עבודה זו נתמכה על ידי המענק מדגיש NERC (NE N016777 1). Ensis בע מ, שירותי מדעי הסביבה, המרכז לחקר שינוי סביבתי, אוניברסיטת קולג '-לונדון שנדגמו, יצאתי עם ליבת משקעים.

המחברים אין לחשוף

עקב מוליכות חום גבוהה של מים, מערכות אקולוגיות מים מתוקים הם בסיכון גבוה יותר של המגוון הביולוגי אובדן מאשר המערכות האקולוגיות יבשתי מול הכללית התחממות34 חיוני, לכן, כדי להבין את התגובה של keystone מינים של מערכות אקולוגיות אלו ולזהות מנגנוני ההתמודדות לשרוד מתח תרמי. ההבנה של מנגנונים אלה ברמות מינים והקהילה יכול לעזור לחזות כיצד מינים שמושפעים התחממות וגולש איך ההשפעה על מינים בודדים לרמות אחרות הזנה. בסופו של דבר, הבנת מנגנוני תגובות על התחממות כדור הארץ מאפשר הזיהוי של תיקונים אסטרטגיות להפחתת extinctions.
מחקרים המובאים כאן מראים כי תגובת מגנה ד בטמפרטורה pervasively מתווך על ידי פלסטיות של תכונות היסטוריית החיים ולא כי בתגובה בטמפרטורה לבד לכפות עלויות כושר ברורה, לפחות האוכלוסייה למד כאן. פלסטיות גבוהה בתכונות היסטוריית החיים נתמך על ידי הבדלים שאינם משמעותיים ביכולות מתחרות של האוכלוסיות (sub) בנוכחות התחממות כדור הארץ. עם זאת, התחרות וקהילותיהם, ניסויים אוכלוסיות מרובות ייתכן שיהיה צורך להכליל ממצאים אלה.
תחייתו של שלבים רדום מספק משאב חסר תקדים ללמוד מנגנוני הסתגלות ואת מסלולי התפתחות של זן עד שעה10. זואופלנקטון מינים תועלת זמן דור מהירה (כשבועיים), ואת הכדאיות של שלבים רדום, אשר מאפשר קדום. כדי להתחרות headtohead נגד צאצאיו משלו, או 'החוזר' האבולוציה שמתחיל ממדינות שונות בעבר. תחיית המתים אקולוגיה בעיקרו של דבר מאפשר החקירה של תוצאה אבולוציונית מיוחדת נמדדת לפי כמה אירועים קודמים. זיהוי מרכיבים גנטיים של אבולוציה אפשרית כיום בניסויים במעבדה בעזרת מיקרואורגניזמים שעבורם 'שורות אב קדמון' קפוא, להחיות אותו לניתוח השוואתי עם צאצא מפותחת שלהם6. עם זאת, אחת המגבלות העיקריות של עבודה עם מעבדה אורגניזמים הוא 'המדינה אב קדמון' הוא בסיסית שהוסטו כבר. המחקר של שלבים רדום מאפשר הדוגמאות של דגימות מן הזמן לגירושן לכל אירוע דחק (למשל, תנאים סביבתיים וטהור) וכדי למדוד מסלולים אבולוציונית מתנאי הסביבה ללא הפרעה למדינות שונות בעבר עד לתקופה המודרנית. בשנים האחרונות, המחקר של ה-DNA פולימורפיזם בשלבים זואופלנקטון לתחייה או עדיין רדום סיפקה תובנות חשובות האחרונות תהליכים דמוגרפיים, מסתגלת תרמו הגנטי של אוכלוסיות של ימינו14 , 16 , 25 , 33 , 35 , 36. עם נגישות גבוהה יותר של טכנולוגיות רצף תפוקה גבוהה, הגנום ואת transcriptome של שלבי לתחייה או עדיין רדום יכול להיות רציף, סוג ומספר שינויים גנטיים שנצבר המתפתחת אוכלוסיות מעל הזמן נמדד.
התקומה SOP המוצג כאן יש ליישומים חשובים בתחום של מולטי-טכנולוגיות על שתי רמות. טכנולוגיות רב ניתן ליישם דגימות לתחייה, המאפשר ניתוח ממצה של היסודות המולקולריים המעורבים בתגובות הסתגלות ללחץ הסביבה הבחירה. בנוסף, טכנולוגיות ניתן ליישם decapsulated אלא שלבי עדיין רדום. עד כה, היישום של טכנולוגיות רצף תפוקה גבוהה לנוח שלבים היה מוגבל על ידי הדרישה של כמות גדולה של חומר קלט. מגבלות אלה מתבצעת והרימה אותה37. עם הדרישות להורדת חומר קלט ולהתקדם בעזרת nanofluidics, רצף הגנום כולו (WGS) אפשרי עכשיו מ קטנה כמו 1 ng או כמה pg להתחיל גשמי38. השימוש של הגנום כולו הגברה (WGA) וטכניקות הגברה (של WTA) כל transcriptome, המאפשרת את העשרת של DNA ו- RNA של כמויות קטנות מאוד של רקמות, יש מהפכה39,metagenomics40 וגם רפואי מחקר41. טכנולוגיות אלה חלה על ביצים רדום decapsulated לאפשר את חריגה של מגבלות הקשורים הכדאיות של שלבים רדום של חוקרים של תקופות זמן ממושך (למשל, מאות שנים).
תחייתו של קהילות הגעה בהפקת שלבים מנוחתו מאפשר היישור של סיפורי הקהילה בשינויים ידועים של הנופים הטבעיים, או עם שינויים סביבתיים להסיק מניתוחי של משקעים orsoils2. הניתוח של הקהילה משתנה בתגובה לשינוי סביבתי מספק לנו את היכולת לכמת פידבקים eco-אבולוציונית42 שיש להם השלכות משמעותית על ההתמדה האוכלוסייה43, אינטראקציות עם מחלות44 , הקהילה הרכבה45, ושינויים במערכת האקולוגית פונקציות ושירותים46. לבסוף, תחזיות מדויקות לגבי תגובות ביולוגיות שינוי סביבתי הם הכרחיים כדי להנחות את ההגנה של המגוון הביולוגי47 מודלים הנוכחית אינם מדויקים בהקשר זה כי הם לא עשה חשבון מנגנונים ביולוגיים חשובים כגון דמוגרפיה, פיזור, האבולוציה מינים אינטראקציות. הבנה כיצד תהליכים אלה משתנים במשך הזמן ושימוש במידע זה כמו לכהן ב דוגמנות תחזית ישפר את היכולת שלנו לחזות מינים ושנה הקהילה התמדה אל מול הסביבה2.
היישום של ה-SOP המובאת כאן אינה ללא אתגרים. המגבלה העיקרית של לאוהדיו שלבים רדום הוא הצורך של ציוד מיוחד עבור הדגימה. בנוסף, התהליך כולו, מן המשקעים ניפוי להקמה של תרבויות המשובטים, דורש זמן ניכר על הידיים.
חלק מהשלבים SOP המובאת כאן המתעכבים ברצון מינים דפניה אחרים. אלה הם: דגימה, הקמת קווי המשובטים, תכנון ניסויים. עם זאת, צעדים אחרים של ה-SOP עשויים לדרוש עוד יותר אופטימיזציה המותאמים למין שנבחנה. Decapsulation לעיתים קרובות חלה על דגימות מגנה ד כדי לשפר את ההצלחה הבקיעה. עם זאת, גישה זו עשוי לא להיות מתאים דגימות קטנות יותר. הבקיעה גירויים יכול להשתנות גם בין המינים48 ובין הדגימה conspecific49. לפיכך, לאופטימיזציה אד הוק של המדרגות הבקיעה של ה-SOP עשוי להידרש לפני ליישומים אחרים. בזמן הבקיעה ההצלחה של האוכלוסייה מגנה ד לתחייה מן האגם טבעת (30.5% על פני הארכיון משקע) עולה בקנה אחד עם תוצאות קודמות49, הבקיעה הצלחה משתנה עם מצב ההשתמרות המשקע, המין 50,51, המקור הגיאוגרפי של משקעים48. מחקרים עתידיים על המנגנונים המווסתים כניסה וההתקדמות דרך השלבים של תרדמה ואסטרטגיה נדרש לזהות גירויים הבקיעה האופטימלי לצרכיו מינים שונים.
לבסוף, רקע הידע של מערכת המחקר, בפרט, נוכחותם של המינים של הריבית לאורך זמן, מומלץ. זו יכולה להיות מושגת באמצעות רשומות היסטוריות. אם רשומות היסטוריות אינן זמינות, דגימה, הקרנת משטח שכבות המשקע אגם לפני דגימה הליבה, מומלץ, למרות שזה מספק מידע רק על ההיסטוריה האחרונה.

מחקרים ארוכי טווח הם קריטיים להבנת תהליכים אקולוגי ואבולוציוני בטבע, בהערכת להגיב וכיצד נמשכות במהלך שינוי סביבתי1מינים. זה בגלל תהליכי eco-אבולוציונית לקרות על פני דורות, שינויים בסביבת מתקיימים לאורך זמן טווחי זמנים. יתר על כן, מחקרים ארוכי טווח לספק מפתח בנתונים אמפיריים, לשפר את הדיוק של דוגמנות חזוי לתחזית אבולוציונית תגובות של מערכות אקולוגיות טבעיות שינויים סביבתיים2. הדיוק של מודלים אלה היא קריטית כדי ליישם אסטרטגיות ניהול ושימור לשמירה על המגוון הביולוגי שירותי המערכת האקולוגית.
לא כולל כמה מקרים יוצאי דופן (למשל, גלפאגוס דארווין פרושים3 ואצות4), מחקרים ארוכי טווח מוגבלים בעיקר מינים עם זמן דור קצר, אותם ניתן להפיץ ב מעבדה5,6 , 7 , 8. לפיכך, התהליכים דינמיקה אבולוציונית לגורם המרכזי עליו מושתתת נשארים חמקמקים. בגלל קשיים לוגיסטיים הקשורים עם גישה לדוגמיות הטמפורלי, בנתונים אמפיריים נלמדים בתדירות גבוהה יותר ב מרחבית יותר בהקשר הטמפורלי, תהליכי eco-אבולוציונית טמפורלית להסיק או המודל של נתונים מרחביים. גישה זו מכונה 'מרחב-עבור-time' החלפת9, לפיה שטח מאומצת כתחליף בחקר דינמיקה אבולוציונית טמפורלית. המגבלה העיקרית ההחלפה 'מרחב-עבור-time' היא כי המחירים של הסתגלות המרחבי בקני מידה שונים נבדלים וריאציה טמפורלית מאותה אוכלוסייה; לפיכך, מסקנות בהתבסס על החלפה של זמן עם שטח הם משוחד10.
חלופה רב עוצמה המאפשר לימוד דינמיקה אבולוציונית של מערכות אקולוגיות טבעיות לאורך זמן הוא הניתוח של שינויים אקולוגיים ולא גנטי במין בהפקת שלבים רדום11. אלה שלבים רדום לארכיון ביולוגי טופס מרובדת שניתן באופן מדויק מיום ולצבור paleolimnologically מאופיין12,13. חשוב, השלבים האלה רדומים יכולים להיות החיינו ומשמשת בניסויים במעבדה, איפה את תגובתם אבולוציונית השינוי הסביבתי ניתן למדוד ישירות. אוכלוסיות ההיסטורי יכול להיות התחרו נגד צאצאיהם מפותחת המודרנית ללמוד כושר שינויים והפונקציה של גנים מתפתח בשלב עם שינוי סביבתי14,15,16.
שלבים רדום כוללים זרעים, ציסטות, נבגים, ביצה בנקים. למרות המחקרים הראשונים על החיו ביצים רדום שתחילתה בסוף שנות השמונים17ו קומץ של מחקרים החלת טכניקה זו בתחילת שנות ה-9018,19, בתחום אקולוגיה התחייה היה באופן רשמי הוקמה על ידי העיתון החלוצי של Kerfoot ועמיתים 199920. פרקטיקה זו הוחל בעיקר בתחום paleolimnological שחזורים של מים מתוקים מינים17,21,22. עם זאת, שוחד אינה זמינה עדיין. כאן, מספק תיאור צעד אחר צעד של פרוטוקול תחיית המתים שהוחל ביצים רדום של המין זואופלנקטון דפניה magna , מן הדוגמאות של שנלכד להקמת תרבויות המשובטים הוולדות. הצעדים של ה-SOP המתעכבים ברצון מינים אחרים של דפניה, כמו גם פעולות שעשויות לדרוש נוספים מיטוב, הם דנו.
דפניה הם מים מתוקים zooplankters נוכח ברוב המכריע של בתי גידול lotic23 . דפניה מינים הם גם parthenogens אל-זוויגית או מחזורי גידול. מאגנה ד הוא parthenogen מחזורית מתרבה clonally תחת תנאים סביבתיים נוחים24. כאשר התנאים הסביבתיים להתדרדר, ייצור זכר מתרחשת ומוביל רקומבינציה מינית את היווצרות של הביצים זה להיכנס למצב של תרדמה מוגן מן הסביבה על-ידי תיק כיטין שנקרא ephippium. שיעור של הביצים רדום בוקעות תנאים סביבתיים נוחים חוזרים. עם זאת, חלק גדול של הבנק הביצה הרדומה מעולם לא יש סיכוי לבקוע, ובכך לבנות את ארכיון ביולוגי לאורך זמן. שלבים רדום שישאר קבור ב המשקע של אגמים, בריכות, יכול להיות לתחייה לחקר דינמיקה אבולוציונית לאורך פרקי זמן ארוכים. כיוון ביצים רדום של magna ד הם התוצאה של רקומבינציה מינית, הן ייצוג טוב של המגוון הגנטי הטבעי של מינים25. יתר על כן, הם יכולים להישמר דרך רבייה המשובטים במעבדה. מאפיינים אלו מספקים את היתרון הייחודי של אורגניזמים דגם isogenic, תוך שמירה על המגוון הגנטי טבעי.
שני מחקרים מפתח מוצגים כדי להדגים את היתרונות של ישירות השוואת היסטוריים ומודרניים צאצאי האוכלוסייה באותו מגנה ד חווה לחץ סביבתי הבחירה לאורך זמן. מאגנה ד דגימות שהוקמו לתחייה מן האגם טבעת (דנמרק), רדוד (עומק 5m; פני 22 ha) בריכה מעורבת שחווה גידול ממוצע טמפרטורה, גלי חום שמתרחשת לאורך זמן. אוכלוסיות מגנה ד (sub) היו לתחייה לאורך זו הדרגה הזמנית המתפרסות על-פני 60 שנה (1960-2005) ולמד לחקור תגובה אבולוציונית טמפרטורה להתחממות. במחקר הראשון בניסוי גן משותף, שינויים בכושר-מקושרים על החיים תכונות נמדדו בתגובה לעלייה בטמפרטורה של C ° +6, בקו אחד עם הנבואה של הפאנל הבין-ממשלתי לשינוי האקלים 100 השנים הקרובות 26. במחקר השני, ניסוי mesocosm שימש כדי למדוד את יכולותיהם תחרותי של שלושת האוכלוסיות (sub) תחת התחממות כדור הארץ. ניסויים אלה בשילוב מראים כי בנוכחות של התחממות כדור הארץ כמו הלחץ היחיד, כל תכונות היסטוריית החיים של אוכלוסיות להציג רמה גבוהה של פלסטיות יכולות תחרותי שווה. ממצאים אלה מראים כי ההתחממות כמו מצוקה מטיל עלויות משמעותי כושר, לפחות בקרב האוכלוסייה למד כאן.

<table border="0" cellpadding="0" cellspacing="0" width="791">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">sampling bags</td>
			<td style="width:145px;">Fisher Scientific</td>
			<td style="width:145px;">11542783</td>
			<td style="width:371px;">Sampling bag revolve round wires closure system and safety tabs sterile polyethylene with writing area clear 89&#181;m thickness 140mm x 229mm, 720mL Fisherbrand</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">piston corer</td>
			<td style="width:145px;">ENSIS ltd</td>
			<td style="width:145px;">na</td>
			<td>Long, heavy tube plunged into the sea, lake, pond floor to extract samples of mud sediment. Piston corers have a viariable diameter and are generally in PVC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">precision scale&#160;</td>
			<td style="width:145px;">Veritas-M124A</td>
			<td>TLP-50</td>
			<td>Analytical Balance</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">geological sieve</td>
			<td>UKGE limited</td>
			<td>SV7521</td>
			<td>200 mm diameter geological sieve - 1 mm mesh</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">geological sieve</td>
			<td>UKGE limited</td>
			<td>SV7525</td>
			<td>200 mm diameter geological sieve - 0.125 mm mesh</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:131px;">white sampling tray</td>
			<td style="width:145px;">nhbs</td>
			<td>http://www.nhbs.com/title/view/159614?ad_id=1509</td>
			<td>Standard mulipurpose lab trays&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">pasteur pipette</td>
			<td style="width:145px;">Globe Scientific inc.</td>
			<td>138020B</td>
			<td>Transfer Pipet, 1.7mL, General Purpose, 87mm, Bulb Draw - 0.9mL</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">stereo microscope</td>
			<td style="width:145px;">nikon&#160;</td>
			<td style="width:145px;">smz800</td>
			<td>Microscope with magnification range 1x -8x linked to a camera control unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">petri dish</td>
			<td>EduLab</td>
			<td>153-533</td>
			<td>Sterile 90mm diameter plastic petri dish</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">glass jars&#160;</td>
			<td style="width:145px;">compak</td>
			<td style="width:145px;">Round Jam Jars 4oz</td>
			<td>100 mL jars&#160;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:131px;">glass jars&#160;</td>
			<td style="width:145px;">compak</td>
			<td style="width:145px;">Atum Jars/ Bonta Jar 10oz</td>
			<td>200 mL jars</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:131px;">glass jars&#160;</td>
			<td style="width:145px;">bottlecompanysouth</td>
			<td style="width:145px;">500ml Food Jam Jar With Twist Off Lid</td>
			<td>500 mL jars&#160;</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:131px;">statistical software R</td>
			<td style="width:145px;">https://cran.r-project.org/</td>
			<td style="width:145px;">na</td>
			<td>Free online GNU&#160; language and environment for statistical computing and graphics</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:131px;">microdissection forceps</td>
			<td style="width:145px;">Fisher Scientific</td>
			<td>41122405</td>
			<td>Fine point stainless steel forceps for microdissections</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">image software</td>
			<td>https://imagej.nih.gov/ij/index.html</td>
			<td style="width:145px;">na</td>
			<td>Open source ImageJ image processing toolkit&#160; written in Java</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">mesocosm</td>
			<td style="width:145px;">amazon</td>
			<td style="width:145px;">na</td>
			<td>Nobby Fauna-Box III, 41 x 23 x 29 cm, 20.0 Liter</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">mirocentrifuge tubes&#160;</td>
			<td style="width:145px;">Sigma_Aldrick - Merck</td>
			<td style="width:145px;">Z606340</td>
			<td>premium microcentrifuge tubes 1.5 mL</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:131px;">AGENCOURT DNAdvance&#160;&#160;</td>
			<td style="width:145px;">Beckman Coulter</td>
			<td style="width:145px;">A48705</td>
			<td>DNA extraction kit</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">size standard</td>
			<td style="width:145px;">Thermo Fisher Scientific</td>
			<td>4322682</td>
			<td>LIZ500 - Size standard compatible with ABI sequencers</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:131px;">ABI3032 sequencer</td>
			<td style="width:145px;">ABI</td>
			<td style="width:145px;">na</td>
			<td>Sequencer used to perform fragment analysis or sanger sequencing</td>
		</tr>
	</tbody>
</table>

resurrection of dormant daphnia magna: protocol and applications

מחקרים ארוכי טווח מאפשרות זיהוי תהליכי eco-אבולוציוניים המתרחשים לאורך פרקי זמן ארוכים. בנוסף, הם מספקים מפתח בנתונים אמפיריים הנתנות ב דוגמנות חזוי לתחזית אבולוציונית תגובות של מערכות אקולוגיות טבעיות לשינויים סביבתיים בעתיד. עם זאת, לא כולל כמה מקרים חריגים, מחקרים ארוכי טווח ואספקות נדירים בגלל קשיים לוגיסטיים הקשורים עם גישה לדוגמיות טמפורלית. דינמיקה טמפורלית נלמדים לעתים קרובות במעבדה או בניסויים מבוקרים mesocosm עם מחקרים יוצאי דופן לשחזר את האבולוציה של אוכלוסיות הטבעי בטבע.
. הנה, סטנדרטי (SOP) מסופק להחיות או להחיות רדום דפניה magna, זן keystone זואופלנקטון נרחבת של המערכת האקולוגית הימית, לקדם באופן דרמטי את אוסף נתוני האורך המדינה-of-the-art מערכות טבעיות. בתחום אקולוגיה תחיית המתים הוגדרה בשנת 1999 על-ידי Kerfoot ועמיתים לעבודה, אף-על-פי הראשון ניסיונות הבקיעה diapausing זואופלנקטון ביצים תאריך חזרה בסוף שנות השמונים. מאז העיתון הזרע של Kerfoot, המתודולוגיה של לאוהדיו זואופלנקטון מינים לעתים קרובות יותר ויותר הוחל, למרות הופץ בין מעבדות רק באמצעות העברה ישירה הידע. כאן, הנוהל המתואר המספק פרוטוקול שלב אחר שלב על העשייה לאוהדיו רדום דפניה מגנה ביצים.
שני מחקרים מרכזיים ניתנים ב אשר תגובת כושר לתחייה דפניה מגנה לאוכלוסיות ההתחממות נמדד, ניצול היכולת ללמוד לאוכלוסייה היסטוריים ומודרניים באותן ההגדרות. לבסוף, נדון היישום של טכנולוגיות רצף ' הדור הבא ' בשלבים לתחייה או עדיין רדום. טכנולוגיות אלה מספקים כוח חסר תקדים בניתוח של תהליכים ומנגנונים של האבולוציה, אם חלה על אוכלוסיות שעברו שינויים בלחץ הבחירה לאורך זמן.

בנתונים אמפיריים לטווח ארוך הם קריטיים להבנת דינמיקה אבולוציונית, ההתמדה של אוכלוסיות טבעי. נתונים כאלה הם בדרך כלל מאתגרת כדי לקבל בגלל קשיים לוגיסטיים הקשורים עם גישה הדרישה בביצוע לטווח ארוך כדי איסוף נתונים ודוגמאות טמפורלית. שני מפתח מחקרים שהוצגו כאן, הוכחה אמפירית של התגובה הטמפרטורה של zooplankter המרכזית של מערכות אקולוגיות מים מתוקים מסופק על פי אבולוציונית. זה מופעלת על ידי השימוש בשכבות הביצה הרדומה הבנקים לספק הזדמנות ללמוד את התגובה של אוכלוסיות היסטורי וצאצאיהם מודרניים כדי עקה בהגדרות ניסיוני משותף.
ניסוי גן משותף הניסוי גן משותף הראה כי כל התכונות ההיסטוריה הגיבו טמפרטורה (איור 6 ו איור 7). ניתוח הנתונים ANOVA גילה כי כל האוכלוסיות (sub) להגיב לטמפרטורת דרך פלסטיות (טבלה 2), למעט התמותה, אשר אינו מגיב. ראיות של שינויים אבולוציוניים (הבדלים בין האוכלוסיות (sub)) נצפתה רק ב גידול האוכלוסיה (טבלה 2), אשר גדל באופן משמעותי בשניים מתוך השלושה אוכלוסיות (sub) ב 24 ° C (איור 6).
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56637/56637fig6.jpg"> איור 6: ניסוי גן משותף. התגובה נורמות החיים תכונות (פוריות, בגודל בגיל בגרות), גידול האוכלוסיה (r) מוצגים עבור כל האוכלוסייה (sub) מתחת לטמפרטורה התחממות (24 ° C) לעומת גן משותף של הטמפרטורה הנוכחית המשטר (18 ° C). גידול האוכלוסיה "r" מחושבת באמצעות משוואת אוילר (1). מרווחי הביטחון מוצגים. אוכלוסיות (sub) הם לפי צבעים: כחול (i): 1960-1970; (ii) ירוק: 1970-1985; (iii) אדום: > 1999. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/56637fig6large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56637/56637fig7.jpg"> איור 7: תמותה. שיעורי התמותה לכל האוכלוסייה (sub) (1960-1970; 1970-1985; > 1999) מוצגים תחת התחממות כדור הארץ (24 ° C) לעומת משטרים מודרניים טמפרטורה (18 ° C). <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/56637fig7large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
ניסוי Mesocosm לאחר ארבעה שבועות של בחירה, המיוצג על-ידי ההתחממות ב 24 ° C, התדירות של שלושת האוכלוסיות (sub) לא השתנה באופן משמעותי (χ2 = 0.55, P = 0.76) לעומת inoculum הראשוני (איור 8). בין 30 אחרים מחוסן בניסוי mesocosm, הרוב זוהה לאחר ארבעה שבועות של בחירה (איור 9). באופן ספציפי, 70% חוסנו אחרים היו התאושש, תואם עם ציפייה Poissonian מחלים נציג אחד לפחות של כל גנוטיפ במדגם של 32 אנשים.
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56637/56637fig8.jpg"> איור 8: תחרות הניסוי - האוכלוסייה תדר- חציון ממוצע האוכלוסייה ואת רביעונים (25th ו 75th), מוצג עבור שלוש אוכלוסיות (sub) של magna ד לאחר ארבעה שבועות של הבחירה בניסויים תחרות mesocosm (24 ° C), לעומת תדר השווה הראשונית (ב ההתחלה). אוכלוסיות (sub) הם לפי כפי שמוצג באיור 6צבעים. <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/56637fig8large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 9" class="xfigimg" src="/files/ftp_upload/56637/56637fig9.jpg"> איור 9: תחרות הניסוי - גנוטיפ תדר- גנוטיפ תדרים – חציון בממוצע רביעונים (25th ו 75th), מוצגים לאחר ארבעה שבועות של חשיפה התחממות כדור הארץ (24 ° C) לעומת תדירות שווה הראשונית של אחרים (קו מנוקד). שמות בציר ה-x הם מזהה אחרים חוסנו, לקבץ לפי האוכלוסייה (sub) (כחול, 1960-1970; ירוק, 1970-1985; רד, > 1999). <a href="//cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/56637fig9large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>לוקוס</td>
			<td>,</td>
			<td>גודל הטווח (bp)</td>
			<td colspan="2">תחל (5' - 3')</td>
			<td>תווית צבע</td>
			<td>מוטיב חוזר</td>
			<td>Tm</td>
		</tr>
<tr>
<td rowspan="2">B008</td>
			<td rowspan="2">HQ234154</td>
			<td rowspan="2">150-170</td>
			<td colspan="2">F: TGGGATCACAACGTTACACAA</td>
			<td rowspan="2">ויק</td>
			<td rowspan="2">(TC) 9
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: GCTGCTCGAGTCCTGAAATC</td>
		</tr>
<tr>
<td rowspan="2">B030</td>
			<td rowspan="2">HQ234160</td>
			<td rowspan="2">154 – 172</td>
			<td colspan="2">F: CCAGCACACAAAGACGAA</td>
			<td rowspan="2">חיית המחמד</td>
			<td rowspan="2">(ג'י אי) 11
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: ACCATTTCTCTCCCCCAACT</td>
		</tr>
<tr>
<td rowspan="2">B045</td>
			<td rowspan="2">HQ234168</td>
			<td rowspan="2">118 – 126</td>
			<td colspan="2">F: GCTCATCATCCCTCTGCTTC</td>
			<td rowspan="2">נד</td>
			<td rowspan="2">(TG) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: ATAGTTTCAGCAACGCGTCA</td>
		</tr>
<tr>
<td rowspan="2">B050</td>
			<td rowspan="2">HQ234170</td>
			<td rowspan="2">234 – 248</td>
			<td colspan="2">F: TTTCAAAAATCGCTCCCATC</td>
			<td rowspan="2">6FAM</td>
			<td rowspan="2">(גה) 6
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TATGGCGTGGAATGTTTCAG</td>
		</tr>
<tr>
<td rowspan="2">B064</td>
			<td rowspan="2">HQ234172</td>
			<td rowspan="2">135 – 151</td>
			<td colspan="2">F: CTCCTTAGCAACCGAATCCA</td>
			<td rowspan="2">6FAM</td>
			<td rowspan="2">(TC) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: CAAACGCGTTCGATTAAAGA</td>
		</tr>
<tr>
<td rowspan="2">B074</td>
			<td rowspan="2">HQ234174</td>
			<td rowspan="2">196-204</td>
			<td colspan="2">F: TCTTTCAGCGCACAATGAAT</td>
			<td rowspan="2">נד</td>
			<td rowspan="2">(GT) 9
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TGTGTTCCTTGTCAACTGTCG</td>
		</tr>
<tr>
<td rowspan="2">B096</td>
			<td rowspan="2">HQ234181</td>
			<td rowspan="2">234 – 240</td>
			<td colspan="2">F: GGATCTGGCAGGAAGTGGTA</td>
			<td rowspan="2">ויק</td>
			<td rowspan="2">(AC) 15
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TTGAACCACGTCGAGGATTT</td>
		</tr>
<tr>
<td rowspan="2">B107</td>
			<td rowspan="2">HQ234184</td>
			<td rowspan="2">250 – 274</td>
			<td colspan="2">F: GGGGTGAAGCATCAAAGAAA</td>
			<td rowspan="2">חיית המחמד</td>
			<td rowspan="2">(CT) 8
</td>
			<td rowspan="2">56</td>
		</tr>
<tr>
<td colspan="2">R: TGTGACCAGGATAAGAGAAGAGG</td>
		</tr>
</tbody></table>טבלה 1: בתי קולנוע Microsatellite. NCBI ההצטרפות מספר (AN), המידע מולטיפלקס, הרצפים פריימר PCR, הטווח גודל ה-PCR, מוטיב חוזר, לצבוע פעם תווית של פריימר לפנים, והטמפרטורה מחזק (Tm) מוצגים.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td colspan="2">שיעור הצמיחה פופ (r)</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>30.309</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>531.546</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>65.137</td>
			<td>< 0.001</td>
		</tr>
<tr>
<td colspan="2">התמותה</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>2.234</td>
			<td>0.1162</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>2.679</td>
			<td>0.1071</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>1.8657</td>
			<td>0.164</td>
		</tr>
<tr>
<td colspan="2">פוריות</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>1.8852</td>
			<td>0.1633</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>6.8934</td>
			<td>0.0117</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>1.6511</td>
			<td>0.203</td>
		</tr>
<tr>
<td colspan="2">גודל בעת הפירעון</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>0.211</td>
			<td>0.8106</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>11.1361</td>
			<td>0.0017</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>0.6586</td>
			<td>0.5225</td>
		</tr>
<tr>
<td colspan="2">גיל בעת הפירעון</td>
			<td>Df</td>
			<td>F</td>
			<td>P</td>
		</tr>
<tr>
<td colspan="2">האבולוציה (Pop)</td>
			<td>2</td>
			<td>0.7811</td>
			<td>0.4637</td>
		</tr>
<tr>
<td colspan="2">פלסטיות (Temp)</td>
			<td>1</td>
			<td>8.0764</td>
			<td>0.0066</td>
		</tr>
<tr>
<td colspan="2">Evol. פלסטיות (פופ x Temp)</td>
			<td>2</td>
			<td>0.088</td>
			<td>0.9159</td>
		</tr>
</tbody></table>בטבלה 2: השונות (ANOVA). ניתוח השונות בדיקה אם שינויים תכונות היסטוריית החיים וכן גידול האוכלוסיה של אוכלוסיות לתחייה (sub) חשופים להתחממות מוסברים על ידי הסתגלות אבולוציונית (אוכלוסיות), פלסטיות (טיפול טמפרטורה), שלהם המונח אינטראקציה (האבולוציה של פלסטיות). משמעותי p-ערכים (p< 0.05) מוצגות בגופן מודגש.
1 וידאו משלימים: דגימה של משקעים ליבות. השימוש corer ביג בן מוצג. ביג בן הוא צינור הליבה של-1.5 מ' אורך עם קוטר צינור פנימי של 14 ס מ. זה מורכב בוכנה על חבל וראש corer, שאליו מחוברים מוטות לנסוע ברכבת התחתית לתוך המשקע. לוכד ליבה משמש לתמיכה הצינור הליבה פרוס כלי קטן. הבוכנה נדחף למטה לתוך המשקע על ידי לחץ הכבידה. מסגרת משמש כדי לתמוך את הצינור הליבה במהלך תהליך ההבלטה מתבצעות בעזרת שקע בקבוק ששונה דוחף את הבוכנה כלפי מעלה. כל שכבה משקעים על משטח המתכת השטוחים ונשתמש הועבר דגימה שקוף שקיות לאחסון לטווח ארוך [אפל וקר (4 ° C) תנאים]. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/Supplementary_video1_Sampling.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>
2 וידאו משלימים: משקעים ניפוי. הציוד הדרוש עבור ניפוי משקעים הוא סולם precision, מגשים דגימה לבן, הנפות גיאולוגי. בין כל שכבה משקעים, לפחות 5 g נשמרים עבור תיארוך רדיומטרי. שארית המשקע משמש כדי לבודד ephippia. המשקע הוא sieved דרך שתי הנפות גיאולוגי, אחד עם 1 מ מ, שנייה עם 125 µm שרוחב, נערמו אחד על גבי השני. בינונית ויוצקים על מסננת רשת 1 מ מ להפריד חימר גדולים חסרי חוליות, חלקיקי החומר. בינוני שפכו על המסננת השנייה עם 125 µm רשת מפריד ד magna ephippia וחומר חלקיקי קטן. Aliquots של משקעים מועברים למגש דגימה לבן. Ephippia מגנה ד הם הבחינו לפי העין במגש רקע לבן. Ephippia של כל שכבה נאספים פטרי נפרדים. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/Supplementary_video2_Sieving_sediment.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>
וידאו משלים 3: Decapsulation. תחת stereomicroscope, ephippia magna ד נפתחות עם מלקחיים microdissection על ידי הפעלת לחץ על עמוד השדרה של המקרה כיטין. קרום ביצה הפנימי יוסר בעדינות ולא נח הביצים בעדינות הועבר עם פיפטה פסטר צלחת פטרי המכילות 10 מ"ל של מדיום. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/Supplementary_video3_Decapsulation.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>
וידאו משלימים 4: הבקיעה. לאחר חשיפה ארוכה photoperiod ו 20 ° C, חידוש התפתחות העובר בין 48 שעות מספר שבועות. עם השלמת הפיתוח, העוברים להשתחרר ממעטפת הביצית, לשחות בחופשיות בטווח הבינוני. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56637/Supplementary_video4_Hatching.mp4">אנא לחץ כאן כדי להוריד את הקובץ.</a>

Watch this Scientific Journal Video about Resurrection of Dormant Daphnia magna: Protocol and Applications at JoVE.com

Resurrection of Dormant Daphnia magna: Protocol and Applications

מחקרים ארוכי טווח חיוניים להבנת תהליך האבולוציה ולא על מנגנוני הסתגלות. באופן כללי, מחקרים אלה דורשות התחייבויות מעבר חיים החוקרים. . הנה, שיטה חזקה מתואר באופן דרמטי ההתקדמות איסוף נתונים המדינה-of-the-art להפיק נתוני האורך בתוך מערכות טבעיות.

תחיית המתים של רדום דפניה מגנה: פרוטוקול ויישומים

Long-term studies enable the identification of eco-evolutionary processes that occur over extended time periods. In addition, they provide key empirical ...

resurrection-of-dormant-daphnia-magna-protocol-and-applications

Nanyang Technological University

Research

JoVE Journal

Environment

Resurrection of Dormant Daphnia magna: Protocol and Applications

18.2K Views.  University of Birmingham. מחקרים ארוכי טווח חיוניים להבנת תהליך האבולוציה ולא על מנגנוני הסתגלות. באופן כללי, מחקרים אלה דורשות התחייבויות מעבר חיים החוקרים. . הנה, שיטה חזקה מתואר באופן דרמטי ההתקדמות איסוף נתונים המדינה-of-the-art להפיק נתוני האורך בתוך מערכות טבעיות.

Video: Resurrection of Dormant Daphnia magna: Protocol and Applications

A Protocol for Conducting Rainfall Simulation to Study Soil Runoff

Rainfall is a driving force for the transport of environmental contaminants from agricultural soils to surficial water bodies via surface runoff. The objective of this study was to characterize the effects of antecedent soil moisture content on the fate and transport of surface applied commercial urea, a common form of nitrogen (N) fertilizer, following a rainfall event that occurs within 24&#160;hr&#160;after fertilizer application. Although urea is assumed to be readily hydrolyzed to ammonium and therefore not often available for transport, recent studies suggest that urea can be transported from agricultural soils to coastal waters where it is implicated in harmful algal blooms. A rainfall simulator was used to apply a consistent rate of uniform rainfall across packed soil boxes that had been prewetted to different soil moisture contents. By controlling rainfall and soil physical characteristics, the effects of antecedent soil moisture on urea loss were isolated. Wetter soils exhibited shorter time from rainfall initiation to runoff initiation, greater total volume of runoff, higher urea concentrations in runoff, and greater mass loadings of urea in runoff. These results also demonstrate the importance of controlling for antecedent soil moisture content in studies designed to isolate other variables, such as soil physical or chemical characteristics, slope, soil cover, management, or rainfall characteristics. Because rainfall simulators are designed to deliver raindrops of similar size and velocity as natural rainfall, studies conducted under a standardized protocol can yield valuable data that, in turn, can be used to develop models for predicting the fate and transport of pollutants in runoff.

A rainfall simulator was used to apply a consistent rate of uniform rainfall to packed soil boxes in a study of the fate and transport of urea, a nonpoint source environmental contaminant. Under uniform soil and rainfall conditions, antecedent soil moisture content exerted strong control over urea loss in surface runoff.

פרוטוקול לעריכת סימולציה גשם לחקר ניגר קרקע

Rainfall is a driving force for the transport of environmental contaminants from agricultural soils to surficial water bodies via surface runoff. The ...

A Push-pull Protocol to Reduce Colonization of Bird Nest Boxes by Honey Bees

Introduction of the invasive Africanized honey bee (AHB) into the Neotropics is a serious problem for many cavity nesting birds, specifically parrots. These bees select cavities that are suitable nest sites for birds, resulting in competition. The difficulty of removing bees and their defensive behavior makes a prevention protocol necessary. Here, we describe a push-pull integrated pest management protocol to deter bees from inhabiting bird boxes by applying a bird safe insecticide, permethrin, to repel bees from nest boxes, while simultaneously attracting them to pheromone-baited swarm traps. Shown here is an example experiment using Barn Owl nest boxes. This protocol successfully reduced colonization of Barn Owl nest boxes by Africanized honey bees. This protocol is flexible, allowing adjustments to accommodate a wide range of bird species and habitats. This protocol could benefit conservation efforts where AHB are located.

Preventing colonization of bird nest boxes by invasive Africanized honey bees is important for conservation efforts of nest-site limited birds. We provide an integrated pest management approach to &#34;push&#34; bees away from nest boxes with a repellant insecticide, permethrin, and &#34;pull&#34; them toward pheromone baited swarm traps.

פרוטוקול Push-Pull כדי להפחית תיבות קינון Colonization של ציפור על ידי דבורי דבש

Introduction of the invasive Africanized honey bee (AHB) into the Neotropics is a serious problem for many cavity nesting birds, specifically parrots. ...

A Protocol for Collecting and Constructing Soil Core Lysimeters

Leaching of nutrients from land applied fertilizers and manure used in agriculture can lead to accelerated eutrophication of surface water. Because the landscape has complex and varied soil morphology, an accompanying disparity in flow paths for leachate through the soil macropore and matrix structure is present. The rate of flow through these paths is further affected by antecedent soil moisture. Lysimeters are used to quantify flow rate, volume of water and concentration of nutrients leaching downward through soils. While many lysimeter designs exist, accurately determining the volume of water and mass balance of nutrients is best accomplished with bounded lysimeters that leave the natural soil structure intact. 
Here we present a detailed method for the extraction and construction of soil core lysimeters equipped with soil moisture sensors at 5 cm and 25 cm depths. Lysimeters from four different Coastal Plain soils (Bojac, Evesboro, Quindocqua and Sassafras) were collected on the Delmarva Peninsula and moved to an indoor climate controlled facility. Soils were irrigated once weekly with the equivalent of 2 cm of rainfall to draw down soil nitrate-N concentrations. At the end of the draw down period, poultry litter was applied (162 kg TN ha-1) and leaching was resumed for an additional five weeks. Total recovery of applied irrigation water varied from 71% to 85%. Nitrate-N concentration varied over the course of the study from an average of 27.1 mg L-1 before litter application to 40.3 mg L-1 following litter application. While greatest flux of nutrients was measured in soils dominated by coarse sand (Sassafras) the greatest immediate flux occurred from the finest textured soil with pronounced macropore development (Quindocqua).

A detailed method for extraction and assembly of intact soil core lysimeters and their use for study of leachate and associated loss of nutrients from surface applied poultry litter is demonstrated.

פרוטוקול Lysimeters Core קרקע איסוף הבנייה

Leaching of nutrients from land applied fertilizers and manure used in agriculture can lead to accelerated eutrophication of surface water. Because the ...

Experimental Protocol for Detecting Cyanobacteria in Liquid and Solid Samples with an Antibody Microarray Chip

Global warming and eutrophication make some aquatic ecosystems behave as true bioreactors that trigger rapid and massive cyanobacterial growth; this has relevant health and economic consequences. Many cyanobacterial strains are toxin producers, and only a few cells are necessary to induce irreparable damage to the environment. Therefore, water-body authorities and administrations require rapid and efficient early-warning systems providing reliable data to support their preventive or curative decisions. This manuscript reports an experimental protocol for the in-field detection of toxin-producing cyanobacterial strains by using an antibody microarray chip with 17 antibodies (Abs) with taxonomic resolution (CYANOCHIP). Here, a multiplex fluorescent sandwich microarray immunoassay (FSMI) for the simultaneous monitoring of 17 cyanobacterial strains frequently found blooming in freshwater ecosystems, some of them toxin producers, is described. A microarray with multiple identical replicates (up to 24) of the CYANOCHIP was printed onto a single microscope slide to simultaneously test a similar number of samples. Liquid samples can be tested either by direct incubation with the antibodies (Abs) or after cell concentration by filtration through a 1- to 3-&#956;m filter. Solid samples, such as sediments and ground rocks, are first homogenized and dispersed by a hand-held ultrasonicator in an incubation buffer. They are then filtered (5 - 20 &#956;m) to remove the coarse material, and the filtrate is incubated with Abs. Immunoreactions are revealed by a final incubation with a mixture of the 17 fluorescence-labeled Abs and are read by a portable fluorescence detector. The whole process takes around 3 h, most of it corresponding to two 1-h periods of incubation. The output is an image, where bright spots correspond to the positive detection of cyanobacterial markers.

Experimental Protocol for Detecting Cyanobacteria in Liquid and Solid Samples with an Antibody Microarray Chip

The presence of cyanobacterial toxins in fresh water reservoirs for human consumption is a major concern for water management authorities. To evaluate the risk of water contamination, this article describes an protocol for the in-field detection of cyanobacterial strains in liquid and solid samples by using an antibody microarray chip.

פרוטוקול הניסוי לזיהוי<em&gt; כחוליות</em&gt; בדגימות נוזלים ומוצקים עם צ&#39;יפ Microarray נוגדן

Global warming and eutrophication make some aquatic ecosystems behave as true bioreactors that trigger rapid and massive cyanobacterial growth; this has ...

Protocol for Microplastics Sampling on the Sea Surface and Sample Analysis

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of scientific publications address microplastic pollution of the sea surface. The protocol below describes the methodology for sampling, sample preparation, separation and chemical identification of microplastic particles. A manta net fixed on an &#187;A frame&#171; attached to the side of the vessel was used for sampling. Microplastic particles caught in the cod end of the net were separated from samples by visual identification and use of stereomicroscopes. Particles were analyzed for their size using an image analysis program and for their chemical structure using ATR-FTIR and micro FTIR spectroscopy. The described protocol is in line with recommendations for microplastics monitoring published by the Marine Strategy Framework Directive (MSFD) Technical Subgroup on Marine Litter. This written protocol with video guide will support the work of researchers that deal with microplastics monitoring all over the world.

The protocol below describes the methodology for: microplastics sampling on the sea surface, separation of microplastic and chemical identification of particles. This protocol is in line with the recommendations for microplastics monitoring published by the MSFD Technical Subgroup on Marine Litter.

פרוטוקול עבור דגימת חלקיקים על פני הים וניתוח לדוגמא

Microplastic pollution in the marine environment is a scientific topic that has received increasing attention over the last decade. The majority of ...

Data Processing Methods for 3D Seismic Imaging of Subsurface Volcanoes: Applications to the Tarim Flood Basalt

The morphology and structure of plumbing systems can provide key information on the eruption rate and style of basalt lava fields. The most powerful way to study subsurface geo-bodies is to use industrial 3D&#160;reflection seismological imaging. However, strategies to image subsurface volcanoes are very different from that of oil and gas reservoirs. In this study, we process seismic data cubes from the Northern Tarim Basin, China, to illustrate how to visualize sills through opacity rendering techniques and how to image the conduits by time-slicing. In the first case, we isolated probes by the seismic horizons marking the contacts between sills and encasing strata, applying opacity rendering techniques to extract sills from the seismic cube. The resulting detailed sill morphology shows that the flow direction is from the dome center to the rim. In the second seismic cube, we use time-slices to image the conduits, which corresponds to marked discontinuities within the encasing rocks. A set of time-slices obtained at different depths show that the Tarim flood basalts erupted from central volcanoes, fed by separate pipe-like conduits.

Three-dimensional (3D) reflection seismology is a powerful method for imaging subsurface volcanoes. By using industrial 3D seismological data from the Tarim Basin, we illustrate how to extract the sills and the conduits of subsurface volcanoes from seismic data cubes.

שיטות עיבוד נתונים סיסמיים הדמיה ממוחשבת של הרי געש מהסבא: יישומים הבזלת טארים המבול

The morphology and structure of plumbing systems can provide key information on the eruption rate and style of basalt lava fields. The most powerful way ...

Dispersion of Nanomaterials in Aqueous Media: Towards Protocol Optimization

The sonication process is commonly used for de-agglomerating and dispersing nanomaterials in aqueous based media, necessary to improve homogeneity and stability of the suspension. In this study, a systematic step-wise approach is carried out to identify optimal sonication conditions in order to achieve a stable dispersion. This approach has been adopted and shown to be suitable for several nanomaterials (cerium oxide, zinc oxide, and carbon nanotubes) dispersed in deionized (DI) water. However, with any change in either the nanomaterial type or dispersing medium, there needs to be optimization of the basic protocol by adjusting various factors such as sonication time, power, and sonicator type as well as temperature rise during the process. The approach records the dispersion process in detail. This is necessary to identify the time points as well as other above-mentioned conditions during the sonication process in which there may be undesirable changes, such as damage to the particle surface thus affecting surface properties. Our goal is to offer a harmonized approach that can control the quality of the final, produced dispersion. Such a guideline is instrumental in ensuring dispersion quality repeatability in the nanoscience community, particularly in the field of nanotoxicology.

Here, we present a step-wise protocol for the dispersion of nanomaterials in aqueous media with real-time characterization to identify the optimal sonication conditions, intensity, and duration for improved stability and uniformity of nanoparticle dispersions without impacting the sample integrity.

פיזור של ננו בתקשורת מימית: לקראת פרוטוקול אופטימיזציה

The sonication process is commonly used for de-agglomerating and dispersing nanomaterials in aqueous based media, necessary to improve homogeneity and ...

Microfluidic Devices for Characterizing Pore-scale Event Processes in Porous Media for Oil Recovery Applications

Microfluidic devices are versatile tools for studying transport processes at a microscopic scale. A demand exists for microfluidic devices that are resistant to low molecular-weight oil components, unlike traditional polydimethylsiloxane (PDMS) devices. Here, we demonstrate a facile method for making a device with this property, and we use the product of this protocol for examining the pore-scale mechanisms by which foam recovers crude oil. A pattern is first designed using computer-aided design (CAD) software and printed on a transparency with a high-resolution printer. This pattern is then transferred to a photoresist via a lithography procedure. PDMS is cast on the pattern, cured in an oven, and removed to obtain a mold. A thiol-ene crosslinking polymer, commonly used as an optical adhesive (OA), is then poured onto the mold and cured under UV light. The PDMS mold is peeled away from the optical adhesive cast. A glass substrate is then prepared, and the two halves of the device are bonded together. Optical adhesive-based devices are more robust than traditional PDMS microfluidic devices. The epoxy structure is resistant to swelling by many organic solvents, which opens new possibilities for experiments involving light organic liquids. Additionally, the surface wettability behavior of these devices is more stable than that of PDMS. The construction of optical adhesive microfluidic devices is simple, yet requires incrementally more effort than the making of PDMS-based devices. Also, though optical adhesive devices are stable in organic liquids, they may exhibit reduced bond-strength after a long time. Optical adhesive microfluidic devices can be made in geometries that act as 2-D micromodels for porous media. These devices are applied in the study of oil displacement to improve our understanding of the pore-scale mechanisms involved in enhanced oil recovery and aquifer remediation.

The goal of this procedure is to easily and rapidly produce a microfluidic device with customizable geometry and resistance to swelling by organic fluids for oil recovery studies. A polydimethylsiloxane mold is first generated, and then used to cast the epoxy-based device. A representative displacement study is reported.

מכשירי Microfluidic אפיון תהליכים אירוע בקנה מידה נקבובית בתקשורת נקבובי עבור יישומים התאוששות שמן

Microfluidic devices are versatile tools for studying transport processes at a microscopic scale. A demand exists for microfluidic devices that are ...

Preparation of DMMTAV and DMDTAV Using DMAV for Environmental Applications: Synthesis, Purification, and Confirmation

Dimethylated thioarsenicals such as dimethylmonothioarsinic acid (DMMTAV) and dimethyldithioarsinic acid (DMDTAV), which are produced by the metabolic pathway of dimethylarsinic acid (DMAV) thiolation, have been recently found in the environment as well as human organs. DMMTAV and DMDTAV can be quantified to determine the ecological effects of dimethylated thioarsenicals and their stability in environmental media. The synthesis method for these compounds is unstandardized, making replicating previous studies challenging. Furthermore, there is a lack of information about storage techniques, including storage of compounds without species transformation. Moreover, because only limited information about synthesis methods is available, there may be experimental difficulties in synthesizing standard chemicals and performing quantitative analysis. The protocol presented herein provides a practically modified synthesis method for the dimethylated thioarsenicals, DMMTAV and DMDTAV, and will help in the quantification of species separation analysis using high performance liquid chromatography in conjunction with inductively coupled plasma mass spectrometry (HPLC-ICP-MS). The experimental steps of this procedure were modified by focusing on the preparation of chemical reagents, filtration methods, and storage.

Preparation of DMMTAV and DMDTAV Using DMAV for Environmental Applications: Synthesis, Purification, and Confirmation

This article presents modified experimental protocols for dimethylmonothioarsinic acid (DMMTAV) and dimethyldithioarsinic acid (DMDTAV) synthesis, inducing dimethylarsinic acid (DMAV) thiolation through mixing of DMAV, Na2S, and H2SO4. The modified protocol provides an experimental guideline, thereby overcoming limitations of the synthesis steps that could have caused experimental failures in quantitative analysis.

הכנת DMMTAV ו- DMDTAV באמצעות DMAV עבור ישומים סביבתיים: סינתזה, טיהור ואישור

Dimethylated thioarsenicals such as dimethylmonothioarsinic acid (DMMTAV) and dimethyldithioarsinic acid (DMDTAV), which are produced by the metabolic ...

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity testing has been demonstrated. Overall, the sensitivity of the species to toxic compounds is in the range with, or higher than, that of other model species.
This work describes protocols for acute, chronic, and multigenerational bioassays of single and combined stressor effects on N. furzeri. Due to its short maturation time and life-cycle, this vertebrate model allows the study of endpoints such as maturation time and fecundity within four months. Transgenerational full life-cycle exposure trials can be performed in as little as 8 months. Since this species produces eggs that are drought-resistant and remain viable for years, the on-site culture of the species is not needed but individuals can be recruited when required. The protocols are designed to measure life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

Protocol for Acute and Chronic Ecotoxicity Testing of the Turquoise Killifish Nothobranchius furzeri

In this work, we describe an acute, chronic and multigenerational bioassay to study the effects of single and combined stressors on the Turquoise killifish Nothobranchius furzeri. This protocol is designed to study life-history traits (mortality, growth, fecundity, weight) and critical thermal maximum.

פרוטוקול עבור סימן ובדיקות כרונית Ecotoxicity של דגים גמבוזיים טורקיז Nothobranchius furzeri

The killifish Nothobranchius furzeri is an emerging model organism in the field of ecotoxicology and its applicability in acute and chronic ecotoxicity ...