This work was supported in part by National Institutes of Health grants 5T32AI7493-20 and&#160;5R01AI089337-03. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

The University of Alabama at Birmingham Institutional Animal Use and Care Committee approved the use of mice as described herein under the approved protocol number 101109272.
1. Genetic Construction of a Modified Plasmid pAd5/H5-HVR1-KWAS-HVR5-His 6 with the Antigen Capsid-Incorporation Strategy
<ol>
	<li>Construction of the shuttle plasmid HVR1-KWAS-HVR5-His6/pH5S
	<ol>
		<li>Order a plasmid containing the synthesized DNA sequence HVR1-KWAS between the restriction enzyme sites AgeI to AccI of hexon5 gene.</li>
		<li>Digest 6 &#181;g of the synthesized fragment (HVR1-KWAS) with the enzymes AgeI (6 units) and AccI (6 units) for 3 hrs at 37 &#176;C. Resolve the digested fragment in a 2% agarose gel by electrophoresis, and purify the fragment with a DNA gel extraction kit according to the manufacturer&#8217;s protocol.</li>
		<li>Based on the molar ratio of insert to vector at 3 : 1, use T4 DNA ligase and ligase buffer to ligate 12 ng of the fragment (HVR1-KWAS) into 100 ng of a previously constructed shuttle plasmid HVR5-His6/pH5S17 in a 10 &#181;l volume at RT for 2 hr, via the sites of AgeI and AccI.</li>
		<li>Transform 1 &#181;l out of 10 &#181;l of the ligation product into 50 &#181;l of electrocompetent DH5&#945; cells in an electroporator (at 1800 V). Add 950 &#181;l of SOC medium to the transformed DH5&#945; cells and incubate the mixture for 1 hr at 37 &#176;C, with 300 rpm. Spread 100-200 &#181;l of the 1 ml mixture on the Luria-Bertani (LB) agar containing kanamycin and incubate O/N at 37 &#176;C.
		<ol>
			<li>To screen ~ 10 colonies by PCR targeting the fragment HVR1-KWAS, mix the forward primer (TATGTGTGTCATGTATGCGT), reverse primer (GGAGGCCCACTTGTCCAGCTC) and a single DH5&#945; colony into a PCR master mix solution (according to manufacturer&#8217;s protocol). Run samples on a thermocycler by referring to the manual provided with the PCR master mix solution.</li>
			<li>Use the forward primer (TATGTGTGTCATGTATGCGT) to sequence the fragment HVR1-KWAS in the clones screened in the section 1.1.4.1.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Construction of the plasmid pAd5/H5-HVR1-KWAS-HVR5-His6
	<ol>
		<li>Digest 6 &#181;g of HVR1-KWAS-HVR5-His6/pH5S with enzymes EcoRI (6 units) and PmeI (6 units) for 3 hrs at 37 &#176;C, and purify the fragment containing homologous recombination arms and the dual modified hexon5 gene, as stated in step 1.1.2. Linearize the backbone plasmid pAd5/&#8710;H5 (GL)16 with SwaI.</li>
		<li>Co-transform 100 ng of the target fragment from the shuttle plasmid and 100 ng of the linearized pAd5/&#8710;H5 (GL) backbone into 50 &#181;l of electrocompetent BJ5183 cells for the homologous recombination in an electroporator (at 1800 V). Add 950 &#181;l of SOC medium to the transformed cells and incubate the mixture for 1 hr at 37 &#176;C, 300 rpm. Spread 100 - 200 &#181;l of the 1 ml mixture on the LB agar containing kanamycin (final 50 &#181;g/ml) for O/N incubation at 37 &#176;C.
		<ol>
			<li>Pick ~10 tiny colonies into 3 ml liquid LB containing kanamycin (final 50 &#181;g/ml) for O/N incubation at a shaker (250 rpm, 37&#176;C). Extract plasmids from the culture. Use PCR analysis to screen the 10 colonies by targeting the fragment HVR1-KWAS, as illustrated in step 1.1.4.1.</li>
			<li>To screen the same colonies by PCR analysis targeting the pIX fragment of the backbone genome, mix the forward primer (AGCTGTTGGATCTGCGCCAGCAGGTT), reverse primer (CCAAACAGAGTCTGGTTTTTTATTTAT) and a single BJ5183 colony into a PCR master mix solution (according to manufacturer&#8217;s protocol). Run samples on a thermocycler by referring to the manual provided with the PCR master mix solution.</li>
			<li>Designate the PCR double-positive colonies as pAd5/H5-HVR1-KWAS-HVR5-His6.</li>
		</ol>
		</li>
		<li>Transform 100 ng of the plasmid pAd5/H5-HVR1-KWAS-HVR5-His6 into DH5&#945; cells as illustrated in step 1.1.4.
		<ol>
			<li>Use PCR analysis to screen ~ 10 colonies by targeting the fragment HVR1-KWAS, as illustrated in step 1.1.4.1.</li>
			<li>Use PCR analysis to screen the same colonies by targeting the pIX fragment of the backbone genome, as illustrated in step 1.2.2.2.</li>
			<li>Use the forward primer (TATGTGTGTCATGTATGCGT) to sequence the fragment HVR1-KWAS in pAd5/H5-HVR1-KWAS-HVR5-His6.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Preparation of Modified Ad5 Viral Vector Ad5/H5-HVR1-KWAS-HVR5-His 6
<ol>
	<li>Constitute the complete medium by adding FBS (final 10%), 100X Non-Essential Amino Acids (final 0.1 mM), 200 mM L-glutamine (final 2 mM) and penicillin/streptomycin solution (final 1%) into DMEM with high glucose. Maintain human embryonic kidney (HEK293) cells in complete medium in a culture incubator (37 &#176;C and 5% CO2 under 85% humidified conditions).</li>
	<li>Rescue of viral vector Ad5/H5-HVR1-KWAS-HVR5-His6
	<ol>
		<li>Seed 3.0 x 106 of the HEK293 cells in one T-25 flask containing 5 ml of complete medium and culture O/N to achieve a monolayer with 80% confluence.</li>
		<li>Linearize 15 &#181;g of pAd5/H5-HVR1-KWAS-HVR5-His6 in a 100 &#181;l volume with restriction enzyme PacI (15 units) at 37 &#176;C for 3 hrs.
		<ol>
			<li>Extract linearized pAd5/H5-HVR1-KWAS-HVR5-His6 by centrifuging the reaction twice (10,000 x g for 1 min) with an equal volume of phenol:chloroform:isoamyl alcohol (ratio at 25 : 24 : 1) in a fume hood, and by sequential centrifugation (10,000 x g for 10 min) with a mixed solution (300 &#181;l of 100% ethanol and 10 &#181;l of sodium acetate) and 700 &#181;l of 70% ethanol. Discard supernatant at each centrifugation step.</li>
		</ol>
		</li>
		<li>Resuspend the purified plasmid in ~ 40 &#181;l of distilled water or Tris-EDTA (TE) buffer. Quantitate the plasmid DNA by measuring the optical density (OD) at 260 nm.</li>
		<li>Transfect 3 &#181;g of the linearized plasmid with commercial liposomal transfection reagent in the T-25 flask, according to the manufacturer&#8217;s manual. Change the transfection medium with complete medium at 6 hrs post-transfection and subsequent incubation in the culture incubator. Maintain transfected cells by replacing complete medium every two to three days, until individual viral plaques form.</li>
		<li>When plaques develop to full cytopathic effect (CPE), scrape the remaining cells off the flask in a sterile hood, and harvest cell lysate by centrifuging medium at 300 x g for 10 min at 4 &#176;C. Suspend the cell pellet in ~1 ml of medium containing 2% FBS, and break cells by freeze-thawing four times. Collect the supernatant containing rescued virus after centrifuging lysate at 10,000 x g for 10 min at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Large scale propagation of the viral vector Ad5/H5-HVR1-KWAS-HVR5-His6
	<ol>
		<li>Propagate the virus in a T-75 flask containing HEK293 cells in the sterile hood by infecting with 1/3 to full lysate from the T-25 flask. Allow full CPE to develop within two to three days in the culture incubator. Harvest the lysate supernatant as stated in step 2.2.5.</li>
		<li>Propagate the virus in one to three T-175 flasks in the sterile hood by infecting with 1/2 to full lysate from the T-75 flask, depending on the virus propagation conditions. Allow full CPE to develop within two to three days in the culture incubator. Harvest the lysate supernatant as stated in step 2.2.5.</li>
		<li>Propagate the virus in one dozen or more T-175 flasks in the sterile hood by infecting with 1/2 to full lysate from the previous T-175 flask(s). Determine the amount of flask usage based on the virus propagation conditions and the amount of virus in need. Harvest the lysate supernatant as stated in step 2.2.5 when full CPE occurs within two to three days in the culture incubator.</li>
	</ol>
	</li>
	<li>Purification of Ad5/H5-HVR1-KWAS-HVR5-His6 by caesium chloride
	<ol>
		<li>Prepare two densities of CsCl solutions in 5 mM HEPES: 1.33 g/ml and 1.45 g/ml, while avoiding contact with CsCl.</li>
		<li>Load 4 ml of CsCl (1.33 g/ml) in a sterile ultracentrifuge tube, and gently load 4 ml of CsCl (1.45 g/ml) against bottom of the tube. Load 4 ml of lysate supernatant slowly on top of the gradients in the sterile hood.</li>
		<li>Centrifuge the tube at 110,000 x g for 3 hrs at 4 &#176;C to separate the mature/lower virus band from the defective/higher virus band. Collect the lower band using a 3 ml syringe armed with a 33 G needle and dilute the band with 5 mM HEPES to a 4 ml volume in the sterile hood.</li>
		<li>Load another tube with two densities of CsCl solutions and the diluted band of virus as described in step 2.4.2. Centrifuge the tube at 110,000 x g O/N at 4 &#176;C. Collect the viral band as described in step 2.4.3.</li>
		<li>Inject the collected virus solution in a dialysis cassette by a 3 ml syringe armed with a 33 G needle in the sterile hood.</li>
		<li>Place the cassette in 700 ml of 1x dialysis buffer (1 L&#160;recipe: 100 ml of 10x PBS, 100 ml of 100% glycerol and 800 ml of distilled water; filter the buffer through a 0.22 &#181;m filter) and replace the dialysis buffer every 3 hrs for 4 times. Aspirate out dialyzed virus solution using needled syringe.</li>
	</ol>
	</li>
</ol>
3. Validation of the Rescued Viral Vector
<ol>
	<li>Viral Vector Titrations
	<ol>
		<li>For the virus physical titer, dilute both virus and dialysis buffer (background control) at 1 : 10 and 1 : 20 in virus lysis buffer (10% SDS in Tris-EDTA) in small tubes, and incubate all tubes at 56 &#176;C for 10 min.</li>
		<li>Turn on a biophotometer and set the mode of absorbance at OD 260 nm. Use the diluted dialysis buffer (1 : 10) to balance the background signal by clicking the &#8220;blank&#8221; bottom. Type &#34;10 + 90&#34; in the biophotometer screen, and read the signal of the diluted virus (1 : 10).</li>
		<li>Read the signal of the diluted virus (1 : 20) by following the method in step 3.1.2, but instead type &#34;5 + 95&#34; in the biophotometer screen. Multiply the two virus readout numbers by 1.1x1012 and calculate the average titer with a unit as VP/ml, based on the two individual titers from the two dilutions.</li>
		<li>For the virus infectious titer (IP/ml), use the KARBER statistical TCID50 method14 to determine the infection depth on HEK293 cells at 10 days post infection (d.p.i.)</li>
	</ol>
	</li>
	<li>Evaluation of antigenic exposure display on the viral vector
	<ol>
		<li>Coat the viral vector in an ELISA plate and proceed with the rest of steps in a standard ELISA method14. Use human anti-gp41 (2F5) monoclonal antibody (mAb) and mouse anti-His tag mAb for the detection of corresponding incorporated antigens14.</li>
		<li>Resolve the viral vector in a denatured protein gel electrophoresis (SDS-PAGE) and proceed with the rest of steps in a standard western-blot method14. Use human anti-gp41 (2F5) monoclonal antibody (mAb) and mouse anti-His tag mAb for the detection of corresponding incorporated antigens14.</li>
	</ol>
	</li>
	<li>In vitro evaluation of the vector on the ability to bypass Ad5-positve sera
	<ol>
		<li>Maintain HeLa cells in complete medium in the culture incubator (37 &#176;C and 5% CO2 under 85% humidified conditions). Constitute the complete medium by adding FBS (final 10%), 200 mM L-glutamine (final 2 mM) and penicillin/streptomycin solution (final 1%) into Minimum Essential Medium Eagle (MEME).</li>
		<li>Seed HeLa cells in 6-well plates at 1x106 cells/well, and incubate the plates in the culture incubator (37 &#176;C and 5% CO2 under 85% humidified conditions) for 2 hrs. Incubate Ad5-positive sera (0.1 &#181;l or 0 &#181;l) with 5 IP/cell of viral vector (Ad5 or Ad5/H5-HVR1-KWAS-HVR5-His6) in the culture incubator for 1 hr before adding the mixtures onto the 6-well plates containing cells.</li>
		<li>At 24 hrs post infection (h.p.i.), rinse cells once with PBS and lyse cells in 0.5 ml of lysis buffer. Centrifuge at 15,000 x g for 5 min and collect the supernatant. Mix 20 &#181;l of the supernatant with 100 &#181;l of luciferase substrate for the luciferase signal reading, since viruses contain the luciferase gene.</li>
	</ol>
	</li>
</ol>
4. Immunological Evaluation of the Rescued Viral Vector
<ol>
	<li>Prepare two immunization groups: Ad5 and Ad5/H5-HVR1-KWAS-HVR5-His6.
	<ol>
		<li>Inject mice (n = 8/group) intramuscularly with viruses at 1x1010 VP/mouse, in a homologous &#8220;prime-boost&#8221; immunization regimen, with an interval of 2 weeks.</li>
		<li>At 2 weeks post every injection, bleed mice without anesthesia by cheek bleeding with animal lancets (5 mm tip length) to collect blood in 1.5 ml tubes.</li>
	</ol>
	</li>
	<li>Mix the blood in the tubes by inverting up and down, and incubate the blood at RT for 30 min. Spin the tubes at 10,000 x g for 5 min at 4 &#176;C and transfer sera (top layer) to new 1.5 ml tubes.
	<ol>
		<li>Spin the new tubes at 10,000 x g for 5 min at 4 &#176;C and transfer sera to newly marked 1.5 ml tubes for storage at -80 &#176;C.</li>
	</ol>
	</li>
	<li>Evaluation of antigen-specific humoral immunity by sera-based ELISA
	<ol>
		<li>Dilute His peptide (stock at 1 mM) and HIV-1 peptide (stock at 1 mM) separately in 100.</li>
		<li>mM carbonate buffer (pH 9.5) to achieve the peptide coating concentration at 10 &#181;M. Coat the ELISA plates with the diluted peptides separately by adding 100 &#181;l per well and incubating the plates O/N at 4 &#176;C.</li>
		<li>Wash the plates with PBST for four times at 200 &#181;l/well and block for 1 hr in 5% BSA in PBST. Apply mice sera to the plates at 1 : 100 dilution in the blocking buffer, 100 &#181;l/well. Incubate for 2 hr incubation at RT.</li>
		<li>Wash the plates with PBST for four times. Block the plates by incubating at RT for 30 min&#160;in the blocking buffer at 100 &#181;l/well.</li>
		<li>Apply goat anti-mouse IgG-HRP (1:5000 in the blocking buffer) at 100 &#181;l/well to both the plates coated with His peptide and HIV-1 peptide individually. Incubate for 2 hr at RT. Wash the plates with PBST.</li>
		<li>Read the plates at OD450 nm after incubating with HRP substrate for 30 min.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Cheng, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coexpression+of+the+simian+immunodeficiency+virus+Env+and+Rev+proteins+by+a+recombinant+human+adenovirus+host+range+mutant.">Coexpression of the simian immunodeficiency virus Env and Rev proteins by a recombinant human adenovirus host range mutant.</a> Journal of virology. 66, 6721-6727 (1992).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+antigen+incorporation+within+adenovirus+hexon+hypervariable+2+for+a+novel+HIV+vaccine+approach.">HIV antigen incorporation within adenovirus hexon hypervariable 2 for a novel HIV vaccine approach.</a> PloS one. 5, e11815 (2010).</li><li>DeMatteo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-lasting+adenovirus+transgene+expression+in+mice+through+neonatal+intrathymic+tolerance+induction+without+the+use+of+immunosuppression.">Long-lasting adenovirus transgene expression in mice through neonatal intrathymic tolerance induction without the use of immunosuppression.</a> Journal of virology. 71, 5330-5335 (1997).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+adenovirus-based+vector+elicits+a+specific+humoral+immune+response+against+the+V3+loop+of+HIV-1+gp120+in+mice+through+the+'Antigen+Capsid-Incorporation'+strategy.">A recombinant adenovirus-based vector elicits a specific humoral immune response against the V3 loop of HIV-1 gp120 in mice through the 'Antigen Capsid-Incorporation' strategy.</a> Virology journal. 11, 112 (2014).</li><li>Matthews, Q. L., Krendelchtchikov, A. L. G., Li, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+Vectors+for+Vaccine+Development.">Viral Vectors for Vaccine Development.</a> INTECH. , (2013).</li><li>Tang, D. C., Zhang, J., Toro, H., Shi, Z., Van Kampen, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+as+a+carrier+for+the+development+of+influenza+virus-free+avian+influenza+vaccines.">Adenovirus as a carrier for the development of influenza virus-free avian influenza vaccines.</a> Expert review of vaccines. 8, 469-481 (2009).</li><li>Flatt, J. W., Kim, R., Smith, J. G., Nemerow, G. R., Stewart, P. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+intrinsically+disordered+region+of+the+adenovirus+capsid+is+implicated+in+neutralization+by+human+alpha+defensin+5.">An intrinsically disordered region of the adenovirus capsid is implicated in neutralization by human alpha defensin 5.</a> PloS one. 8, e61571 (2013).</li><li>Bradley, R. R., Lynch, D. M., Iampietro, M. J., Borducchi, E. N., Barouch, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5+neutralizing+antibodies+target+both+hexon+and+fiber+following+vaccination+and+natural+infection.">Adenovirus serotype 5 neutralizing antibodies target both hexon and fiber following vaccination and natural infection.</a> Journal of virology. 86, 625-629 (2012).</li><li>Zaiss, A. K., Machado, H. B., Herschman, H. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+innate+and+pre-existing+immunity+on+adenovirus+therapy.">The influence of innate and pre-existing immunity on adenovirus therapy.</a> Journal of cellular biochemistry. 108, 778-790 (2009).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+and+CD8++T+lymphocytes+both+contribute+to+immunity+to+adenovirus+serotype+5+vaccine+vectors.">Neutralizing antibodies and CD8+ T lymphocytes both contribute to immunity to adenovirus serotype 5 vaccine vectors.</a> Journal of virology. 78, 2666-2673 (2004).</li><li>Sumida, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neutralizing+antibodies+to+adenovirus+serotype+5+vaccine+vectors+are+directed+primarily+against+the+adenovirus+hexon+protein.">Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein.</a> Journal of immunology. 174, 7179-7185 (2005).</li><li>Bradley, R. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+serotype+5-specific+neutralizing+antibodies+target+multiple+hexon+hypervariable+regions.">Adenovirus serotype 5-specific neutralizing antibodies target multiple hexon hypervariable regions.</a> Journal of virology. 86, 1267-1272 (2012).</li><li>Gahery-Segard, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+response+to+recombinant+capsid+proteins+of+adenovirus+in+humans:+antifiber+and+anti-penton+base+antibodies+have+a+synergistic+effect+on+neutralizing+activity.">Immune response to recombinant capsid proteins of adenovirus in humans: antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity.</a> Journal of virology. 72, 2388-2397 (1998).</li><li>Gu, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+multivalent+adenoviral+vectors+for+HIV+vaccination.">Using multivalent adenoviral vectors for HIV vaccination.</a> PloS one. 8, e60347 (2013).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+against+enterovirus+71+with+neutralizing+epitope+incorporation+within+adenovirus+type+3+hexon.">Protection against enterovirus 71 with neutralizing epitope incorporation within adenovirus type 3 hexon.</a> PloS one. 7, e41381 (2012).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+adenovirus+serotype+5+packaged+by+serotype+3+hexon.">Construction and characterization of adenovirus serotype 5 packaged by serotype 3 hexon.</a> Journal of virology. 76, 12775-12782 (2002).</li><li>Wu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+sites+in+adenovirus+hexon+for+foreign+peptide+incorporation.">Identification of sites in adenovirus hexon for foreign peptide incorporation.</a> Journal of virology. 79, 3382-3390 (2005).</li><li>Qiu, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-specific+neutralizing+antibody+epitopes+of+human+adenovirus+type+3+(HAdV-3)+and+HAdV-7+reside+in+multiple+hexon+hypervariable+regions.">Serotype-specific neutralizing antibody epitopes of human adenovirus type 3 (HAdV-3) and HAdV-7 reside in multiple hexon hypervariable regions.</a> Journal of. 86, 7964-7975 (2012).</li><li>Parker, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fine+definition+of+the+epitope+on+the+gp41+glycoprotein+of+human+immunodeficiency+virus+type+1+for+the+neutralizing+monoclonal+antibody+2F5.">Fine definition of the epitope on the gp41 glycoprotein of human immunodeficiency virus type 1 for the neutralizing monoclonal antibody 2F5.</a> Journal of virology. 75, 10906-10911 (2001).</li><li>Farrow, A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunization+with+Hexon+Modified+Adenoviral+Vectors+Integrated+with+gp83+Epitope+Provides+Protection+against+Trypanosoma+cruzi+Infection.">Immunization with Hexon Modified Adenoviral Vectors Integrated with gp83 Epitope Provides Protection against Trypanosoma cruzi Infection.</a> PLoS neglected tropical diseases. 8, e3089 (2014).</li><li>Krause, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitopes+expressed+in+different+adenovirus+capsid+proteins+induce+different+levels+of+epitope-specific+immunity.">Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope-specific immunity.</a> Journal of virology. 80, 5523-5530 (2006).</li><li>Omori, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+a+fiber+protein+in+an+adenovirus+vector+improves+in+vitro+gene+transfer+efficiency+to+the+mouse+microglial+cell+line.">Modification of a fiber protein in an adenovirus vector improves in vitro gene transfer efficiency to the mouse microglial cell line.</a> Neuroscience letters. 324, 145-148 (2002).</li><li>Dmitriev, I. P., Kashentseva, E. A., Curiel, D. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+adenovirus+vectors+containing+heterologous+peptide+sequences+in+the+C+terminus+of+capsid+protein+IX.">Engineering of adenovirus vectors containing heterologous peptide sequences in the C terminus of capsid protein IX.</a> Journal of virology. 76, 6893-6899 (2002).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+a+recombinant+human+adenovirus+type+3+vector+containing+two+foreign+neutralizing+epitopes+in+hexon.">Construction and characterization of a recombinant human adenovirus type 3 vector containing two foreign neutralizing epitopes in hexon.</a> Virus research. 183, 67-74 (2014).</li><li>Tian, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+human+adenovirus+serotype+3+packaged+by+serotype+7+hexon.">Construction and characterization of human adenovirus serotype 3 packaged by serotype 7 hexon.</a> Virus research. 160, 214-220 (2011).</li><li>Kim, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+adenovirus+vector+incorporating+carbohydrate+binding+domains+utilizes+glycans+for+gene+transfer.">An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.</a> PloS one. 8, e55533 (2013).</li><li>Vasconcelos, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen-induced+proapoptotic+phenotype+and+high+CD95+(Fas)+expression+accompany+a+suboptimal+CD8++T-cell+response:+reversal+by+adenoviral+vaccine.">Pathogen-induced proapoptotic phenotype and high CD95 (Fas) expression accompany a suboptimal CD8+ T-cell response: reversal by adenoviral vaccine.</a> PLoS pathogens. 8, e1002699 (2012).</li><li>Matthews, Q. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+incorporation+of+a+herpes+simplex+virus+type+1+thymidine+kinase+and+firefly+luciferase+fusion+into+the+adenovirus+protein+IX+for+functional+display+on+the+virion.">Genetic incorporation of a herpes simplex virus type 1 thymidine kinase and firefly luciferase fusion into the adenovirus protein IX for functional display on the virion.</a> Molecular imaging. 5, 510-519 (2006).</li></ol>

The authors have nothing to disclose.

The application of the traditional transgene strategy on Ad5 modification for the development of vaccines has been diminished primarily due to the bottleneck associated with the Ad5 PEI4,6. This bottleneck can be partially diminished by application of the alternative Antigen Capsid-Incorporation strategy (Figure 1A), since this strategy can evade neutralization by Ad5 NAbs by replacing neutralizing epitopes of Ad5 with antigens-of-interest, and facilitate the generation of robust immunity to the incorporated antigens-of-interest. In this study, the generation of the modified divalent viral vector Ad5/H5-HVR1-KWAS-HVR5-His6 was introduced as a conceptual example (Figure 1B). Corresponding to the protocol section 1.1.1, the synthesized fragment in the ordered plasmid contains an HIV-1 gp41 short gene substitution in the HVR1 locale of hexon5. The partial gp41 gene encodes an epitope ELDKWAS, which substitutes partial HVR1 from the amino acids 139 to 144 of hexon514. ELDKWAS is a potent neutralizing epitope in HIV-1 gp4119.
During the cloning, there were two critical steps. One step was the selection of two restriction enzymes when synthesizing the gene fragment interest in the protocol section 1.1.1. The selection of the two enzymes conditionally depends on the location of Ad capsid to be modified, i.e., in this study, gene fragment containing KWAS was designated to incorporate into HVR1 of hexon5 protein. Restriction enzymes AgeI and AccI exist separately at N-terminal and C-terminal flanking areas of the HVR1 locale, and do not exist in the fragment HVR1-KWAS, thus AgeI and AccI were chosen to be individually put at N-terminus and C-terminus of the synthesized fragment HVR1-KWAS. Since hexon is the major target of Ad NAbs, and hexon-specific neutralizing epitopes reside in all HVRs of hexon12,18, it is feasible that the hexon modified Ad5 vectors with the Antigen Capsid-Incorporation strategy could gain the ability to bypass the neutralization by Ad5-positive sera in vitro, and even the Ad5 PEI in host. In this study, both HVR1 and HVR5 on the divalent viral vector could contribute to the escape of neutralization by the Ad5-positive sera. The other critical step was in the protocol section 1.2.2. After the O/N incubation of co-transformed mixture on LB agar, the grown BJ5183 colonies need to be immediately cultured in liquid LB for O/N, and plasmids need to be immediately extracted from the BJ5183 cells as well. Delaying the procedures will likely lead to potential recombination and mutations, since the recombined plasmid in the BJ5183 cells is not stable. The correct plasmid from the homologous recombination needs to be transformed into DH5&#945; in order to maintain a stable and correct genome species.
After the cloning, there were two more critical steps. The first step in the protocol section is about transfection. It is necessary to transfect the recombined Ad backbone plasmid into cells that express Ad5 E1 (HEK293), if the backbone plasmid is E1 gene deleted. The other step in the protocol section 2.3 is about virus upscaling. The basic procedure for virus upscaling follows the principle of standard virus upscaling from a T-25 flask to T-75 flasks and to T-175 flasks. However the number of the flasks (T-75 and/or T-175) for use depends on the growth speed of the virus, the CPE development caused by the virus infection, and the amount of virus needed.
The Antigen Capsid-Incorporation strategy allows for broad application on Ad modifications. With this strategy, it is feasible to modify or incorporate heterologous antigens on different capsid major proteins, such as hexon2,4,20, penton base21 and fiber22. The capsid minor protein pIX C terminus also showed promise for the heterologous antigen/peptide incorporation21,23. Besides the single modification, multiple modifications on Ad with this strategy also achieved success. Examples are the generation of divalent Ad5/H5-HVR1-KWAS-HVR5-His6 in this study by incorporations in both HVR1 and HVR5 of hexon5, and the incorporation of two neutralizing epitopes of enterovirus type 71 into either HVR1 and HVR2 or HVR1 and HVR4, or HVR1 and HVR5 of hexon324. These examples imply the feasibility of hexon modifications in other serotypes of Ad, for the purpose of either gene therapy or vaccination approach. Our data also demonstrated the incorporations of two Trypanosoma cruzi epitopes into hexon and pIX (unpublished data). This strategy has also been extended to make chimeric Ad vectors for either vaccination or gene therapy approaches. Examples are the generation of chimeric Ad5H3 by switching hexon5 with hexon316, the generation of chimeric Ad3H7 by switching hexon3 with hexon725, and the generation of chimeric Ad5F4 by replacing Ad5 fiber with Ad4 fiber26.
In this study, the divalent Ad5/H5-HVR1-KWAS-HVR5-His6 demonstrated the eliciting of humoral immune responses specific to the incorporated antigens-of-interest. Our current project demonstrates that the ASP2-specific CD8 T cell response is significantly primed by immunization with a vector Ad5-pIX-ASP2, which was generated by incorporating ASP2 peptide into protein IX (pIX) of Ad5, with the Antigen Capsid-Incorporation strategy (data not shown). ASP2, also named amastigote surface protein 2, is an immunodominant antigen of the digenetic intracellular protozoan parasite Trypanosoma cruzi (T. cruzi)27. This new experimental finding extends our knowledge that the application of Antigen Capsid-Incorporation strategy on Ad vectored vaccines can elicit not only humoral immune responses, but also the cellular immune responses specific to the antigens-of-interest.
Although comparatively advantageous to the traditional transgene strategy, the Antigen Capsid-Incorporation strategy also has three disadvantages. First, it cannot allow the incorporation of gene-of-interest as long as traditional strategy does. It has been reported that the Antigen Capsid-Incorporation strategy on hexon5 allows for insertions of a maximum 80 amino acids (aa) in HVR1, 77 aa in HVR5 and 57 aa in HVR22. Of which, HVR1 is the most permissive locale for the incorporation. However, the minor capsid protein pIX can accommodate an insertion of 1,000 amino acids28. Second, some antigens-of-interest in nature fail in incorporating into the Ad capsid proteins, due to the factors such as charges and forces of amino acids, which seem to disrupt the structural arrangement of Ad virus. In this case, the introduction of appropriate spacers linked to the antigens-of-interest may help the successful incorporation4. Third, incorporations in some HVR locales, i.e., HVR6 or HVR7 could lead to failed generation of viable viral vectors12. Given the advantages and disadvantages of both strategies, a wise selection from the two strategies or a combination of both strategies will depend on the specific conditions/needs. An example of combing both the strategies is the generation of Ad5/HVR2-MPER-L15(Gag), whereby the membrane-proximal external region (MPER) of HIV-1 gp41was incorporated into HVR2 of hexon5 with the Antigen Capsid-Incorporation strategy, and HIV-1 Gag gene was inserted to replace the E1 gene locale of Ad5 with the traditional transgene strategy2.

Human adenovirus (Ad) is a medium-sized, non-enveloped virus with an icosahedral nucleocapsid containing a double stranded DNA genome. Ad belongs to the Adenoviridae family, with a classification into seven groups (A through G). Each group contains virus of different serotypes. Of which, adenovirus serotype 5 (Ad5) from group C has been the most extensively studied and the most widely applied for vectored approaches like gene therapy and vaccinations.
The traditional transgene strategy has been developed and applied for Ad5 modifications, which is characterized by the displacement of the virus early genes with a gene-of-interest, and the focused expression of the gene-of-interest in a host. Examples are the construction of pENV9/Ad5hr&#8710;E3 by replacing early gene 3 (E3) with rev gene of Simian Immunodeficiency Virus1, the construction of AdCMVGag by replacing early gene 1 (E1) with the gag gene of Human Immunodeficiency Virus (HIV)2, and the construction of AdlacZ by replacing E1 with lacZ gene3. The broad application of the traditional transgene strategy on Ad5 depends on the following merits: the wide range of hosts for Ad5, the feasible gene engineering on virus and virus propagation, the large accommodation of foreign gene insert and the safety of Ad54,5. However, the reduced efficacies of Ad5-vectored clinical therapies by use of this strategy has been a major bottleneck, which has been mapped to be primarily associated with Ad5 PEI, since Ad5 is so prevalent among the majority of children and adults4,6.
To overcome the major bottleneck of Ad5, the primary objective is to develop an alternative strategy circumventing Ad5 PEI. Innate immunity7, adaptive immunity such as neutralizing antibodies (NAbs)8-10 and CD8+ T cell responses10 against Ad5 have been shown to contribute to Ad5 PEI, with Ad5 NAbs appearing to play the dominant role in the contributions to Ad5 PEI10,11. Moreover, Ad5 NAbs target epitopes located in capsid proteins, including the major protein hexon, fiber and penton base. Of which, hexon is the major target of Ad5 NAbs8,11-13. Based on these findings, an innovative Antigen Capsid-Incorporation strategy has been introduced. This novel strategy highlights the replacement or incorporation of proteins-of-interest on Ad5 capsid proteins, which shifts or masks the Ad5 neutralizing epitopes, leading to the decreased recognition by the NAbs and efficient Ad5 vector administrations. It is noteworthy that this strategy is competitive because it can also help hosts elicit robust humoral immunity and potent cellular immunity by directly presenting antigens-of-interest to the immune system4,14,15. Based on this strategy, the molecular cloning and recombinant Ad viral vector rescue can be structurally divided into four main steps: (a) the preparation of gene-of-interest fragment by either polymerase chain reaction (PCR) or synthesis; (b) the ligation of gene fragment into a shuttle plasmid that contains the gene-of-interest fragment and homologous arms to an adenovirus backbone; (c) the homologous recombination by co-transforming the shuttle plasmid containing the gene-of-interest fragment with the linearized backbone plasmid pAd5/&#8710;H5 (GL)16; (d) the transfection of linearized recombinant adenoviral plasmid to rescue the recombinant Ad vector incorporated with antigens-of-interest.
Our group and some others have extended this alternative Ad incorporation strategy for Ad vectored vaccine development against different infectious pathogens. We reported the generation of a recombinant Ad vector Ad-HVR1-lgs-His6-V3 by incorporating a His-tagged HIV-1 antigen V3 into the HVR1 locale of Ad5 hexon (hexon5). This generated vector triggered strong humoral immune response specific to the V3 epitope4. We also reported the development of Ad5/HVR2-MPER-L15&#8710;E1 by incorporating HIV-1 membrane proximal ectodomain region (MPER) into the HVR2 locale of hexon52. In addition, Dr. Zhou&#8217;s group has used the benefits of this Ad incorporation strategy to develop Ad serotype 3 (Ad3) vectored vaccines, i.e., the generation of viral vector R1SP70A3 by incorporating a neutralizing epitope SP70 of Enterovirus 71 into the HVR1 of Ad3 hexon (hexon3). R1SP70A3 generated strong NAbs and IFN-&#947; production specific to the epitope SP70, which lead to the high rate of protection against Enterovirus 71 challenge15.
For the purpose of technical reference, our study took advantage of the qualitative Antigen Capsid-Incorporation strategy to focus on the generation of a divalent Ad5 vector Ad5/H5-HVR1-KWAS-HVR5-His6 by incorporating an HIV-1 antigen into HVR1 and a His tag into HVR5 of hexon5. The generated viral vector was also immunologically evaluated. The Antigen Capsid-Incorporation strategy could be utilized towards the development of Ad5-vectored vaccination approaches against different infectious diseases.

<table><tbody><tr><td>1x DPBS</td><td>Thermo Scientific</td><td>SH30256.01</td><td>for cell spliting&amp;nbsp;</td></tr><tr><td>10x DPBS</td><td>Thermo Scientific</td><td>SH30378.02</td><td>for dialysis buffer preparation</td></tr><tr><td>glycerol</td><td>SIGMA</td><td>G5516-1L</td><td>for dialysis buffer preparation</td></tr><tr><td>SDS</td><td>BIO-RAD</td><td>161-0301</td><td>for virus lysis buffer preparation</td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>Thermo Scientific</td><td>SH30910.03</td><td>component of culture medium</td></tr><tr><td>100x Non-Essential Amino Acids&amp;nbsp;</td><td>Thermo Scientific</td><td>SH30238.01</td><td>component of culture medium</td></tr><tr><td>200 mM L-glutamine</td><td>Cellgro</td><td>25-005-CI</td><td>component of culture medium</td></tr><tr><td>penicillin/streptomycin solution&amp;nbsp;</td><td>Cellgro</td><td>30-002-CI</td><td>component of culture medium</td></tr><tr><td>DMEM with high glucose</td><td>Thermo Scientific</td><td>SH30081.01</td><td>for HEK293 cell culture</td></tr><tr><td>Minimum Essential Medium Eagle</td><td>SIGMA</td><td>M5650</td><td>for HeLa cell culture</td></tr><tr><td>phenol:chloroform:isoamyl alcohol&amp;nbsp;</td><td>SIGMA</td><td>P3803-100ML</td><td>for large size of DNA purification</td></tr><tr><td>cesium chloride&amp;nbsp;</td><td>Research Products International Corp.</td><td>C68050</td><td>for virus purificiation</td></tr><tr><td>HEPES</td><td>Cellgro</td><td>25-060-CI</td><td>for CsCl solution preparation</td></tr><tr><td>HEK293</td><td>ATCC</td><td>51-0036</td><td>for virus rescue and upscale</td></tr><tr><td>HeLa</td><td>ATCC</td><td>CCL-2</td><td>for neutralization assay</td></tr><tr><td>T-25 flask</td><td>Thermo Scientific</td><td>156367</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>T-75 flask</td><td>CORNING</td><td>430641</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>T-175 flask</td><td>Thermo Scientific</td><td>159910</td><td>for cell culture&amp;nbsp;</td></tr><tr><td>Ultracentrifuge</td><td>BECKMAN</td><td>NA</td><td>for virus purification</td></tr><tr><td>Ultracentrifuge tube</td><td>BECKMAN</td><td>344059</td><td>for virus purification</td></tr><tr><td>dialysis cassette&amp;nbsp;</td><td>Thermo Scientific</td><td>66380</td><td>for virus dialysis</td></tr><tr><td>ELISA plate</td><td>Thermo Scientific</td><td>442404</td><td>for ELISA</td></tr><tr><td>human anti-gp41 (2F5) mAb</td><td>NIH AIDS Reagent Program</td><td>1475</td><td>for immunological assays</td></tr><tr><td>mouse anti-His tag mAb</td><td>GenScript</td><td>A00186</td><td>for immunological assays</td></tr><tr><td>SOC medium</td><td>CORNING</td><td>46-003-CR</td><td>for transformation</td></tr><tr><td>PCR master mix solution</td><td>QIAGEN</td><td>201445</td><td>for PCR</td></tr><tr><td>Animal lancet (point length at 5 mm)</td><td>MEDIpoint</td><td></td><td>for mice bleeding&amp;nbsp;</td></tr><tr><td>Biophotometer</td><td>Eppendorf</td><td></td><td>for virus physical titer titration</td></tr></tbody></table>

utilizing the antigen capsid-incorporation strategy for the development of adenovirus serotype 5-vectored vaccine approaches

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these traditionally modified Ad5 vectors in clinical trials could be primarily correlated with Ad5 pre-existing immunity (PEI) among the majority of the population. To promote Ad5-vectored vaccine development by solving the concern of Ad5 PEI, the innovative Antigen Capsid-Incorporation strategy has been employed. By merit of this strategy, Ad5-vectored we first constructed the hexon shuttle plasmid HVR1-KWAS-HVR5-His6/pH5S by subcloning the hypervariable region (HVR) 1 of hexon into a previously constructed shuttle plasmid HVR5-His6/pH5S, which had His6 tag incorporated into the HVR5. This HVR1 DNA fragment containing a HIV epitope ELDKWAS was synthesized. HVR1-KWAS-HVR5-His6/pH5S was then linearized and co-transformed with linearized backbone plasmid pAd5/&#8710;H5 (GL) , for homologous recombination. This recombined plasmid pAd5/H5-HVR1-KWAS-HVR5-His6 was transfected into cells to generate the viral vector Ad5/H5-HVR1-KWAS-HVR5-His6. This vector was validated to have qualitative fitness indicated by viral physical titer (VP/ml), infectious titer (IP/ml) and corresponding VP/IP ratio. Both the HIV epitope and His6 tag were surface-exposed on the Ad5 capsid, and retained epitope-specific antigenicity of their own. A neutralization assay indicated the ability of this divalent vector to circumvent neutralization by Ad5-positive sera in vitro. Mice immunization demonstrated the generation of robust humoral immunity specific to the HIV epitope and His6. This proof-of-principle study suggested that the protocol associated with the Antigen Capsid-Incorporation strategy could be feasibly utilized for the generation of Ad5-vectored vaccines by modifying different capsid proteins. This protocol could even be further modified for the generation of rare-serotype adenovirus-vectored vaccines.

The Antigen Capsid-Incorporation strategy (Figure 1A) was utilized to generate the divalent Ad5 viral vector Ad5/H5-HVR1-KWAS-HVR5-His6. Firstly, the shuttle plasmid HVR1-KWAS-HVR5-His6/pH5S was constructed by subcloning HVR1-KWAS fragment into the previous constructed shuttle plasmid HVR5-His6/pH5S17. Secondly, the plasmid pAd5/H5-HVR1-KWAS-HVR5-His614 was constructed by a homologous recombination between the fragment of &#8220;EcoRI-HVR1-KWAS-HVR5-His6-PmeI&#8221; and SwaI-linearized pAd5/&#8710;H5 (GL)16 (Figure 1B). Transfection of PacI digested pAd5/H5-HVR1-KWAS-HVR5-His6 in a T-25 flask lead to the rescue of the viral vector Ad5/H5-HVR1-KWAS-HVR5-His614. The rescued viral vector was then propagated in a large scale and purified by two cycles of CsCl gradient ultracentrifuge.
In order to demonstrate the viability/fitness of the rescued viral vector Ad5/H5-HVR1-KWAS-HVR5-His6, the physical titer was determined at 1.3 x 1011 VP/ml by measuring the physical copies of viral genome, and the infectious titer was determined at 1.4 x 109 IP/ml by titrating the actual infectious viral particles. The VP/IP ratio was subsequently calculated at 9214. Normally, an Ad with a VP/IP ratio below 1,000 indicates a qualitative fitness of this virus. In order to demonstrate whether this rescued virus displays the antigenic HIV antigen and His tag respectively on the surface of the viral capsid major protein hexon5, ELISA was undertaken with human 2F5 mAb and mouse anti-His tag mAb, respectively. Results indicated that both the human 2F5 mAb (Figure 2A)14 and mouse anti-His tag mAb (Figure 2B)14 showed binding to Ad5/H5-HVR1-KWAS-HVR5-His 6,whereas there was no binding to the negative control vector Ad5. Western-blot analysis was used to confirm the data in the ELISA, as both human 2F5 mAb (Figure 2C)14 and mouse anti-His tag mAb (Figure 2D)14 detected specific bands around 117 kDa only in the virus Ad5/H5-HVR1-KWAS-HVR5-His6, which corresponds to the size of hexon5 protein. In order to evaluate the potential of Ad5/H5-HVR1-KWAS-HVR5-His6 in circumventing neutralization by Ad5-positive sera, neutralization assay analysis was carried out as stated in the protocol section 3.3. The results showed that the relative luminescent unit (RLU) signal from the viral vector Ad5 treated with 0 &#181;l of Ad5-positve sera is 12 times higher than that from the same vector treated with 0.1 &#181;l of Ad5-positve sera (p value &#60; 0.001). This suggested the neutralization of the vector Ad5 by the Ad5-positvive sera. In contrast, there was little difference from the viral vector Ad5/H5-HVR1-KWAS-HVR5-His6 treated with 0 &#181;l and 0.1 &#181;l of Ad5-positve sera (Figure 3). Since hexon is the major target of Ad NAbs, and hexon-specific neutralizing epitopes reside in all HVRs of hexon12,18, the data above demonstrated that Ad5/H5-HVR1-KWAS-HVR5-His6 escaped neutralization by Ad5-positve sera in vitro and suggested the potential of Ad5/H5-HVR1-KWAS-HVR5-His6 on circumventing Ad5 PEI in the host.
To investigate whether the modified divalent Ad5 viral vector with the Antigen Capsid-Incorporation strategy could elicit robust humoral immunity specific to the incorporated antigens-of-interest, the &#8220;prime-boost&#8221; immunization regimen was applied to immunize mice with control viral vector Ad5 and the divalent vector Ad5/H5-HVR1-KWAS-HVR5-His6. Sera-based ELISA coated with HIV-1 peptide showed that sera from immunization group of Ad5/H5-HVR1-KWAS-HVR5-His6 had significant binding to the HIV-1 peptide at dilutions between 40 and 640, when compared to the sera from the control group (p value &#60; 0.001) (Figure 4A)14. Sera-based ELISA coated with His peptide showed that sera from the immunization group of Ad5/H5-HVR1-KWAS-HVR5-His6 had significant binding to the His peptide when compared to the sera from the control group, as statistical p value &#60; 0.001 at the sera dilutions of 40 and 80, p value &#60; 0.01 at the dilution of 160 and p value &#60; 0.05 at a 320 dilution (Figure 4B)14. The above results indicated the generation of humoral immune response against the incorporated antigens on the divalent viral vector.
<img alt="Figure 1" src="/files/ftp_upload/52655/52655fig1.jpg" /> 
Figure 1.&#160;Schematic illustration of the genetic construction of plasmid pAd5/H5-HVR1-KWAS-HVR5-His6 with the Antigen Capsid-Incorporation strategy. (A) The Antigen Capsid-Incorporation strategy is characterized by directly display antigen-of-interest on the capsid proteins (hexon, penta base, pIX and/or fiber) of adenovirus. This figure was adapted from Nemerow et al., 2009. Virology 384 (2009) 380&#8211;388, copyright Elsevier. (B) Gene fragment (HVR1-KWAS) was synthesized and cloned into a pUC vector by a company. This fragment was subcloned into the previously constructed shuttle plasmid HVR5-His6/pH5S by the restriction enzymes AgeI and AccI to generate HVR1-KWAS-HVR5-His6/pH5S. The resulting shuttle plasmid was digested with enzymes EcoRI and PmeI, and co-transformed with SwaI-linearized backbone plasmid pAd5/&#8710;H5 (GL) for the homologous recombination, resulting in the generation of the recombined backbone plasmid pAd5/H5-HVR1-KWAS-HVR5-His6. In this figure, R1 denotes HVR1 and R5 denotes HVR5, and GL denotes green fluorescence protein (GFP) and luciferase, separately. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52655/52655fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/52655/52655fig2.jpg" /> 
Figure 2. Evaluation of the antigenic exposure of incorporated antigens on the capsid surface of the divalent viral vector Ad5/H5-HVR1-KWAS-HVR5-His6. Whole viral vector ELISA was carried out to determine if the incorporated antigens were exposed on vector surface while maintaining antigenic characteristics of their own. ELISA plates were coated with the divalent vector, and incubated with human 2F5 mAb (A) or mouse anti-His mAb (B). Data indicated the significant binding of the antibodies to the divalent vector, but not to the control vector Ad5. R1-KWAS-R5-His6 denotes Ad5/H5-HVR1-KWAS-HVR5-His6. Western-blot analysis was performed to confirm the antigenic binding of the human 2F5 mAb (C) or mouse anti-His mAb (D) to the incorporated antigens on the divalent vector. In both&#160;(C) and (D), lane 1 indicates Ad5, and lane 2 indicate Ad5/H5-HVR1-KWAS-HVR5-His6. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52655/52655fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/52655/52655fig3.jpg" /> 
Figure 3. Evaluation of the divalent viral vector&#8217;s ability to escape the neutralization by Ad5-positve sera in vitro. Neutralization assay was performed to determine if the divalent vector could escape the neutralization. Results indicated the neutralization of Ad5 virus by the sera, but the escape of neutralization of the divalent virus in vitro. In this figure, R1-KWAS-R5-His6 denotes Ad5/H5-HVR1-KWAS-HVR5-His6. The asterisks *** denotes the p value &#60; 0.001.
<img alt="Figure 4" src="/files/ftp_upload/52655/52655fig4.jpg" /> 
Figure 4. In vivo generation of humoral immunity by the divalent viral vector in the mice model. Sera-based ELISA was used to evaluate the humoral immunity against the incorporated proteins on the divalent vector Ad5/H5-HVR1-KWAS-HVR5-His6. HIV-1 peptide (A) and His peptide (B) were coated in the ELISA plates separately, followed by the incubation with the mice sera from the two immunization groups (Ad5 and Ad5/H5-HVR1-KWAS-HVR5-His6). Data indicated the significant generation of humoral immune responses against the HIV-1 antigen in HVR1 (A) and the His tag in HVR5 (B). Each data point represents means and SD from eight replicates. The asterisks *** denotes the p value &#60; 0.001, ** denotes the p value &#60; 0.01, and * denotes the p value &#60; 0.05.

Watch this Scientific Journal Video about Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches at JoVE.com

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Here, we present a protocol to generate a proof-of-principle divalent adenovirus type 5 (Ad5) vector Ad5/H5-HVR1-KWAS-HVR5-His6 by utilizing the Antigen Capsid-Incorporation strategy. This vector was demonstrated to exhibit qualitative fitness, the capability to escape Ad5-positive sera in vitro, and the antigenicity as well as immunogenicity to the incorporated antigens.

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

utilizing-antigen-capsid-incorporation-strategy-for-development

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

10.3K Views.  University of Alabama at Birmingham. Here, we present a protocol to generate a proof-of-principle divalent adenovirus type 5 (Ad5) vector Ad5/H5-HVR1-KWAS-HVR5-His6 by utilizing the Antigen Capsid-Incorporation strategy. This vector was demonstrated to exhibit qualitative fitness, the capability to escape Ad5-positive sera in vitro, and the antigenicity as well as immunogenicity to the incorporated antigens.

Video: Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically &gt;80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Engineering and Evolution of Synthetic Adeno-Associated Virus AAV Gene Therapy Vectors via DNA Family Shuffling

We demonstrate the basic technique to molecularly engineer and evolve synthetic Adeno-associated viral (AAV) gene therapy vectors via DNA family shuffling. Moreover, we provide general guidelines and representative examples for selection and analysis of individual chimeric capsids with enhanced properties on target cells in culture or in mice.

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique ...

Production and Purification of Non Replicative Canine Adenovirus Type 2 Derived Vectors

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 1010 infectious particles per ml and can be directly administrated in vivo.

These past 15 years, canine adenovirus type 2 (CAV2)-derived vectors have proven their efficiency to transduce cells in vitro&#160;and in vivo and are widely used for vaccination and gene therapy. Here, we describe a procedure to construct, produce and purify CAV2 vectors, giving rise to high-titer viral suspensions.

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the ...

Cloning and Large-Scale Production of High-Capacity Adenoviral Vectors Based on the Human Adenovirus Type 5

High-capacity adenoviral vectors (HCAdV) devoid of all viral coding sequences represent one of the most advanced gene delivery vectors due to their high packaging capacity (up to 35 kb), low immunogenicity, and low toxicity. However, for many laboratories the use of HCAdV is hampered by the complicated procedure for vector genome construction and virus production. Here, a detailed protocol for efficient cloning and production of HCAdV based on the plasmid pAdFTC containing the HCAdV genome is described. The construction of HCAdV genomes is based on a cloning vector system utilizing homing endonucleases (I-CeuI and PI-SceI). Any gene of interest of up to 14 kb can be subcloned into the shuttle vector pHM5, which contains a multiple cloning site flanked by I-CeuI and PI-SceI. After I-CeuI and PI-SceI-mediated release of the transgene from the shuttle vector the transgene can be inserted into the HCAdV cloning vector pAdFTC. Because of the large size of the pAdFTC plasmid and the long recognition sites of the used enzymes associated with strong DNA binding, careful handling of the cloning fragments is needed. For virus production, the HCAdV genome is released by NotI digest and transfected into a HEK293 based producer cell line stably expressing Cre recombinase. To provide all adenoviral genes for adenovirus amplification, co-infection with a helper virus containing a packing signal flanked by loxP sites is required. Pre-amplification of the vector is performed in producer cells grown on surfaces and large-scale amplification of the vector is conducted in spinner flasks with producer cells grown in suspension. For virus purification, two ultracentrifugation steps based on cesium chloride gradients are performed followed by dialysis. Here tips, tricks, and shortcuts developed over the past years working with this HCAdV vector system are presented.

A protocol for generation of high-capacity adenoviral vectors lacking all viral coding sequences is presented. Cloning of transgenes contained in the vector genome is based on homing endonucleases. Virus amplification in producer cells grown as adherent cells and in suspension relies on a helper virus providing viral genes in trans.

High-capacity adenoviral vectors (HCAdV) devoid of all viral coding sequences represent one of the most advanced gene delivery vectors due to their high ...

Bioengineering

An Efficient Method for Adenovirus Production

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types and organs. However, recombinant adenoviral technology is laborious, time-consuming, and expensive. Here, we present an improved protocol using the pAdEasy system to obtain purified adenoviral particles that can induce a strong green fluorescent protein (GFP) expression in transduced cells. The advantages of this improved method are faster preparation and decreased production cost compared to the original method developed by Bert Vogelstein. The main steps of the adenoviral technology are: (1) the recombination of pAdTrack-GFP with the pAdEasy-1 plasmid in BJ5183 bacteria; (2) the packaging of the adenoviral particles; (3) the amplification of the adenovirus in AD293 cells; (4) the purification of the adenoviral particles from cell lysate and culture medium; and (5) the viral titration and functional testing of the adenovirus. The improvements to the original method consist of (i) the recombination in BJ5183-containing pAdEasy-1 by chemical transformation of bacteria; (ii) the selection of recombinant clones by &#8220;negative&#8221; and &#8220;positive&#8221; PCR; (iii) the transfection of AD293 cells using the K2 transfection system for adenoviral packaging; (iv) the precipitation with ammonium sulfate of the viral particles released by AD293 cells in cell culture medium; and (v) the purification of the virus by one-step cesium chloride discontinuous gradient ultracentrifugation. A strong expression of the gene of interest (in this case, GFP) was obtained in different types of transduced cells (such as hepatocytes, endothelial cells) from various sources (human, bovine, murine). Adenoviral-mediated gene transfer represents one of the main tools for developing modern gene therapies.

Here, we present a protocol for adenovirus production using the pAdEasy system. The technology includes the recombination of the pAdTrack and pAdEasy-1 plasmids, the adenovirus packaging and amplification, the purification of the adenoviral particles from cell lysate and culture medium, the viral titration, and the functional testing of the adenovirus.

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types ...

Production, Purification, and Quality Control for Adeno-associated Virus-based Vectors

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), including gene therapy applications. AAV vectors are non-replicating, able to infect both dividing and non-dividing cells&#160;and provide long-term transgene expression. Importantly, some serotypes, such as the newly described PHP.B, can cross the blood-brain-barrier (BBB) in animal models, following systemic delivery. AAV vectors can be efficiently produced in the laboratory. However, robust and reproducible protocols are required to obtain AAV vectors with sufficient purity levels and titer values high enough for in vivo applications. This protocol describes an efficient and reproducible strategy for AAV vector production, based on an iodixanol gradient purification strategy. The iodixanol purification method is suitable for obtaining batches of high-titer AAV vectors of high purity, when compared to other purification methods. Furthermore, the protocol is generally faster than other methods currently described. In addition, a quantitative polymerase chain reaction (qPCR)-based strategy is described for a fast and accurate determination of the vector titer, as well as a silver staining method to determine the purity of the vector batch. Finally, representative results of gene delivery to the CNS, following systemic administration of AAV-PHP.B, are presented. Such results should be possible in all labs using the protocols described in this article.

Here, we describe an efficient and reproducible strategy to produce, titer, and quality-control batches of adeno-associated virus vectors. It allows the user to obtain a vector preparation with high-titer&#160;(&#8805;1 x 1013 vector genomes/mL) and a high purity, ready for in vitro or in vivo use.

Gene delivery tools based on adeno-associated viruses (AAVs) are a popular choice for the delivery of transgenes to the central nervous system (CNS), ...

Neuroscience

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus (AAV) Capsid Variants

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by encouraging clinical data and the approval of several AAV gene therapies. Two major reasons for the success of AAV vectors are (i) the prior isolation of various naturally occurring viral serotypes with distinct properties, and (ii) the subsequent establishment of powerful technologies for their molecular engineering and repurposing in high throughput. Further boosting the potential of these techniques are recently implemented strategies for barcoding selected AAV capsids on the DNA and RNA level, permitting their comprehensive and parallel in vivo stratification in all major organs and cell types in a single animal. Here, we present a basic pipeline encompassing this set of complementary avenues, using AAV peptide display to represent the diverse arsenal of available capsid engineering technologies. Accordingly, we first describe the pivotal steps for the generation of an AAV peptide display library for the in vivo selection of candidates with desired properties, followed by a demonstration of how to barcode the most interesting capsid variants for secondary in vivo screening. Next, we exemplify the methodology for the creation of libraries for next-generation sequencing (NGS), including barcode amplification and adaptor ligation, before concluding with an overview of the most critical steps during NGS data analysis. As the protocols reported here are versatile and adaptable, researchers can easily harness them to enrich the optimal AAV capsid variants in their favorite disease model and for gene therapy applications.

Isolation of Next-Generation Gene Therapy Vectors through Engineering, Barcoding, and Screening of Adeno-Associated Virus AAV Capsid Variants

AAV peptide display library generation and subsequent validation through the barcoding of candidates with novel properties for the creation of next-generation AAVs.

Gene delivery vectors derived from Adeno-associated virus (AAV) are one of the most promising tools for the treatment of genetic diseases, evidenced by ...

Detection of Neutralization-sensitive Epitopes in Antigens Displayed on Virus-Like Particle (VLP)-Based Vaccines Using a Capture Assay

The virus-like particle (VLP) capture assay is an immunoprecipitation method, commonly known as a &#39;pull-down assay&#39; used to purify and isolate antigen-displaying VLPs. Surface antigen-specific antibodies are coupled to, and thus immobilized on a solid and insoluble matrix such as beads. Due to their high affinity to the target antigen, these antibodies can capture VLPs decorated with the cognate antigen anchored in the membrane envelope of the VLPs. This protocol describes the binding of antigen-specific antibodies to protein A- or G-conjugated magnetic beads. In our study, human immunodeficiency virus (HIV)-derived VLPs formed by the group-specific antigen (Gag) viral core precursor protein p55 Gag and displaying the envelope glycoproteins (Env) of HIV are examined. The VLPs are captured utilizing broadly neutralizing antibodies (bNAbs) directed against neutralization-sensitive epitopes in Env. The VLP capture assay outlined here represents a sensitive and easy-to-perform method to demonstrate that (i) the VLPs are decorated with the respective target antigen, (ii) the surface antigen retained its structural integrity as demonstrated by the epitope-specific binding of bNAbs used in the assay and (iii) the structural integrity of the VLPs revealed by the detection of Gag proteins in a subsequent Western blot-analysis. Consequently, the utilization of bNAbs for immunoprecipitation facilitates a prediction of whether VLP vaccines will be able to elicit a neutralizing B cell response in vaccinated humans. We anticipate that this protocol will furnish other researchers with a valuable and straightforward experimental approach to examine potential VLP-based vaccines.

Detection of Neutralization-sensitive Epitopes in Antigens Displayed on Virus-Like Particle VLP-Based Vaccines Using a Capture Assay

Here, we present a protocol to detect neutralization epitopes on antigen-displaying virus-like particles (VLPs). Immunoprecipitation of the human immunodeficiency virus (HIV)-derived VLPs is performed using envelope glycoproteins-specific monoclonal antibodies coupled to protein G-conjugated magnetic beads. Captured VLPs are subsequently subjected to SDS-PAGE and Western blot-analysis employing viral core protein Gag-specific antibodies.

The virus-like particle (VLP) capture assay is an immunoprecipitation method, commonly known as a &#39;pull-down assay&#39; used to purify and isolate ...

Construction of Adenoviral Vectors using DNA Assembly Technology

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an adenoviral vector by manipulating the genomic DNA of wild-type HAdV-7 by using a DNA assembly method. First, an infectious clone of HAdV-7, pKan-Ad7, was generated by fusing the viral genomic DNA with a PCR product from plasmid backbone, comprising of the kanamycin-resistant gene and the origin of replication (Kan-Ori), through DNA assembly. This was done by designing a pair of PCR primers, that contained ~25 nucleotides of the terminal sequence of HAdV-7 inverted terminal repeat (ITR) at the 5' end, a non-cutter restriction enzyme site for HAdV-7 genome in the middle, and a template-specific sequence for PCR priming at the 3' end. Second, an intermediate plasmid-based strategy was employed to replace the E3 region with transgene-expressing elements in the infectious clone to generate an adenoviral vector. Briefly, pKan-Ad7 was digested with dual-cutter restriction enzyme Hpa I, and the fragment containing the E3 region was ligated to another PCR product of plasmid backbone by Gibson assembly to construct an intermediate plasmid pKan-Ad7HpaI. For convenience, restriction-assembly was used to designate the plasmid cloning method of combined restriction digestion and assembly. Using restriction-assembly, the E3 genes in pKan-Ad7HpaI was replaced with a green fluorescent protein (GFP) expression cassette, and the modified E3 region was released from the intermediate plasmid and restored to the infectious clone to generate an adenoviral plasmid pKAd7-E3GFP. Finally, pKAd7-E3GFP was linearized by Pme I digestion and used to transfect HEK293 packaging cells to rescue recombinant HAdV-7 virus. To conclude, a DNA assembly-based strategy was introduced here for constructing adenoviral vectors in general laboratories of molecular biology without the need of specialized materials and instruments.

In this study, an infectious clone of human adenovirus type 7 (HAdV-7) was constructed, and an E3-deleted HAdV-7 vector system was established by modifying the infectious clone. This strategy used here can be generalized to make gene transfer vectors from other wild-type adenoviruses.

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an ...

Purification of AAV Vectors by Single-Step Heparin Affinity Chromatography

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

Author Spotlight: Improved Method for Production and Purification of Adeno-Associated Viral Vectors

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

Expression and Purification of Virus-like Particles for Vaccination

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased biosafety and stability over use of live pathogens. Non-infectious and self-assembling, VLPs are used to present structural proteins as immunogens, bypassing the need for live pathogens or recombinant viral vectors for antigen delivery. In this article, we demonstrate the different stages of VLP design and development for future applications in preclinical animal testing. The procedure includes the following stages: selection of antigen, expression of antigen in cell line of choice, purification of VLPs/SVPs, and quantification for antigen dosing. We demonstrate use of both mammalian and insect cell lines for expression of our antigens and demonstrate how methodologies differ in yield. The methodology presented may apply to a variety of pathogens and can be achieved by substituting the antigens with immunogenic structural proteins of the user&#39;s microorganism of interest. VLPs and SVPs assist with antigen characterization and selection of the best vaccine candidates.

Here, we present a protocol for synthesizing virus-like particles using either baculovirus or mammalian expression systems, and ultracentrifugation purification. This highly customizable approach is used to identify viral antigens as vaccine targets in a safe and flexible manner.

Virus-like particles (VLPs) and subviral particles (SVPs) are an alternative approach to viral vaccine design that offers the advantages of increased ...