다. 하기 위해서의 Ad5가 / H5-HVR1-KWAS-HVR5이-그의 6, 물리적 역가가 바이러스 게놈의 물리적 복사본을 측정하여 / ml의 1.3 × 10 (11) 부사장에서 측정 된 구조 바이러스 벡터의 생존 / 체력을 증명하고, 감염 역가이었다 실제 감염성 바이러스 입자를 적정하여 1.4 × 10 9 IP / ㎖에서 결정. VP / IP 비는 이후 92 (14). 일반적으로 계산 된, 1,000 이하의 부사장 / IP 비율이 광고는이 바이러스의 질적 인 체력을 나타냅니다. 이 구조 바이러스 항원, HIV 항원과 바이러스 캡시드 주요 단백질 hexon5의 표면에 각각 자신의 태그를 표시할지 여부를 설명하기 위해, ELISA는 각각 인간의 2F5 단클론 항체와 마우스 항 - 그의 태그 단클론 항체로 수행되었다. 결과가 있었다 반면 두 사람의 2F5 단클론 항체 (그림 2A) (14)와 마우스 항 - 그의 태그 단클론 항체 (그림 2B) (14),의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 결합을 보였다 것으로 나타났다에는 부정적인 contro에 결합하지L 벡터의 Ad5. 웨스턴 블롯 분석은 단지 바이러스의 Ad5 모두 인간 2F5 단클론 항체 (도 2C) (14)와 마우스 항 His 태그를 단클론 항체 (도 2d) (14) 검출 같이 ELISA에 데이터를 확인하는 117 kDa의 주변의 특정 대역을 사용 하였다 / H5- HVR1-KWAS-HVR5-그의 6 hexon5 단백질의 크기에 대응한다. 의 잠재력을 평가하기 위하여의 Ad5 / 프로토콜 섹션 3.3에 명시된 바와 같이 H5-HVR1-KWAS HVR5-6의 Ad5-그의 양성 혈청에 의해 중화를 우회에서 중화 검정 분석을 수행 하였다. 결과는 상대적인 형광 단위의 Ad5-positve 혈청 0 μL 처리 바이러스 벡터의 Ad5로부터 (RLU) 신호의 Ad5-positve 혈청 0.1 μL (p 값 &lt;0.001로 처리 동일한 벡터에서보다 12 배 더 높은 것으로 나타났다 ). 이것의 Ad5-positvive 혈청에 의한 벡터의 Ad5의 중화를 제안했다. 대조적으로, 바이러스 벡터의 Ad5 / H5-HVR1-KWAS-HVR5 그의-6에서 거의 차이가 있었다0 μL와의 Ad5-positve 혈청 0.1 μL (그림 3)로 처리. hexon는 중화 항원이 hexon 12, 18, ​​20, 22의 모든 HVRS에있는 주요 광고 NABS의 목표 및 hexon 별이기 때문에, 데이터는 위의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6의 Ad5-positve 혈청으로 중화 탈출 시연 의 잠재적 인 생체 외 및 제안의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6 호스트에서의 Ad5 PEI를 우회합니다. 항원 캡시드-설립 전략 수정 가의의 Ad5 바이러스 벡터가 통합 된 항원 -의 이익과 관련된 강력한 체액 성 면역을 유도 할 수 있는지 여부를 조사하기 위해, &quot;프라임 - 부스트&quot;면역 요법은 제어 바이러스 벡터의 Ad5과 함께 마우스를 면역에 적용되었다 가의 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6. HIV-1 펩티드로 코팅 세라 기반 ELISA는의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6의 예방 접종 군에서 혈청 significan 있었다는 것을 보여 주었다대조군 (p 값 &lt;0.001) (도 4a) (14)로부터의 혈청에 비해 t 40와 640 사이의 희석에 HIV-1에 결합하는 펩티드. 그의 펩티드로 코팅 된 ELISA 세라 기반 대조군 혈청과 비교했을 때의 Ad5 /의 면역화 그룹에서 혈청 H5-HVR1-KWAS-HVR5-그의 6 통계적 p 값으로서, 그의 펩타이드 결합 유의 한 것으로 나타났다 &lt; 320 희석 (도 4b)에서 14 (160) 및 p 값 &lt;0.05의 희석 40, 80, p 값 &lt;0.01의 혈청 희석액에 0.001. 이상의 결과 가의 바이러스 벡터에 혼입 항원에 대한 체액 성 면역 반응의 발생을 나타내었다. <img alt="그림 1" src="/files/ftp_upload/52655/52655fig1.jpg" /> 항원 캡시드-설립 전략 플라스미드 pAd5 / H5-HVR1-KWAS-HVR5-그의 6의 유전 구조의 그림 1. 도식 그림. (A) 항원 캡시드-설립 전략은 직접 항원의 관심 아데노 바이러스의 캡시드 단백질 (hexon, 펜타베이스, PIX 및 / 또는 섬유)에 표시 특징입니다. 이 그림은 Nemerow에서 적응했다 등. 2009 년 바이러스학 384 (2009) 380-388은, 저작권 엘스 비어. (나) 유전자 단편 (HVR1-KWAS)는 합성 및 회사에 의해는 pUC 벡터에 클로닝 하였다. 이 조각은 HVR5-그의 제한에 의해 6 / pH5S이 AgeI과 AccI이 HVR1-KWAS-HVR5-그의 6 / pH5S를 생성하는 효소 이전에 건설 셔틀 플라스미드에 서브 클로닝 하였다. 얻어진 셔틀 플라스미드를 재조합 백본 플라스미드 pAd5 / H5-HVR1-KWAS의 생성의 결과로, 효소를 EcoRI 및 PmeI, 공동 형질 SwaI-선형화 백본 플라스미드 pAd5 / ΔH5 (GL)과 상 동성 재조합 용 분해시켰다 -HVR5-그의 6. 이 도면에서, R1은 HVR1을 나타내고 R5가 HVR5이고, GL은 녹색 형광 단백질 (GFP)과 lucife를 나타내고새기다는 별도. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52655/52655fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" src="/files/ftp_upload/52655/52655fig2.jpg" /> 가의 바이러스 벡터의 캡시드의 표면에 결합 항원의 항원 노출 그림 2. 평가의 Ad5 / H5-HVR1-KWAS-HVR5-그의 통합 항원이 벡터에 노출 된 경우 ELISA를 결정하기 위해 실시 하였다 6. 전체 바이러스 벡터 표면은 자신의 항원 특성을 유지하면서. ELISA 플레이트 가의 벡터로 도포하고, 인간 단클론 항체 2F5 (A) 또는 마우스 단클론 항 - 그의 (B)와 함께 배양 하였다. 데이터가 아닌 제어 된 Ad5 벡터에, 가의 벡터로 항체의 상당한 결합을 나타내었다. R1은-KWAS-R5는 그의-6의 Ad5 / H5를 나타낸다-HVR1-KWAS-HVR5-그의 6. 웨스턴 블롯 분석은 가의 벡터에 혼입 항원 인간 단클론 항체 2F5 (C) 또는 마우스 단클론 항 - 그의 (D)의 결합 항원을 확인 하였다. 모두 (C)와 (D)에서, 레인 1의 Ad5을 나타내고, 레인 2는 표시의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52655/52655fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/52655/52655fig3.jpg" /> 의 Ad5-positve 혈청 체외. 중화 분석에 의해 중화을 탈출하는 이가 바이러스 벡터의 능력 그림 3. 평가 가의 벡터 중화 탈출 할 수 있는지 확인하기 위해 수행되었다. 결과는 혈청에서의 Ad5 바이러스의 중화를 지시하지만, ES체외에서 이가 바이러스의 중화 케이프. 이 그림에서, R1-KWAS-R5-그의 6의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6을 의미한다. 별표 (*) *** p 값 &lt;0.001을 나타낸다. <img alt="그림 4" src="/files/ftp_upload/52655/52655fig4.jpg" /> 마우스 모델에서 이가 바이러스 벡터에 의해 체액 성 면역의 생체 내 세대에서 그림 4. ELISA 세라 기반 가의 벡터의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6에 포함 된 단백질에 대한 체액 성 면역을 평가하는 데 사용되었다 . HIV-1 펩타이드 (A) 및 그의 펩타이드 (B)는 두 면역화 그룹의 마우스 혈청과 인큐베이션 별도로 ELISA 플레이트에 코팅 하였다 (의 Ad5과의 Ad5 / H5-HVR1-KWAS-HVR5-그의 6) . 데이터는 H에서 HIV-1 항원에 대한 체액 성 면역 반응의 중요한 발생을 표시VR1 (A) 및 그의 HVR5에서 태그 (B). 각각의 데이터 포인트는 수단과 팔 복제에서 SD를 나타냅니다. 별표 *** ** p 값 &lt;0.01를 나타내고, * p 값 &lt;0.05를 나타내고, p 값 &lt;0.001을 나타낸다.

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

여기서는 원리 증명 가의 아데노 바이러스 타입 5 (의 Ad5) 벡터를 생성하는 프로토콜을 제시의 Ad5 / H5-HVR1-KWAS HVR5-6-그의 항원 캡시드 혼입 전략을 이용하여. 이 벡터는 성적 체력을 나타내는 것으로 입증되었다, 기능은 통합 항원의 Ad5 양성 시험관 내에서 혈청 및 항원뿐만 아니라 면역 원성을 탈출.

아데노 바이러스 혈청 형 5 된 벡터 백신 접근 방법의 개발을위한 항원 캡시드-설립 전략을 활용

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

10.3K 조회수.  University of Alabama at Birmingham.  여기서는 원리 증명 가의 아데노 바이러스 타입 5 (의 Ad5) 벡터를 생성하는 프로토콜을 제시의 Ad5 / H5-HVR1-KWAS HVR5-6-그의 항원 캡시드 혼입 전략을 이용하여. 이 벡터는 성적 체력을 나타내는 것으로 입증되었다, 기능은 통합 항원의 Ad5 양성 시험관 내에서 혈청 및 항원뿐만 아니라 면역 원성을 탈출. 

비디오: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically &gt;80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

유전자 가족 걸어갔다 통해 공학 및 합성 Adeno-관련 바이러스의 진화 (AAV) 유전자 치료 벡터

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

연구

면역학 및 감염병학

Production and Purification of Non Replicative Canine Adenovirus Type 2 Derived Vectors

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 1010 infectious particles per ml and can be directly administrated in vivo.

These past 15 years, canine adenovirus type 2 (CAV2)-derived vectors have proven their efficiency to transduce cells in vitro&#160;and in vivo and are widely used for vaccination and gene therapy. Here, we describe a procedure to construct, produce and purify CAV2 vectors, giving rise to high-titer viral suspensions.

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the ...

Cloning and Large-Scale Production of High-Capacity Adenoviral Vectors Based on the Human Adenovirus Type 5

High-capacity adenoviral vectors (HCAdV) devoid of all viral coding sequences represent one of the most advanced gene delivery vectors due to their high packaging capacity (up to 35 kb), low immunogenicity, and low toxicity. However, for many laboratories the use of HCAdV is hampered by the complicated procedure for vector genome construction and virus production. Here, a detailed protocol for efficient cloning and production of HCAdV based on the plasmid pAdFTC containing the HCAdV genome is described. The construction of HCAdV genomes is based on a cloning vector system utilizing homing endonucleases (I-CeuI and PI-SceI). Any gene of interest of up to 14 kb can be subcloned into the shuttle vector pHM5, which contains a multiple cloning site flanked by I-CeuI and PI-SceI. After I-CeuI and PI-SceI-mediated release of the transgene from the shuttle vector the transgene can be inserted into the HCAdV cloning vector pAdFTC. Because of the large size of the pAdFTC plasmid and the long recognition sites of the used enzymes associated with strong DNA binding, careful handling of the cloning fragments is needed. For virus production, the HCAdV genome is released by NotI digest and transfected into a HEK293 based producer cell line stably expressing Cre recombinase. To provide all adenoviral genes for adenovirus amplification, co-infection with a helper virus containing a packing signal flanked by loxP sites is required. Pre-amplification of the vector is performed in producer cells grown on surfaces and large-scale amplification of the vector is conducted in spinner flasks with producer cells grown in suspension. For virus purification, two ultracentrifugation steps based on cesium chloride gradients are performed followed by dialysis. Here tips, tricks, and shortcuts developed over the past years working with this HCAdV vector system are presented.

A protocol for generation of high-capacity adenoviral vectors lacking all viral coding sequences is presented. Cloning of transgenes contained in the vector genome is based on homing endonucleases. Virus amplification in producer cells grown as adherent cells and in suspension relies on a helper virus providing viral genes in trans.

인간 아데노 바이러스 유형 5를 기반으로 대용량 아데노 바이러스 벡터의 클로닝 및 대규모 생산

High-capacity adenoviral vectors (HCAdV) devoid of all viral coding sequences represent one of the most advanced gene delivery vectors due to their high ...

생체공학

An Efficient Method for Adenovirus Production

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types and organs. However, recombinant adenoviral technology is laborious, time-consuming, and expensive. Here, we present an improved protocol using the pAdEasy system to obtain purified adenoviral particles that can induce a strong green fluorescent protein (GFP) expression in transduced cells. The advantages of this improved method are faster preparation and decreased production cost compared to the original method developed by Bert Vogelstein. The main steps of the adenoviral technology are: (1) the recombination of pAdTrack-GFP with the pAdEasy-1 plasmid in BJ5183 bacteria; (2) the packaging of the adenoviral particles; (3) the amplification of the adenovirus in AD293 cells; (4) the purification of the adenoviral particles from cell lysate and culture medium; and (5) the viral titration and functional testing of the adenovirus. The improvements to the original method consist of (i) the recombination in BJ5183-containing pAdEasy-1 by chemical transformation of bacteria; (ii) the selection of recombinant clones by &#8220;negative&#8221; and &#8220;positive&#8221; PCR; (iii) the transfection of AD293 cells using the K2 transfection system for adenoviral packaging; (iv) the precipitation with ammonium sulfate of the viral particles released by AD293 cells in cell culture medium; and (v) the purification of the virus by one-step cesium chloride discontinuous gradient ultracentrifugation. A strong expression of the gene of interest (in this case, GFP) was obtained in different types of transduced cells (such as hepatocytes, endothelial cells) from various sources (human, bovine, murine). Adenoviral-mediated gene transfer represents one of the main tools for developing modern gene therapies.

Here, we present a protocol for adenovirus production using the pAdEasy system. The technology includes the recombination of the pAdTrack and pAdEasy-1 plasmids, the adenovirus packaging and amplification, the purification of the adenoviral particles from cell lysate and culture medium, the viral titration, and the functional testing of the adenovirus.

아데노바이러스 생산을 위한 효율적인 방법

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types ...

Production, Purification, and Quality Control for Adeno-associated Virus-based Vectors

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), including gene therapy applications. AAV vectors are non-replicating, able to infect both dividing and non-dividing cells&#160;and provide long-term transgene expression. Importantly, some serotypes, such as the newly described PHP.B, can cross the blood-brain-barrier (BBB) in animal models, following systemic delivery. AAV vectors can be efficiently produced in the laboratory. However, robust and reproducible protocols are required to obtain AAV vectors with sufficient purity levels and titer values high enough for in vivo applications. This protocol describes an efficient and reproducible strategy for AAV vector production, based on an iodixanol gradient purification strategy. The iodixanol purification method is suitable for obtaining batches of high-titer AAV vectors of high purity, when compared to other purification methods. Furthermore, the protocol is generally faster than other methods currently described. In addition, a quantitative polymerase chain reaction (qPCR)-based strategy is described for a fast and accurate determination of the vector titer, as well as a silver staining method to determine the purity of the vector batch. Finally, representative results of gene delivery to the CNS, following systemic administration of AAV-PHP.B, are presented. Such results should be possible in all labs using the protocols described in this article.

Here, we describe an efficient and reproducible strategy to produce, titer, and quality-control batches of adeno-associated virus vectors. It allows the user to obtain a vector preparation with high-titer&#160;(&#8805;1 x 1013 vector genomes/mL) and a high purity, ready for in vitro or in vivo use.

생산, 정화, 및 Adeno 관련 바이러스 기반 벡터에 대 한 품질 관리

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), ...

신경과학

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.

아데노 관련 바이러스(AAV) 캡시드 변이체의 엔지니어링, 바코드 및 스크리닝을 통한 차세대 유전자 치료 벡터의 분리

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by ...

Detection of Neutralization-sensitive Epitopes in Antigens Displayed on Virus-Like Particle (VLP)-Based Vaccines Using a Capture Assay

The virus-like particle (VLP) capture assay is an immunoprecipitation method, commonly known as a &#39;pull-down assay&#39; used to purify and isolate antigen-displaying VLPs. Surface antigen-specific antibodies are coupled to, and thus immobilized on a solid and insoluble matrix such as beads. Due to their high affinity to the target antigen, these antibodies can capture VLPs decorated with the cognate antigen anchored in the membrane envelope of the VLPs. This protocol describes the binding of antigen-specific antibodies to protein A- or G-conjugated magnetic beads. In our study, human immunodeficiency virus (HIV)-derived VLPs formed by the group-specific antigen (Gag) viral core precursor protein p55 Gag and displaying the envelope glycoproteins (Env) of HIV are examined. The VLPs are captured utilizing broadly neutralizing antibodies (bNAbs) directed against neutralization-sensitive epitopes in Env. The VLP capture assay outlined here represents a sensitive and easy-to-perform method to demonstrate that (i) the VLPs are decorated with the respective target antigen, (ii) the surface antigen retained its structural integrity as demonstrated by the epitope-specific binding of bNAbs used in the assay and (iii) the structural integrity of the VLPs revealed by the detection of Gag proteins in a subsequent Western blot-analysis. Consequently, the utilization of bNAbs for immunoprecipitation facilitates a prediction of whether VLP vaccines will be able to elicit a neutralizing B cell response in vaccinated humans. We anticipate that this protocol will furnish other researchers with a valuable and straightforward experimental approach to examine potential VLP-based vaccines.

Detection of Neutralization-sensitive Epitopes in Antigens Displayed on Virus-Like Particle VLP-Based Vaccines Using a Capture Assay

Here, we present a protocol to detect neutralization epitopes on antigen-displaying virus-like particles (VLPs). Immunoprecipitation of the human immunodeficiency virus (HIV)-derived VLPs is performed using envelope glycoproteins-specific monoclonal antibodies coupled to protein G-conjugated magnetic beads. Captured VLPs are subsequently subjected to SDS-PAGE and Western blot-analysis employing viral core protein Gag-specific antibodies.

포획 분석기를 사용하여 바이러스와 같은 입자(VLP) 기반 백신에 표시되는 항원에서 중화에 민감한 에피토프 검출

The virus-like particle (VLP) capture assay is an immunoprecipitation method, commonly known as a &#39;pull-down assay&#39; used to purify and isolate ...

Construction of Adenoviral Vectors using DNA Assembly Technology

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an adenoviral vector by manipulating the genomic DNA of wild-type HAdV-7 by using a DNA assembly method. First, an infectious clone of HAdV-7, pKan-Ad7, was generated by fusing the viral genomic DNA with a PCR product from plasmid backbone, comprising of the kanamycin-resistant gene and the origin of replication (Kan-Ori), through DNA assembly. This was done by designing a pair of PCR primers, that contained ~25 nucleotides of the terminal sequence of HAdV-7 inverted terminal repeat (ITR) at the 5' end, a non-cutter restriction enzyme site for HAdV-7 genome in the middle, and a template-specific sequence for PCR priming at the 3' end. Second, an intermediate plasmid-based strategy was employed to replace the E3 region with transgene-expressing elements in the infectious clone to generate an adenoviral vector. Briefly, pKan-Ad7 was digested with dual-cutter restriction enzyme Hpa I, and the fragment containing the E3 region was ligated to another PCR product of plasmid backbone by Gibson assembly to construct an intermediate plasmid pKan-Ad7HpaI. For convenience, restriction-assembly was used to designate the plasmid cloning method of combined restriction digestion and assembly. Using restriction-assembly, the E3 genes in pKan-Ad7HpaI was replaced with a green fluorescent protein (GFP) expression cassette, and the modified E3 region was released from the intermediate plasmid and restored to the infectious clone to generate an adenoviral plasmid pKAd7-E3GFP. Finally, pKAd7-E3GFP was linearized by Pme I digestion and used to transfect HEK293 packaging cells to rescue recombinant HAdV-7 virus. To conclude, a DNA assembly-based strategy was introduced here for constructing adenoviral vectors in general laboratories of molecular biology without the need of specialized materials and instruments.

In this study, an infectious clone of human adenovirus type 7 (HAdV-7) was constructed, and an E3-deleted HAdV-7 vector system was established by modifying the infectious clone. This strategy used here can be generalized to make gene transfer vectors from other wild-type adenoviruses.

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an ...

Single-Step Heparin Affinity Chromatography를 이용한 AAV 벡터 정제

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

저자 스포트라이트: Adeno-Associated Viral Vectors의 생산 및 정제를 위한 개선된 방법

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

단일 단계 및 반자동 Heparin Affinity Chromatography Protocol을 통한 Adeno-associated viral vectors 분리

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

아데노 바이러스 혈청 형 5 된 벡터 백신 접근 방법의 개발을위한 항원 캡시드-설립 전략을 활용

요약

더 많은 비디오 탐색

이 비디오의 챕터

유전자 가족 걸어갔다 통해 공학 및 합성 Adeno-관련 바이러스의 진화 (AAV) 유전자 치료 벡터

Production and Purification of Non Replicative Canine Adenovirus Type 2 Derived Vectors

인간 아데노 바이러스 유형 5를 기반으로 대용량 아데노 바이러스 벡터의 클로닝 및 대규모 생산

아데노바이러스 생산을 위한 효율적인 방법

생산, 정화, 및 Adeno 관련 바이러스 기반 벡터에 대 한 품질 관리

아데노 관련 바이러스(AAV) 캡시드 변이체의 엔지니어링, 바코드 및 스크리닝을 통한 차세대 유전자 치료 벡터의 분리

포획 분석기를 사용하여 바이러스와 같은 입자(VLP) 기반 백신에 표시되는 항원에서 중화에 민감한 에피토프 검출

Construction of Adenoviral Vectors using DNA Assembly Technology

단일 단계 및 반자동 Heparin Affinity Chromatography Protocol을 통한 Adeno-associated viral vectors 분리

단일 단계 및 반자동 Heparin Affinity Chromatography Protocol을 통한 Adeno-associated viral vectors 분리