תמיכה כספית במחקר זה ניתנה על ידי לאומי מפתח מחקר ופיתוח התוכנית (2016YFC1200601) ואת הקרן הלאומית למדעי הטבע של סין (31390421).

1. Whitefly Rearing ומין מינים זיהוי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> שמירה על מינים לבן על כותנה Gossypium hirsutum (Malvaceae) (cv. Zian-mian 1973) בכלובים בתנאים סטנדרטיים של 27 ± 1 ° C, לחות 70 ± 10% ו 14 שעות אור: 10 שעות משטר כהה. </li><li style=";text-align:right;direction:rtl"> איסוף לבן יחיד מבוגר ו homogenize ב 30 μL של חיץ תמוגה (10 מ&quot;מ טריס, pH 8.4, 50 מ&quot;מ KCl, 0.45% [wt / vol] Tween-20, 0.2% [wt / vol] ג &#39;לטין, 0.45% [vol / Vol] Nonidet P 40, 60 גרם / מ&quot;ל ​​Proteinase K). </li><li style=";text-align:right;direction:rtl"> דגירה homogenate ב 65 מעלות צלזיוס למשך 1 שעות ולאחר מכן 100 מעלות צלזיוס למשך 10 דקות. הערה: זמן דגירה על 65 מעלות צלזיוס ניתן להגדיל אם יש צורך. זמן דגירה על 100 מעלות צלזיוס צריך להיות מבוקר בביקורתית מספיק להשבית Proteinase K ולהימנע נזק DNA. </li><li style=";text-align:right;direction:rtl"> בצע את התגובה שרשרת פולימראז (PCR) באמצעות DNA לבן (שנרכש בסעיף 1.3) על בסיס אוקטידאז ציטוכרום המיטוכונדריה אני primers. COI-F: 5&#39;-TTGATTTTTGGTCATCCAGAAGT-3 &#39; COI-R: 5&#39;-TAATATGGAGATTAGTGCATTGGA-3 &#39; <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בצע את התגובות PCR בנפח סופי של 25 μL המכיל 1 U של פולימרז DNA Taq , 2.5 מאגר μL 10x, 0.2 מ&quot;מ dNTP, 0.2 מ&quot;מ של כל תחל ו 2 μL של DNA לבן. </li><li style=";text-align:right;direction:rtl"> השתמש בתנאים הבאים הליך PCR: denaturation הראשונית 95 מעלות צלזיוס במשך 3 דקות ואחריו 35 מחזורים של 95 מעלות צלזיוס במשך 45 שניות (denaturation), 50 מעלות צלזיוס במשך 45 שניות (חישול) ו 72 מעלות צלזיוס למשך 1 דקות (הרחבה) ו עוד 10 דקות ב 72 מעלות צלזיוס להארכה נוספת. </li></ol></li><li style=";text-align:right;direction:rtl"> נקה את המוצר מוגבר PCR באמצעות ערכת ג &#39;ל DNA החילוץ עם פרוטוקול מומלץ. </li><li style=";text-align:right;direction:rtl"> רצף דגימות DNA מטוהרים עם דגימה דנ&quot;א רצף המערכת בעקבות ההוראה של היצרן. </li><li style=";text-align:right;direction:rtl"> לנתח את sequences באמצעות כלי בסיסי מקומי יישור כלי (BLAST) כדי לזהות את מינים סתומים של זבוב לבן ולמנוע זיהום של speci אחריםEs. </li></ol> 2. זיהוי Endosymbiont לוקליזציה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לבצע PCR על DNA לבן (שנרכש בשלב 1.3) כדי להגביר את הגנים הספציפיים של endosymbiont כל בתוך whitefly (מתכון ה- PCR מתואר בסעיף 1.4, ו PCR נהלים פריימרים המפורטים בטבלה 1 ). </li><li style=";text-align:right;direction:rtl"> נושא המדגם מוגבר על ג&#39;ל אלקטרופורזה agarose על פי פרוטוקול שפורסם בעבר 20 (1% agarose ג&#39;ל, Tris-אצטט-EDTA כמו חיץ פועל, מתח 5 V / cm) כדי לזהות את הגן הספציפי של כל חיידק. </li><li style=";text-align:right;direction:rtl"> לשחזר ורצף כל הלהקה כדי לקבוע את מינים חיידקי בתוך whitefly (ראה סעיפים 1.5-1.7). </li><li style=";text-align:right;direction:rtl"> בצע הקרינה באתר הכלאות (FISH) על whiteflies לזהות את המיקום של endosymbionts על פי פרוטוקול שפורסם בעבר 19 . הערה: יש להגדיל את הריכוז של בדיקות פלורסנט במידת הצורך. </li></oL&gt; 3. הילוכים אלקטרונים מיקרוסקופית (TEM) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לטבול לתקן whiteflies במאגר פוספט (0.1 M, pH 7.0) המכיל 2.5% [vol / vol] glutaraldehyde עבור 4 שעות. </li><li style=";text-align:right;direction:rtl"> שטפו את דגימות במאגר פוספט (0.1 M, pH 7.0) שלוש פעמים, 15 דקות בכל פעם. </li><li style=";text-align:right;direction:rtl"> לטבול ולתקן את דגימות שוב במאגר פוספט (0.1 M, pH 7.0) המכיל 1% [wt / vol] OsO 4 עבור 2 שעות. </li><li style=";text-align:right;direction:rtl"> מייבשים את הדגימות על ידי סדרה מדורגת של אתנול (30%, 50%, 70%, 80%, 90%, 95% ו 100%), 15 דקות בכל פעם. </li><li style=";text-align:right;direction:rtl"> העברה לטבול את דגימות לתוך אצטון 100% במשך 20 דקות. </li><li style=";text-align:right;direction:rtl"> מניחים את הדגימות בתערובת של אצטון 100% ו 100% שרף spurr (1: 1) במשך שעה 1 בטמפרטורת החדר. </li><li style=";text-align:right;direction:rtl"> מעבירים את הדגימות לתערובת של אצטון 100% ו 100% שרף Spurr (1: 3) במשך 3 שעות בטמפרטורת החדר. </li><li style=";text-align:right;direction:rtl"> העברה לטבול את דגימות 100% שרף spurr (מודגרות על 70 מעלות צלזיוס) במשך יותר מ 9 שעות. </li><li style=";text-align:right;direction:rtl"> סעיף דגימות פרפר באמצעות מיקרולי. </li><li style=";text-align:right;direction:rtl"> כתם את הסרטים דק במיוחד (שנרכש בסעיף 3.9) על ידי טבילה ב אצטט uranyl מוחלטת עבור 5-10 דקות, ואחריו טבילה ב 50% אלקטרלי ציטראט להוביל עוד 5-10 דקות. הערה: כרכים של ריאגנטים מנוצל בסעיף 3.1-3.10 תלויים הדגימות. ודא דגימות שקועים ריאגנטים. </li><li style=";text-align:right;direction:rtl"> שימו לב לדגימות במיקרוסקופ אלקטרונים בתדר (15,000X) כדי לקבוע את לוקליזציה, צורה וגודל של חיידקים לשימוש נוסף (ראה סעיף 4.6). </li></ol> 4. Whitefly Bacteriome Dissection וטיהור <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הוסף 100 μL של פתרון 1x PBS על שקופית מיקרוסקופ. בחר כמה 3 rd או 4 th נימפות מן העלים כותנה לטבול אותם לתוך הפתרון PBS. </li><li style=";text-align:right;direction:rtl"> השתמש מחטים אנטומולוגיים בסדר תחת stereomicroscope ולמשוך את הבקטריומים מתוך הגוף פרפר. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחתוך בעדינות חור בצד אחד של נימפה, ולחץ מעט על השניבצד לתת את הבקטריומים החוצה. </li></ol></li><li style=";text-align:right;direction:rtl"> הר microloader 20 μL (עם לחתוך את קצה מוביל כדי לענות על גודל bacteriome) על פיפטה 0.5-10 μL. לחלץ את החיידק הפרט מתוך הפתרון PBS לתוך microloader. </li><li style=";text-align:right;direction:rtl"> לשטוף את bacteriome לחסל את הזיהום של רקמות רקמות אחרות על ידי pipetting את הבקטריום לתוך הפתרון PBS ולחלץ את הבקטריום. חזור שלוש פעמים. </li><li style=";text-align:right;direction:rtl"> מיד פיפטה הבקטריום שטף לתוך צינור צנטריפוגה המכיל 60 μL של פתרון PBS 1x. </li><li style=";text-align:right;direction:rtl"> מזרק לסנן את bacteriome התאספו באמצעות 5 קרום מסנן מיקרומטר (נקבע על ידי גדלים של חיידקים וגרעין של bacteriocyte ב whitefly). חזור על מספר פעמים כדי להעביר את הנוזל המעורב דרך קרום המסנן ביסודיות. הערה: כדי להשיג תוצאה טובה יותר של הגברה ורצף, להרכיב מעל 100 bacteriomes. רטוב קרום המסנן הראשון באמצעות פתרון 1x PBS כדי להפחית את אובדן החיידקיםמחייב את הממברנה. </li></ol> 5. הגברה של הגנום Endosymbiont <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> להגביר את תסנין (בעיקר המכיל endosymbionts של פרפר) באמצעות ערכת הגברה DNA על ידי פרוטוקול מומלץ עם שינוי כלשהו. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בחר את הפרוטוקול המומלץ של הגברה של DNA גנומי מן הדם או תאים ולהכין D2 חיץ לניסוי הבא. </li><li style=";text-align:right;direction:rtl"> להוסיף ישירות 1.5 μL של תסנין (ראה סעיף 4.6) לצינור צנטריפוגה, ואחריו μL 1.5 של D2 הצפת ומערבבים היטב. </li><li style=";text-align:right;direction:rtl"> לדגור על הקרח במשך 10 דקות ולהוסיף 1.5 μL של פתרון להפסיק. </li><li style=";text-align:right;direction:rtl"> הוסף 15 μL של חיץ התגובה 1 μL של פולימראז DNA לערבב בעדינות. </li><li style=";text-align:right;direction:rtl"> לדגור את התערובת על 30 מעלות צלזיוס במשך 16 שעות, ואחריו 3 דקות ב 65 מעלות צלזיוס. </li></ol></li><li style=";text-align:right;direction:rtl"> בצע PCR ישירות על סינון מוגבר (לדלל את הדגימות מוגבר במידת הצורך) באמצעות פריימרים ספציפיים המיועדים bacטריה כדי לאשר את מינים חיידקים (ראה סעיף 2.1). </li><li style=";text-align:right;direction:rtl"> התנהגות PCR כדי לאשר אם יש זיהום של הגנום המארח באמצעות גרגר לבן בטן אקטין ו EF1 primers על פי השיטה שפורסמה בעבר 21 (מתכון ה- PCR מתואר בסעיף 1.4). </li></ol> 6. Endosymbiont Metagenome רצף <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> נושא סינון מוגבר ספקטרופוטומטר ו fluorometer (על פי הוראות היצרן) לפני רצף לבדוק את איכות דגימות ואם הדגימות לעמוד בקריטריונים של רצף. </li><li style=";text-align:right;direction:rtl"> נושא המוגבר לרצף הגנום בהתאם להוראות היצרן. </li></ol>

<ol>
	<li>Buchner, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endosymbiosis+of+animals+with+plant+microorganisms.">Endosymbiosis of animals with plant microorganisms.</a> J. Basic Microbiol. 7 (2), (1967).</li><li>Sloan, D. B., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endosymbiotic+bacteria+as+a+source+of+carotenoids+in+whiteflies.">Endosymbiotic bacteria as a source of carotenoids in whiteflies.</a> Biol. Letters. 8 (6), 986-989 (2012).</li><li>Stouthamer, R., Breeuwer, J. A., Hurst, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+pipientis:+microbial+manipulator+of+arthropod+reproduction.">Wolbachia pipientis: microbial manipulator of arthropod reproduction.</a> Annu. Rev. Microbiol. 53, 71-102 (1999).</li><li>Brumin, M., Kontsedalov, S., Ghanim, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rickettsia+influences+thermotolerance+in+the+whitefly+Bemisia+tabaci+B+biotype.">Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype.</a> Insect Sci. 18 (1), 57-66 (2011).</li><li>Hansen, A. K., Degnan, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+expression+of+conserved+small+RNAs+in+small+symbiont+genomes.">Widespread expression of conserved small RNAs in small symbiont genomes.</a> ISME J. 8, 2490-2502 (2014).</li><li>Moran, N. A., McCutcheon, J. P., Nakabachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomics+and+evolution+of+heritable+bacterial+symbionts.">Genomics and evolution of heritable bacterial symbionts.</a> Annu. Rev. Genet. 42, 165-190 (2008).</li><li>Shigenobu, S., Watanabe, H., Hattori, M., Sakaki, Y., Ishikawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+endocellular+bacterial+symbiont+of+aphids+Buchnera+sp.+APS.">Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS.</a> Nature. 407, 81-86 (2000).</li><li>Nikoh, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+origin+of+insect-Wolbachia+nutritional+mutualism.">Evolutionary origin of insect-Wolbachia nutritional mutualism.</a> Proc. Natl. Acad. Sci. U. S. A. 111 (28), 10257-10262 (2014).</li><li>Sloan, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Parallel+histories+of+horizontal+gene+transfer+facilitated+extreme+reduction+of+endosymbiont+genomes+in+sap-feeding+insects.">Parallel histories of horizontal gene transfer facilitated extreme reduction of endosymbiont genomes in sap-feeding insects.</a> Mol. Biol. Evol. 31 (4), 857-871 (2014).</li><li>Xue, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomes+of+the+rice+pest+brown+planthopper+and+its+endosymbionts+reveal+complex+complementary+contributions+for+host+adaptation.">Genomes of the rice pest brown planthopper and its endosymbionts reveal complex complementary contributions for host adaptation.</a> Genome Biol. 15 (12), 521 (2014).</li><li>Campbell, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+expansion+via+lineage+splitting+and+genomereduction+in+the+cicada+endosymbiont+Hodgkinia.">Genome expansion via lineage splitting and genomereduction in the cicada endosymbiont Hodgkinia.</a> Proc. Natl. Acad. Sci. U. S. A. 112 (33), 10192-10199 (2015).</li><li>Wilson, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+insight+into+the+amino+acid+relations+of+the+pea+aphid,+Acyrthosiphon+pisum,+with+its+symbiotic+bacterium+Buchnera+aphidicola.">Genomic insight into the amino acid relations of the pea aphid, Acyrthosiphon pisum, with its symbiotic bacterium Buchnera aphidicola.</a> Insect Mol. Biol. 19, 249-258 (2010).</li><li>Degnan, P. H., Ochman, H., Moran, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence+conservation+and+functional+constraint+on+intergenic+spacers+in+reduced+genomes+of+the+obligate+symbiont+Buchnera.">Sequence conservation and functional constraint on intergenic spacers in reduced genomes of the obligate symbiont Buchnera.</a> PLoS Genet. 7 (9), e1002252 (2011).</li><li>Nakabachi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+160-kilobase+genome+of+the+bacterial+endosymbiont+Carsonella.">The 160-kilobase genome of the bacterial endosymbiont Carsonella.</a> Science. 314 (5797), 267 (2006).</li><li>De Barro, P. J., Liu, S. S., Boykin, L. M., Dinsdale, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bemisia+tabaci:+a+statement+of+species+status.">Bemisia tabaci: a statement of species status.</a> Annu. Rev. Entomol. 56, 1-19 (2011).</li><li>Himler, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+spread+of+a+bacterial+symbiont+in+an+invasive+whitefly+is+driven+by+fitness+benefits+and+female+bias.">Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias.</a> Science. 332 (6026), 254-256 (2011).</li><li>Bing, X. L., Ruan, Y. M., Rao, Q., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+secondary+endosymbionts+among+different+putative+species+of+the+whitefly+Bemisia+tabaci.">Diversity of secondary endosymbionts among different putative species of the whitefly Bemisia tabaci.</a> Insect Sci. 20 (2), 194-206 (2013).</li><li>Bing, X. L., Yang, J., Zchori-Fein, E., Wang, X. W., Liu, S. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+newly+discovered+symbiont+of+the+whitefly+Bemisia+tabaci+(Hemiptera:+Aleyrodidae).">Characterization of a newly discovered symbiont of the whitefly Bemisia tabaci (Hemiptera: Aleyrodidae).</a> Appl. Environ. Microbiol. 79 (2), 569-575 (2013).</li><li>Kliot, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+in+situ+hybridizations+(FISH)+for+the+localization+of+viruses+and+endosymbiotic+bacteria+in+plant+and+insect+tissues.">Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues.</a> J. Vis. Exp. (84), e51030 (2014).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>Rao, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+reduction+and+potential+metabolic+complementation+of+the+dual+endosymbionts+in+the+whitefly+Bemisia+tabaci.">Genome reduction and potential metabolic complementation of the dual endosymbionts in the whitefly Bemisia tabaci.</a> BMC Genomics. 16 (1), 226 (2015).</li><li>Thao, L. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts.">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li><li>Zhu, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+and+comparison+of+the+Rickettsia+genomes+from+the+whitefly+Bemisia+tabaci+Middle+East+Asia+Minor+I.">Sequencing and comparison of the Rickettsia genomes from the whitefly Bemisia tabaci Middle East Asia Minor I.</a> Insect Sci. 23 (4), 531-542 (2016).</li><li>Gottlieb, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+localization+of+a+Rickettsia+sp.+in+Bemisia+tabaci+(HomopteraAleyrodidae).">Identification and localization of a Rickettsia sp. in Bemisia tabaci (HomopteraAleyrodidae).</a> Appl. Environ. Microbiol. 72 (5), 3646-3652 (2006).</li><li>Zhang, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+temporal+changes+of+primary+and+secondary+bacterial+symbionts+and+whitefly+host+fitness+following+antibiotic+treatments.">Differential temporal changes of primary and secondary bacterial symbionts and whitefly host fitness following antibiotic treatments.</a> Sci. Rep. 5, 15898 (2015).</li><li>Shan, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+changes+of+symbiont+density+and+host+fitness+after+rifampicin+treatment+in+a+whitefly+of+the+Bemisia+tabaci+species+complex.">Temporal changes of symbiont density and host fitness after rifampicin treatment in a whitefly of the Bemisia tabaci species complex.</a> Insect Sci. 23 (2), 200-214 (2016).</li><li>Zchori-Fein, E., Brown, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+prokaryotes+asscociated+with+Bemisia+tabaci+(Gennadius)+(Hemiptera:+Aleyrodidae).">Diversity of prokaryotes asscociated with Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae).</a> Ann. Entomol. Soc. Am. 95 (6), 711-718 (2002).</li><li>Thao, M. L., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+relationships+of+primary+prokaryotic+endosymbionts+of+whiteflies+and+their+hosts.">Evolutionary relationships of primary prokaryotic endosymbionts of whiteflies and their hosts.</a> Appl. Environ. Microbiol. 70 (6), 3401-3406 (2004).</li><li>Zchori-Fein, E., Perlman, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+of+the+bacterial+symbiont+Cardinium+in+arthropods.">Distribution of the bacterial symbiont Cardinium in arthropods.</a> Mol. Ecol. 13 (7), 2009-2016 (2004).</li><li>O'Neill, S. L., Giordano, R., Colbert, A. M., Karr, T. L., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=116S+rRNA+phylogenetic+analysis+of+the+bacterial+endosymbionts+associated+with+cytoplasmic+incompatibility+in+insects.">116S rRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects.</a> Proc. Natl. Acad. Sci. U. S. A. 89 (7), 2699-2702 (1992).</li><li>Nirgianaki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+infections+of+the+whitefly+Bemisia+tabaci.">Wolbachia infections of the whitefly Bemisia tabaci.</a> Curr. Microbiol. 47 (2), 93-101 (2003).</li><li>Everett, K. D., Thao, M. L., Horn, M., Dyszynski, G. E., Baumann, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+chlamydiae+in+whiteflies+and+scale+insects:+endosymbionts+'Candidatus+Fritschea+bemisiae'+strain+Falk+and+'Candidatus+Fritschea+eriococci'+strain+Elm.">Novel chlamydiae in whiteflies and scale insects: endosymbionts 'Candidatus Fritschea bemisiae' strain Falk and 'Candidatus Fritschea eriococci' strain Elm.</a> Int. J. Syst. Evol. Micr. 55, 1581-1587 (2005).</li></ol>

למחברים אין מה לחשוף.

Since the endosymbionts within whiteflies cannot be cultured in vitro, dissection and assembling bacteriocytes is an effective way to obtain enough genetic material of endosymbionts. Before dissection, the species of whitefly and endosymbionts involved should be explicitly confirmed. The whitefly B. tabaci is a species complex with more than 35 morphologically indistinguishable species and different cryptic species may contain different endosymbionts. Portiera is uniformly harbored as an obligate symbiont22, and secondary symbionts vary among species, even the individual whitefly17,21,23. Moreover, although many endosymbionts have been proven to be restrained within bacteriocytes, some may be distributed in the entire body of the whitefly24. Thus, analyzing the localization of different endosymbionts by FISH and TEM is necessary before bacteriome dissection. 
For bacteriome dissection and any subsequent operations, the utilized materials must be strictly sterile to eliminate possible contamination of other bacteria, particularly the PBS solution, the filtration equipment, and the centrifuge tubes. Special care should be taken when filtering the PBS solution containing the bacteriomes to avoid environmental contamination. It is best to use a relatively aseptic environment. In addition, whitefly nymphs can be stored in absolute ethanol at room temperature before dissection, which may be useful to send samples to other places. Nevertheless, dead or environmental stress treated insects should not be used because there would be declination of bacteria25,26. 
In this protocol, the 3rd or 4th instar nymphs were utilized to isolate bacteriome. Compared to other stages of the whitefly, there are several advantages of using the 3rd or 4th instar nymphs for dissection. Firstly, compared to the 1st and 2nd instar nymphs, whiteflies in this stage are obviously larger and not so fragile. Secondly, in the 3rd or 4th instar nymphs of whitefly, bacteriome can be easily distinguished from other tissues of the whitefly body with an obviously yellow color, and bacteriocytes always cluster firmly and can be conveniently separated from other tissues. For the bacteriome in adult whiteflies, once pulled out from the body, bacteriocytes would separate quite easily thus increasing the difficulty in assembly. Hence, the best choice for dissecting bacteriomes is the 3rd or 4th instar nymphs. Nevertheless, this protocol can be used with adult whiteflies for certain experiment needs, with more practice. 
Compared to a previously published method using a single bacteriocyte21, this protocol assembled more bacteriocytes used in the amplification, which contributed to the richness and diversity of bacteriocytes. Furthermore, we utilized filtration to separate symbiont cells from whitefly bacteriocytes, which is more convenient than another method using a micromanipulator and a microinjector. Nevertheless, there were some limitations of this protocol. Firstly, symbionts not confined to bacteriocytes cannot be separated by this method, since we only dissect the bacteriome of the whitefly. Secondly, this protocol cannot absolutely eliminate the contamination of the whitefly genome, since some fragments of whitefly tissues would pass through the filter membrane. Thirdly, clustered symbionts cannot be further separated into individual symbiont species. Hence, obtaining a single species of bacterium accurately and purely requires further study.
In summary, we reported a convenient method for the extraction and purification of endosymbionts from the whitefly B. tabaci that is suitable for subsequent sequencing and analysis. The protocol described here can be easily adapted for the isolation of endosymbionts from other insects for genome sequencing.

חיידקים המרכיבים מערכת יחסים סימביוטית אינטימית עם המארחים היחסיים נפוצים אצל פרוקי רגליים. את endosymbionts הוכחו כדי להשפיע על היבטים של המארחים, כגון מטבוליזם תזונה, רבייה, תגובות ללחץ סביבתי 2 , 3 , 4 וכו &#39; , כמעט בכל שלב התפתחותי 5 . עם זאת, המנגנון העומד בבסיס הארגונים עדיין אינו ידוע. גנומיקה היא בעלת חשיבות עליונה כאשר לומדים את הפונקציות הפוטנציאליות ואת תפקידים של חיידקים. חלק מהמידע הבסיסי, כלומר המעמד הטקסונומי, הגנים הפונקציונליים, מסלולי חילוף החומרים, מערכות ההפרשה, ניתן להסיק מרצפי הגנום, אשר שופכים אורות על התפקידים הפוטנציאליים של סימביונטות בסימביוזה. עם התפתחות של רצף תפוקה גבוהה, מספר עצום של גנומים חיידקים כבר רצף wIth פונקציות מגוונות גילה 6 . Endosymbionts הם בעלי חשיבות חיונית ב hemipterans, כגון כנימות 7 , פשפשים 8 , פסיילים 9 , Planthoppers חום 10 ו cicadas 11 . לדוגמה, בוכנרה ב כנימות, כמו סימביונט חובה, הוכח להיות מעורב חומצות אמינו חיוניות biosynthesis, יחד עם הגנים של הגנום aphid 12 . יתר על כן, תקנה תעתיק של Buchnera נחשף גם 13 . בפסילים, קרסונלה הוא רצף מדורגת הגנום החיידקי הקטן ביותר שנמצא אי פעם 14 . כל אלה סימני ההיכר של endosymbionts מבוססים ו להסיק את רצפי הגנום. בגלל אלה endosymbionts לא יכול להיות מתורבת במבחנה , מספר גישות הוחלו לבודד חיידקים נאותים עבור seqהעלאה. ב כנימות, endosymbionts מופקים באמצעות צנטריפוגה וסינון, ונתונה ניתוח גנומי נוסף transcriptomic 5 . ב planthoppers חום, endosymbionts הם רצף יחד עם גנום חרק כולו 10 . Whitefly B. Tabaci הוא קומפלקס מינים המכיל יותר מ -35 מינים שאינם ניתנים לזיהוי מבחינה מורפולוגית (מינים סתומים), בהם שני מינים פולשניים פלשו לכל רחבי העולם וגרמו לפגיעה עצומה בייצור החקלאי. של הערה, endosymbionts בתוך מינים tabaci B. הראו חשיבות בפיתוח מזיקים 16 . עד כה, שמונה endosymbionts זוהו ב whitefly, כולל symbiont חובה, Candidatus Portiera alerodididum, ושבע סימביונטות משניות המילטונלה , Rickettsia , ארסנופונוס , קרדיניום , &lt;<html> Em&gt; וולבכיה, פריטשה והמיפטריפילוס הגדירו 17 , 18 . שלא כמו ההמיפטרנים שתוארו קודם לכן, הטפטף הלבן הוא חרק זעיר באורך של 1 מ&quot;מ בלבד. רוב endosymbionts מוגבלים bacteriocytes 19 (תאים מיוחדים המכילים symbionts, אשר טופס נוסף bacteriome ב B. tabaci ). בנוסף, אלה endosymbionts לא יכול להיות מתורבת במבחנה . הדרך היחידה להשיג endosymbionts מ B. tabaci היא לנתח את bacteriome החוצה. עם זאת, יש קושי של דיסקציה. ראשית, החיידק השברירי תמיד מקשר עם רקמות אחרות של הפרפר, שקשה להפריד ביניהם. שנית, הגודל הזעיר של הפרפר מגביל את הבידוד של בקטריום מספיק. שלישית, endosymbionts מקבץ בבקטריום, מה שהופך אותו מסובך מאוד לרכוש מינים בודדים של חיידק. התחת = &quot;jove_content&quot;&gt; כאן, אנו מדווחים פרוטוקול פשוט וזול לבודד endosymbionts whitefly עבור רצף metagenome הבאים. באמצעות דיסקציה, טיהור והגברה, ניתן להשיג DNA מתאים ל- endosymbiont וניתן לאשר את מינים של חיידקים. פרוטוקול המתואר ניתן להשתמש באופן דומה אחרים פרוקי רגליים.

<table border="0" cellpadding="0" cellspacing="0" width="775">
	<tbody>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Taq DNA polymerase</td>
			<td style="width:107px;">Takara</td>
			<td style="width:129px;">R001A</td>
			<td style="width:296px;">including rTaq, 10&#215;Buffer and dNTP</td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Gel DNA extraction kit</td>
			<td style="width:107px;">Qiagen</td>
			<td style="width:129px;">28704</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">DNA sample sequencing system</td>
			<td style="width:107px;">ABI</td>
			<td style="width:129px;">ABI-3730XL</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Microtome</td>
			<td style="width:107px;">Leica</td>
			<td style="width:129px;">EM UC7</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Transmission electron microscopy</td>
			<td style="width:107px;">Hitachi</td>
			<td style="width:129px;">H-7650 TEM</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Stereo microscope</td>
			<td style="width:107px;">Zeiss</td>
			<td style="width:129px;">Stemi 2000-C</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">20 &#956;L microloader</td>
			<td style="width:107px;">Eppendorf</td>
			<td style="width:129px;">F2771951</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Filter holder</td>
			<td style="width:107px;">Millipore</td>
			<td style="width:129px;">SX0001300</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Filter membrane filter</td>
			<td style="width:107px;">Millipore</td>
			<td style="width:129px;">SMWP001300</td>
			<td>5.0 &#956;m SMWP</td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">REPLI-g UltraFast Mini Kit</td>
			<td style="width:107px;">Qiagen</td>
			<td style="width:129px;">150033</td>
			<td>DNA amlification kit</td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">NanoDrop</td>
			<td style="width:107px;">Thermo Scientific</td>
			<td style="width:129px;">NanoDrop 2000</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;">Qubit Fluorometer</td>
			<td style="width:107px;">Thermo Fisher Scientific</td>
			<td style="width:129px;">Q33216</td>
			<td></td>
		</tr>
		<tr height="53">
			<td height="53" style="height:53px;width:243px;">Genome Sequencer</td>
			<td style="width:107px;">Illumina</td>
			<td style="width:129px;">Hiseq 2000</td>
			<td></td>
		</tr>
	</tbody>
</table>

methods for the extraction of endosymbionts from the whitefly bemisia tabaci

חיידקים בקטריאליים יוצרים קשר אינטימי עם המארחים שלהם ומעניקים יתרונות למארח ברוב המקרים. מידע גנומי הוא קריטי ללמוד את הפונקציות ואת האבולוציה של חיידקים חיידקים המארח שלהם. כמו רוב symbionts לא יכול להיות מתורבת במבחנה , שיטות לבודד כמות נאותה של חיידקים עבור רצף הגנום חשובים מאוד. ב bemisia bamisia tabaci , מספר endosymbionts זוהו ו צפויים להיות בעל חשיבות בפיתוח ורבייה של מזיקים דרך גישות רבות. עם זאת, המנגנון המסייע לאסוציאציות נותר בלתי מוכר במידה רבה. המכשול נובע באופן חלקי מהעובדה כי endosymbionts ב whitefly, בעיקר מאופק בבקטריוציטים, קשה להפריד בין התאים המארח. כאן אנו מדווחים על פרוטוקול צעד אחר צעד לזיהוי, מיצוי וטיהור של endosymbionts מ whitefly B. tabaci בעיקר על ידי dissectiב ו סינון. דגימות Endosymbiont שהוכנו על ידי שיטה זו, אם כי עדיין תערובת של מינים שונים endosymbiont, מתאימים רצף הגנום הבאים וניתוח של תפקידים אפשריים של endosymbionts ב Tabaci. שיטה זו עשויה לשמש גם לבידוד endosymbionts מ חרקים אחרים.

המזרח התיכון אסיה 1 מינור 1 (MEAM1) מינים של B. Tabaci מורכבים נלקח כדוגמה כאן לתיאור. כותנה לגידול whiteflies וכמה שלבים התפתחותיים של whiteflies מוצגים באיור 1 כולל צמח כותנה, זבוב לבן ו 1 st, 2 nd ו 4 n נימפות ניר של whitefly (3 rd instar נימפה נראה דומה נימפה 4 אינסטאר ). זה היה ברור כי 4 נימפה instar גדול יותר 1 ו 2 נימפות אינסטאר השני ( איור 1 ). ניתוח דגים של Portiera ו המילטונלה בתוך MEAM1 מוצג באיור 2 . אלה שני endosymbionts מוגבלים על bacteriocytes של פרפר, וכן חופפים של שני חיידקים הוא ציין גם. איור 3 מציג את השידור elec<html> תמונות מיקרוסקופיות טרון של endosymbiont Portiera של פרפר, המציין כי Portiera עלול לאבד את קיר התא שלו. עבור רצף, שתי ספריות נבנו, עם הגדלת גדלים של 200 bp ו 2000 bp, בהתאמה. לאחר הרצף, שתי הספריות יצרו 1,626 Mb ו- 1,302 Mb של נתונים גולמיים, בהתאמה. לאחר ניקוי נתוני הזיהום עבור מתאמים ושכפולים, נרכשו 1,484 Mb ו - 1,219 Mb של נתונים נקיים. ההרכבה הניבה בהצלחה רצף גנום מלא עבור סימביונט המחייב, פורטייה . בנוסף, טיוטה הגנום של המילטונלה הושג גם. הרכבה המבוססת על 200 bp ו -2,000 ספריות bp גרמה ל -138 תדרים. על פי יחסי זיווג-קצה, 138 המתקנים הורכבו עוד יותר ל -89 פיגומים ( טבלה 2 ). Figimg &quot;src =&quot; / files / ftp_upload / 55809 / 55809fig1.jpg &quot;/&gt; איור 1: סקירה כללית של מערכת החרקים המשמשת בנייר זה. ( א ) Whiteflies הם גידלו על צמחים כותנה ( Gossypium hirsutum cv. ז &#39;מיאן 1793). ( ב ) מבט של זבוב לבן מבוגר. ( ג ) כמה שלבים התפתחותיים של נימפה instar במחזור החיים של פרפר. החץ האדום מתייחס לביצה של פרפר; חץ שחור מתייחס נימפה 1 st instar של פרפר; חץ לבן מתייחס לנימפה השנייה של פרפר; החץ הכחול מתייחס נימפה 4 אינר של נייטף. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" class="xfigimg" src="/files/ftp_upload/55809/55809fig2.jpg" /> איור 2: ניתוח דגים של Portiera , HamIltonella ב 4 אינסטאר נימפה של MEAM1. בדיקה ספציפית Portiera (אדום) מצומדות ל Cy3, בדיקה Hamiltonella- Specific (ירוק) מסומן עם Cy5 שימשו. סולם ברים = 100 מיקרומטר. ( א ) אותות ההכלאה האדומים מייצגים את הפורטיירה תחת שדה אפל. ( ב ) אותות היברידיזציה הירוק מייצג את המילטונלה תחת השדה החשוך. ( ג ) Portiera ו המילטונלה התמזגה תחת השדה החשוך. ( ד ) Portiera ו- Hamiltonella התמזגו מתחת לשדות בהירים. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <img alt="איור 3" class="xfigimg" src="/files/ftp_upload/55809/55809fig3.jpg" /> איור 3: העברת אלקטרונים מיקרותמונה של Portiera ב Whitefly . חץ מציין את המיקום של Portiera . סולם בר = 1 מיקרומטר. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55809/55809fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> יעד סימביונט </td><td> גן היעד </td><td colspan="3"> רצפי פריימר (5&#39;-3 &#39;) </td><td> הליכי PCR </td><td> הפניות </td></tr><tr><td> פורטירה </td><td> 16R rRNA </td><td colspan="3"> Por-F: TGCAAGTCGAGCGGCATCAT </td><td> 95 ° C 1 דקות, 60 ° C 1 דקות, 72 ° C 1 דקות, 5 מחזורים; </td><td> 27 </td></tr><tr><td></td><td></td><td colspan="3"> Por-R: AAAGTTCCCGCCTTATGCGT </td><td colspan="2"> 9576, C 1 דקות, 58 מעלות צלזיוס 1 דקות, 72 מעלות צלזיוס 1 דקות, 30 מחזורים; </td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 20 דקות </td><td></td></tr><tr><td> המילטונלה </td><td> 16R rRNA </td><td colspan="3"> Ham-F: TGAGTAAAGTCTGGGAATCTGG </td><td> 95 ° C 1 דקות, 60 ° C 1 דקות, 72 ° C 1 דקות, 5 מחזורים; </td><td> 27 </td></tr><tr><td></td><td></td><td colspan="3"> Ham-R: CCCGGGAACGTATTCACCGTAG </td><td colspan="2"> 95 ° C 1 דקות, 58 ° C 1 דקות, 72 ° C 1 דקות, 30 מחזורים; </td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 20 דקות </td><td></td></tr><tr><td> ריקטציה </td><td> 16R rRNA </td><td colspan="3"> Ric-F: GCTCAGAACGAACGCTATC </td><td> 95 מעלות צלזיוס 2 דקות; </td><td> 24 </td></tr><tr><td></td><td></td><td colspan="3"> Ric-R: GAAGGAAAGCATCTCTGC </td><td> 92 ° C 1 דקות, 58 °C 1 דקות, 72 ° C 90 s, 30 מחזורים; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 5 דקות </td><td></td></tr><tr><td> ארסנופונוס </td><td> 23S rRNA </td><td colspan="3"> Ars-F: CGTTTGATGAATTCATAGTCAAA </td><td> 95 ° C 5 דקות; </td><td> 28 </td></tr><tr><td></td><td></td><td colspan="3"> Ars-R: GGTCCTCCAGTTAGTGTTACCCAAC </td><td> 95 ° C 30 s, 60.5 ° C 30, 72 ° C 45 s, 30 מחזורים; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 10 דקות </td><td></td></tr><tr><td> קרדיניום </td><td> 16R rRNA </td><td colspan="3"> Car-F: TACTGTAAGAATAAGCACCGGCC </td><td> 95 ° C 2 דקות </td><td> 29 </td></tr><tr><td></td><td></td><td colspan="3"> Car-R: GTGGATCACTTAACGCTTTCG </td><td> 92 ° C 1 דקות, 57 ° C 1 דקות, 72 ° C 90 s, 30 מחזורים; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 5 דקות </td><td></td></tr><tr><td> וולבכיה </td><td> 16R rRNA </td><td colspan="3"> Wol-F: TTGTAGCCTGCTATGGTATAACT </td><td> 94 ° C 5 דקות; </td><td> 30, 31 </td></tr><tr><td></td><td></td><td colspan="3"> Wol-R: GAATAGGTATGATTTATATGT </td><td colspan="2"> 94 ° C 1 דקות, 55 ° C 1 דקות, 72 ° C 1 דקות, 35 מחזורים </td></tr><tr><td> Fritschea </td><td> 23S rRNA </td><td colspan="3"> Fri-F: GATGCCTTGGCATTGATAGGGGATGAAGGA </td><td> 95 ° C 5 דקות; </td><td> 32 </td></tr><tr><td></td><td></td><td colspan="3"> Fri-R: TGGCTCATCATGCAAAAGGA </td><td> 94 ° C 1 דקות, 64 ° C 1 דקות, 72 ° C 90 s, 35 מחזורים; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 5 דקות </td><td></td></tr><tr><td> המיפטריפילהוס </Em&gt; </td><td> גרגר </td><td colspan="3"> אורקל : F: CACCWAAAATTACTAAAGATGG </td><td> 94 מעלות צלזיוס 3 דקות; </td><td> 18 </td></tr><tr><td></td><td></td><td colspan="3"> ORGROEL - R: TAGAARTCCATWCCKCCCATWC </td><td> 94 ° C 30 s, 52 ° C 30 s, 72 ° C 2 דקות, 34 מחזורים; </td><td></td></tr><tr><td></td><td></td><td colspan="3"></td><td> 72 ° C 10 דקות </td><td></td></tr></tbody></table> טבלה 1: PCR primers ונהלים של endosymbionts ב. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td></td><td> פורטירה </td><td> המילטונלה </td></tr><tr><td> מספר קונטג </td><td> 1 </td><td> 138 </td></tr><tr><td> מספר פיגומים א </strOng&gt; </td><td> 1 </td><td> 89 </td></tr><tr><td> סה&quot;כ אורך, bp </td><td> 358,232 </td><td> 1,711,449 </td></tr><tr><td> N50, bp </td><td> / </td><td> 118,802 </td></tr><tr><td> N90, bp </td><td> / </td><td> 16,753 </td></tr><tr><td> אורך מרבי, bp </td><td> / </td><td> 390,511 </td></tr><tr><td> אורך מינימלי, bp </td><td> / </td><td> 503 </td></tr><tr><td> תוכן GC,% </td><td> °.18 </td><td> 39.89 </td></tr><tr><td colspan="3"> המידע המוצג להלן מבוסס על פיגומים. </td></tr></tbody></table> טבלה 2: תכונות כלליות של פורטייה ו המילטונלה טיוטת הגנום.

Watch this Scientific Journal Video about Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci at JoVE.com

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

כאן, אנו מציגים פרוטוקול לבודד endosymbionts מ tabaci בימייה פרפר באמצעות נתיחה וסינון. לאחר הגברה, דגימות DNA מתאימים לרצף הבאים ולימוד של הדדיות בין endosymbionts ו whitefly.

שיטות להפקת endosymbionts מן Whitefly<em&gt; Bemisia Tabaci</em

Bacterial symbionts form an intimate relationship with their hosts and confer advantages to the hosts in most cases. Genomic information is critical to ...

methods-for-extraction-endosymbionts-from-whitefly-bemisia

Nanyang Technological University

Research

JoVE Journal

Biology

Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

9.8K Views.  Zhejiang University.  כאן, אנו מציגים פרוטוקול לבודד endosymbionts מ tabaci בימייה פרפר באמצעות נתיחה וסינון. לאחר הגברה, דגימות DNA מתאימים לרצף הבאים ולימוד של הדדיות בין endosymbionts ו whitefly. 

Video: Methods for the Extraction of Endosymbionts from the Whitefly Bemisia tabaci

Methods for Patch Clamp Capacitance Recordings from the Calyx

We demonstrate the basic techniques for presynaptic patch clamp recording at the calyx of Held, a mammalian central nervous system nerve terminal. Electrical recordings from the presynaptic terminal allow the measurement of action potentials, calcium channel currents, vesicle fusion (exocytosis) and subsequent membrane uptake (endocytosis). The fusion of vesicles containing neurotransmitter causes the vesicle membrane to be added to the cell membrane of the calyx. This increase in the amount of cell membrane is measured as an increase in capacitance. The subsequent reduction in capacitance indicates endocytosis, the process of membrane uptake or removal from the calyx membrane. Endocytosis, is necessary to maintain the structure of the calyx and it is also necessary to form vesicles that will be filled with neurotransmitter for future exocytosis events. Capacitance recordings at the calyx of Held have made it possible to directly and rapidly measure vesicular release and subsequent endocytosis in a mammalian CNS nerve terminal. In addition, the corresponding postsynaptic activity can be simultaneously measured by using paired recordings. Thus a complete picture of the presynaptic and postsynaptic electrical activity at a central nervous system synapse is achievable using this preparation. Here, the methods for slice preparation, morphological features for identification of calyces of Held, basic patch clamping techniques, and examples of capacitance recordings to measure exocytosis and endocytosis are presented.

We demonstrate the basic techniques for presynaptic patch clamp recording at the calyx of Held, a mammalian central nervous system nerve terminal.

שיטות הצמד תיקון הקלטות קיבול מן Calyx

We demonstrate the basic techniques for presynaptic patch clamp recording at the calyx of Held, a mammalian central nervous system nerve terminal. ...

Micro-dissection of Rat Brain for RNA or Protein Extraction from Specific Brain Region

Micro-dissection of rat brain into various regions is extremely important for the study of different neurodegenerative diseases. This video demonstrates micro-dissection of four major brain regions include olfactory bulb, frontal cortex, striatum and hippocampus in fresh rat brain tissue. Useful tips for quick removal of respective regions to avoid RNA and protein degradation of the tissue are given.

Micro-dissection of rat brain into various regions is extremely important for the study of different neurodegenerative diseases. This video demonstrates micro-dissection of four major brain regions include olfactory bulb, frontal cortex, striatum and hippocampus in fresh rat brain tissue. Useful tips for quick removal of respective regions to avoid RNA and protein degradation of the tissue are given.

Micro-דיסקציה של מוח החולדה עבור הפקת RNA או חלבון מן אזור מסוים במוח

Micro-dissection of rat brain into various regions is extremely important for the study of different neurodegenerative diseases. This video demonstrates ...

RNA Extraction from Neuroprecursor Cells Using the Bio-Rad Total RNA Kit

הפקת RNA מן התאים Neuroprecursor שימוש Bio-Rad סך RNA Kit

Electrophysiological Methods for Recording Synaptic Potentials from the NMJ of Drosophila Larvae

In this video, we describe the electrophysiological methods for recording synaptic transmission at the neuromuscular junction (NMJ) of Drosophila larva. The larval neuromuscular system is a model synapse for the study of synaptic physiology and neurotransmission, and is a valuable research tool that has defined genetics and is accessible to experimental manipulation. Larvae can be dissected to expose the body wall musculature, central nervous system, and peripheral nerves. The muscles of Drosophila and their innervation pattern are well characterized and muscles are easy to access for intracellular recording. Individual muscles can be identified by their location and orientation within the 8 abdominal segments, each with 30 muscles arranged in a pattern that is repeated in segments A2 - A7. Dissected drosophila larvae are thin and individual muscles and bundles of motor neuron axons can be visualized by transillumination1. Transgenic constructs can be used to label target cells for visual identification or for manipulating gene products in specific tissues. In larvae, excitatory junction potentials (EJP&#8217;s) are generated in response to vesicular release of glutamate from the motoneurons at the synapse. In dissected larvae, the EJP can be recorded in the muscle with an intracellular electrode. Action potentials can be artificially evoked in motor neurons that have been cut posterior to the ventral ganglion, drawn into a glass pipette by gentle suction and stimulated with an electrode. These motor neurons have distinct firing thresholds when stimulated, and when they fire simultaneously, they generate a response in the muscle. Signals transmitted across the NMJ synapse can be recorded in the muscles that the motor neurons innervate. The EJP&#8217;s and minature excitatory junction potentials (mEJP&#8217;s) are seen as changes in membrane potential. Electrophysiological responses are recorded at room temperature in modified minimal hemolymph-like solution2 (HL3) that contains 5 mM Mg2+ and 1.5 mM Ca2+. Changes in the amplitude of evoked EJP&#8217;s can indicate differences in synaptic function and structure. Digitized recordings are analyzed for EJP amplitude, mEJP frequency and amplitude, and quantal content.

Here we describe electrophysiological methods for measuring synaptic transmission at the neuromuscular junction of Drosophila larva. Evoked release is initiated artificially by stimulating the motor neuron axons, and transmission through the NMJ can be measured by the postsynaptic response evoked in the muscle.

שיטות אלקטרו עבור הקלטה פוטנציאלים Synaptic מן NMJ של הזחלים תסיסנית

In this video, we describe the electrophysiological methods for recording synaptic transmission at the neuromuscular junction (NMJ) of Drosophila larva. ...

Methods for the Study of the Zebrafish Maxillary Barbel

Barbels are skin sensory appendages found in fishes, reptiles and amphibians. The zebrafish, Danio rerio, develops two pairs of barbels- a short nasal pair and a longer maxillary pair. Barbel tissue contains cells of ectodermal, mesodermal and neural crest origin, including skin cells, glands, taste buds, melanocytes, circulatory vessels and sensory nerves. Unlike most adult tissue, the maxillary barbel is optically clear, allowing us to visualize the development and maintenance of these tissue types throughout the life cycle. 
This video shows early development of the maxillary barbel (beginning approximately one month post-fertilization) and demonstrates a surgical protocol to induce regeneration in the adult appendage (&gt;3 months post-fertilization). Briefly, the left maxillary barbel of an anesthetized fish is elevated with sterile forceps just distal to the caudal edge of the maxilla. A fine, sterile spring scissors is positioned against the forceps to cut the barbel shaft at this level, establishing an anatomical landmark for the amputation plane. Regenerative growth can be measured with respect to this plane, and in comparison to the contralateral barbel. Barbel tissue regenerates rapidly, reaching maximal regrowth within 2 weeks of injury.
Techniques for analyzing the regenerated barbel include dissecting and embedding matched pairs of barbels (regenerate and control) in the wells of a standard DNA electrophoresis gel. Embedded specimens are conveniently photographed under a stereomicroscope for gross morphology and morphometry, and can be stored for weeks prior to downstream applications such as paraffin histology, cryosectioning, and/or whole mount immunohistochemistry. These methods establish the maxillary barbel as a novel in vivo tissue system for studying the regenerative capacity of multiple cell types within the genetic context of zebrafish.

The zebrafish maxillary barbel is an integumentary sense organ containing ectodermal, mesodermal and neural crest derivatives. Importantly, the adult barbel can regenerate after proximal amputation. This video introduces maxillary barbel development and demonstrates a surgical protocol to induce regeneration, followed by collection, embedding and downstream imaging of barbel specimens.

שיטות מחקר של דג הזברה לסתי בינית

Barbels are skin sensory appendages found in fishes, reptiles and amphibians.  The zebrafish, Danio rerio, develops two pairs of barbels- a short nasal ...

Extraction of the EPP Component from the Surface EMG

A surface electromyogram (EMG), especially when recorded near the neuromuscular junction, is expected to contain the endplate potential (EPP) component which can be extracted with an appropriate signal filter. Two factors are important: the EMG must be recorded in monopolar fashion, and the recording must be done so the low frequency signal corresponding the EPP is not eliminated. This report explains how to extract the EPP component from the EMG of the masseter muscle in a human subject. The surface EMG is recorded from eight sites using traditional disc electrodes aligned along over the muscle, with equal inter-electrode distance from the zygomatic arch to the angle of mandible in response to quick gum clenching. A reference electrode is placed on the tip of the nose. The EPP component is extracted from the raw EMGs by applying a high-cut digital filter (2nd dimension Butterworth filter) with a range of 10-35 Hz. When the filter is set to 10 Hz, the extracted EPP wave deflects either negative or positive depending on the recording site. The difference in the polarity reflects the sink-source relation of the end plate current, with the site showing the most negative deflection corresponding to the neuromuscular junction. In the case of the masseter muscle, the neuromuscular junction is estimated to be located in the inferior portion close to the angle of mandible. The EPP component exhibits an interesting oscillation when the cut-off frequency of the high-cut digital filter is set to 30 Hz. The EPP oscillation indicates that muscle contraction is adjusted in an intermittent manner. Abnormal tremors accompanying various sorts of diseases may be substantially due to this EPP oscillation, which becomes slower and is difficult to cease.

The endplate potential (EPP) component can be extracted from the surface EMG using a digital filter. The extracted EPP shows oscillation with a frequency of about 30 Hz.

מיצוי של המרכיב EPP מן Surface EMG

A surface electromyogram (EMG), especially when recorded near the neuromuscular junction, is expected to contain the endplate potential (EPP) component ...

Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously hard to disrupt. Here we describe the use of a bead mill homogenizer for the extraction of proteins into buffers optimized to maintain the functions, interactions and post-translational modifications of proteins. Logarithmically growing cells expressing the protein of interest are grown in a liquid growth media of choice. The growth media may be supplemented with reagents to induce protein expression from inducible promoters (e.g. galactose), synchronize cell cycle stage (e.g. nocodazole), or inhibit proteasome function (e.g. MG132). Cells are then pelleted and resuspended in a suitable buffer containing protease and/or phosphatase inhibitors and are either processed immediately or frozen in liquid nitrogen for later use. Homogenization is accomplished by six cycles of 20 sec&#160;bead-beating (5.5 m/sec), each followed by one minute incubation on ice. The resulting homogenate is cleared by centrifugation and small particulates can be removed by filtration. The resulting cleared whole cell extract (WCE) is precipitated using 20% TCA for direct analysis of total proteins by SDS-PAGE followed by Western blotting. Extracts are also suitable for affinity purification of specific proteins, the detection of post-translational modifications, or the analysis of co-purifying proteins. As is the case for most protein purification protocols, some enzymes and proteins may require unique conditions or buffer compositions for their purification and others may be unstable or insoluble under the conditions stated. In the latter case, the protocol presented may provide a useful starting point to empirically determine the best bead-beating strategy for protein extraction and purification. We show the extraction and purification of an epitope-tagged SUMO E3 ligase, Siz1, a cell cycle regulated protein that becomes both sumoylated and phosphorylated, as well as a SUMO-targeted ubiquitin ligase subunit, Slx5.

The preparation of high quality yeast cell extracts is a necessary first step in the analysis of individual proteins or entire proteomes. Here we describe a fast, efficient, and reliable homogenization protocol for budding yeast cells that has been optimized to preserve protein functions, interactions, and post-translational modifications.

הפקת ניצני שמרים וטיהור חלבון לחקר תפקוד, האינטראקציות, ולאחר translational השינויים

Homogenization by bead beating is a fast and efficient way to release DNA, RNA, proteins, and metabolites from budding yeast cells, which are notoriously ...

The Infiltration-centrifugation Technique for Extraction of Apoplastic Fluid from Plant Leaves Using Phaseolus vulgaris as an Example

The apoplast is a distinct extracellular compartment in plant tissues that lies outside the plasma membrane and includes the cell wall. The apoplastic compartment of plant leaves is the site of several important biological processes, including cell wall formation, cellular nutrient and water uptake and export, plant-endophyte interactions and defence responses to pathogens. The infiltration-centrifugation method is well established as a robust technique for the analysis of the soluble apoplast composition of various plant species. The fluid obtained by this method is commonly known as apoplast washing fluid (AWF). The following protocol describes an optimized vacuum infiltration and centrifugation method for AWF extraction from Phaseolus vulgaris (French bean) cv. Tendergreen leaves. The limitations of this method and the optimization of the protocol for other plant species are discussed. Recovered AWF can be used in a wide range of downstream experiments that seek to characterize the composition of the apoplast and how it varies in response to plant species and genotype, plant development and environmental conditions, or to determine how microorganisms grow in apoplast fluid and respond to changes in its composition.

The Infiltration-centrifugation Technique for Extraction of Apoplastic Fluid from Plant Leaves Using Phaseolus vulgaris as an Example

This protocol details the optimized extraction of apoplast washing fluid from plant leaves, using French bean plants (Phaseolus vulgaris) as a model example.

טכניקת ההסתננות-צנטריפוגה להפקת Apoplastic נוזלים מצמח עלים שימוש<em&gt; Vulgaris Phaseolus</em&gt; כדוגמה

The apoplast is a distinct extracellular compartment in plant tissues that lies outside the plasma membrane and includes the cell wall. The apoplastic ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

בידוד סינון של חומצות גרעין: שיטת הפקת DNA פשוטה ומהירה

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Methods for the Isolation, Culture, and Functional Characterization of Sinoatrial Node Myocytes from Adult Mice

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). These pacemaker APs reflect the coordinated activity of numerous membrane currents and intracellular calcium cycling. However the precise mechanisms that drive spontaneous pacemaker activity in SAMs remain elusive. Acutely isolated SAMs are an essential preparation for experiments to dissect the molecular basis of cardiac pacemaking. However, the indistinct anatomy, complex microdissection, and finicky enzymatic digestion conditions have prevented widespread use of acutely isolated SAMs. In addition, methods were not available until recently to permit longer-term culture of SAMs for protein expression studies. Here we provide a step-by-step protocol and video demonstration for the isolation of SAMs from adult mice. A method is also demonstrated for maintaining adult mouse SAMs in vitro and for expression of exogenous proteins via adenoviral infection. Acutely isolated and cultured SAMs prepared via these methods are suitable for a variety of electrophysiological and imaging studies.

Methods are demonstrated for the isolation of sinoatrial node myocytes (SAMs) from adult mice for patch clamp electrophysiology or imaging studies. Isolated cells can be used directly or can be maintained in culture to permit expression of proteins of interest, such as genetically encoded reporters.

שיטות הבידוד, תרבות האפיון פונקציונלי של myocytes צומת Sinoatrial של עכברים בוגרים

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). ...