This work was supported by awards from the National Institutes of Health, National Heart, Lung and Blood Institute to K.C.V. HL128996, HL113039, and HL116263. This work was also supported by awards from the American Heart Association to K.C.V. CSA2066001, D.L.M POST26630003, and R.M.A. POST25710170.

<ol>
	<li>Vickers, K. C., Roteta, L. A., Hucheson-Dilks, H., Han, L., Guo, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+diverse+small+RNA+species+in+the+deep+transcriptome.">Mining diverse small RNA species in the deep transcriptome.</a> Trends Biochem Sci. 40, 4-7 (2015).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=+MicroRNAs:+genomics,+biogenesis,+mechanism,+and+function."> MicroRNAs: genomics, biogenesis, mechanism, and function.</a> Cell. 116, 281-297 (2004).</li><li>Haussecker, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+tRNA-derived+small+RNAs+in+the+global+regulation+of+RNA+silencing.">Human tRNA-derived small RNAs in the global regulation of RNA silencing.</a> RNA. 16, 673-695 (2010).</li><li>Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extensive+terminal+and+asymmetric+processing+of+small+RNAs+from+rRNAs,+snoRNAs,+snRNAs,+and+tRNAs.">Extensive terminal and asymmetric processing of small RNAs from rRNAs, snoRNAs, snRNAs, and tRNAs.</a> Nucleic Acids Res. 40, 6787-6799 (2012).</li><li>Martens-Uzunova, E. S., Olvedy, M., Jenster, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+microRNA--novel+RNAs+derived+from+small+non-coding+RNA+and+their+implication+in+cancer.">Beyond microRNA--novel RNAs derived from small non-coding RNA and their implication in cancer.</a> Cancer Lett. 340, 201-211 (2013).</li><li>Maute, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=tRNA-derived+microRNA+modulates+proliferation+and+the+DNA+damage+response+and+is+down-regulated+in+B+cell+lymphoma.">tRNA-derived microRNA modulates proliferation and the DNA damage response and is down-regulated in B cell lymphoma.</a> Proc Natl Acad Sci U S A. 110, 1404-1409 (2013).</li><li>Vickers, K. C., Palmisano, B. T., Shoucri, B. M., Shamburek, R. D., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs+are+transported+in+plasma+and+delivered+to+recipient+cells+by+high-density+lipoproteins.">MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins.</a> Nat Cell Biol. 13, 423-433 (2011).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Anal Biochem. 150, 76-85 (1985).</li><li>Chen, C., Khaleel, S. S., Huang, H., Wu, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Software+for+pre-processing+Illumina+next-generation+sequencing+short+read+sequences.">Software for pre-processing Illumina next-generation sequencing short read sequences.</a> Source Code Biol Med. 9, 8 (2014).</li><li>Vickers, K. C., Remaley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipid-based+carriers+of+microRNAs+and+intercellular+communication.">Lipid-based carriers of microRNAs and intercellular communication.</a> Curr Opin Lipidol. 23, 91-97 (2012).</li><li>Greening, D. W., Xu, R., Ji, H., Tauro, B. J., Simpson, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+protocol+for+exosome+isolation+and+characterization:+evaluation+of+ultracentrifugation,+density-gradient+separation,+and+immunoaffinity+capture+methods.">A protocol for exosome isolation and characterization: evaluation of ultracentrifugation, density-gradient separation, and immunoaffinity capture methods.</a> Methods Mol Biol. 1295, 179-209 (2015).</li><li>Sung, B. H., Ketova, T., Hoshino, D., Zijlstra, A., Weaver, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directional+cell+movement+through+tissues+is+controlled+by+exosome+secretion.">Directional cell movement through tissues is controlled by exosome secretion.</a> Nat Commun. 6, 7164 (2015).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25, 402-408 (2001).</li><li>Jung, R., Lubcke, C., Wagener, C., Neumaier, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reversal+of+RT-PCR+inhibition+observed+in+heparinized+clinical+specimens.">Reversal of RT-PCR inhibition observed in heparinized clinical specimens.</a> Biotechniques. 23, (1997).</li><li>Johnson, M. L., Navanukraw, C., Grazul-Bilska, A. T., Reynolds, L. P., Redmer, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heparinase+treatment+of+RNA+before+quantitative+real-time+RT-PCR.">Heparinase treatment of RNA before quantitative real-time RT-PCR.</a> Biotechniques. 35, 1140-1142 (2003).</li><li>Garcia, M. E., Blanco, J. L., Caballero, J., Gargallo-Viola, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoagulants+interfere+with+PCR+used+to+diagnose+invasive+aspergillosis.">Anticoagulants interfere with PCR used to diagnose invasive aspergillosis.</a> J Clin Microbiol. 40, 1567-1568 (2002).</li><li>Yokota, M., Tatsumi, N., Nathalang, O., Yamada, T., Tsuda, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+heparin+on+polymerase+chain+reaction+for+blood+white+cells.">Effects of heparin on polymerase chain reaction for blood white cells.</a> J Clin Lab Anal. 13, 133-140 (1999).</li><li>Bai, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predictive+value+of+quantitative+PCR-based+viral+burden+analysis+for+eight+human+herpesviruses+in+pediatric+solid+organ+transplant+patients.">Predictive value of quantitative PCR-based viral burden analysis for eight human herpesviruses in pediatric solid organ transplant patients.</a> J Mol Diagn. 2, 191-201 (2000).</li><li>McShine, R. L., Sibinga, S., Brozovic, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differences+between+the+effects+of+EDTA+and+citrate+anticoagulants+on+platelet+count+and+mean+platelet+volume.">Differences between the effects of EDTA and citrate anticoagulants on platelet count and mean platelet volume.</a> Clin Lab Haematol. 12, 277-285 (1990).</li><li>Fichtlscherer, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+microRNAs+in+patients+with+coronary+artery+disease.">Circulating microRNAs in patients with coronary artery disease.</a> Circ Res. 107, 677-684 (2010).</li><li>Pritchard, C. C., Cheng, H. H., Tewari, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling:+approaches+and+considerations.">MicroRNA profiling: approaches and considerations.</a> Nat Rev Genet. 13, 358-369 (2012).</li><li>Kirschner, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haemolysis+during+sample+preparation+alters+microRNA+content+of+plasma.">Haemolysis during sample preparation alters microRNA content of plasma.</a> PLoS One. 6, e24145 (2011).</li><li>Kannan, M., Atreya, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+profiling+of+human+red+blood+cells+during+storage+for+52+selected+microRNAs.">Differential profiling of human red blood cells during storage for 52 selected microRNAs.</a> Transfusion. 50, 1581-1588 (2010).</li><li>Chen, S. Y., Wang, Y., Telen, M. J., Chi, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genomic+analysis+of+erythrocyte+microRNA+expression+in+sickle+cell+diseases.">The genomic analysis of erythrocyte microRNA expression in sickle cell diseases.</a> PLoS One. 3, e2360 (2008).</li><li>Balzano, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miRNA+Stability+in+Frozen+Plasma+Samples.">miRNA Stability in Frozen Plasma Samples.</a> Molecules. 20, 19030-19040 (2015).</li><li>Redgrave, T. G., Roberts, D. C., West, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+plasma+lipoproteins+by+density-gradient+ultracentrifugation.">Separation of plasma lipoproteins by density-gradient ultracentrifugation.</a> Anal Biochem. 65, 42-49 (1975).</li><li>Cheung, M. C., Wolf, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+effect+of+ultracentrifugation+on+apolipoprotein+A-I-containing+lipoprotein+subpopulations.">Differential effect of ultracentrifugation on apolipoprotein A-I-containing lipoprotein subpopulations.</a> J Lipid Res. 29, 15-25 (1988).</li><li>Kunitake, S. T., Kane, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+integrity+of+high+density+lipoproteins+in+the+ultracentrifuge.">Factors affecting the integrity of high density lipoproteins in the ultracentrifuge.</a> J Lipid Res. 23, 936-940 (1982).</li><li>Laurent, L. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meeting+report:+discussions+and+preliminary+findings+on+extracellular+RNA+measurement+methods+from+laboratories+in+the+NIH+Extracellular+RNA+Communication+Consortium.">Meeting report: discussions and preliminary findings on extracellular RNA measurement methods from laboratories in the NIH Extracellular RNA Communication Consortium.</a> J Extracell Vesicles. 4, 26533 (2015).</li></ol>

The authors have nothing to disclose.

פרוטוקול זה נועד לכמת miRNAs ו sRNAs אחרים על ידי רצף תפוקה גבוהה או בזמן אמת PCR על HDL טהור מאוד. כמו בכל גישה, שיקולים מיוחדים יש לתת לכל שלב בתהליך של HDL מטהר RNA ואז לכימות sRNAs. פרוטוקול זה מיועד פרויקטים החל ≥ 2 מ&quot;ל של הפלזמה. אף על פי כן, ניתוחי RNA באיכות גבוהה ניתן להשלים בהצלחה עם HDL מטוהר מ קטן כמו 80 μL של מפלזמה אנושית או עכבר באמצעות כרומטוגרפיה זיקה; עם זאת, כרכי פלזמת מוצא גדולים לייצר נתונים טובים יותר באמצעות השיטות שהוצגו כאן. שיטות עיבוד והפקה לדוגמא יכולה דרסטי לשנות מירנה / Srna איכות ואת תשואה. שימוש תרופות נגד קרישת הדם, בעוד חיוני לאיסוף פלזמה, הנראה ישפיע על חילוץ במורד זרם. לדוגמה, הפרין לא יוסר בקלות במהלך החילוץ RNA 14,15, והוא יכול לעכב אנזימים במורד מנוצל PCR 16-18. בנוסף, הere דיווחים כי נתרן ציטרט יכול גם להפריע מדידות qPCR שבו miRNAs ממדגמים EDTA מוצגים השתפרו פרופיל הביטוי לעומת דגימות נתרן ציטרט 16,19,20. מחקרים אלה ממחישים את הצורך שיקול דעת בעת בחירת נוגד קרישה. יתר על כן, בשל פוטנציאל מוגבר תמוגה התא במהלך קרישה, דגימות סרום אינם מומלצים כמו miRNAs הסלולר lysed עשויים לשייך באופן מלאכותי עם ליפופרוטאינים. כמו כן, פלזמה אידיאלי מבודדת מיד כולו דם כדי למנוע זיהום מתאי דם היקפיים אחרים, כולל לויקוציטים lysed. כמו טמפרטורה קרה ידועה להשפיע הפעלה טסיות, דגימות דם כולו הם הסתחררו הרחק אריתרוציטים, לויקוציטים וטסיות ב 3000 XG במשך 15 דקות בטמפרטורת חדר. המוליזה גם מומלצת חולה כמו אריתרוציטים מקרע דווחו גם כדי להשפיע על תוצאות מירנה 21,22, כפי שהם מכילים miRNAs שעשוי להישפך במהלך hemolיסיס 23,24. פלזמה אז יכולה להיות מאוחסן על 4 מעלות צלזיוס למשך 2 - 4 שבועות או לחלופין פלזמה עשויה להיות קפוא ב -80 ° C שבו תוכן מירנה הוא יציבה ובת קיימא הוא בטווח קצר והן בטווח אחסון לטווח ארוך (מקסימום 4 שנים) 25. למיטב הנוכחי שלנו, הקפאת דגימות פלזמה לא נחזה לפגוע HDL-miRNAs דגימות פלזמה מוקפאות מתאימות לניתוח. כפי ליפופרוטאינים ורכיבי דם כולו אחרים יכולים להיות מושפעים על ידי צריכת מזון, איסוף דם בצום הוא מועדף. כאמור, HDL בפלזמה ניתן לבודד באמצעות מספר שיטות סטנדרטיות, כולל DGUC, FPLC, ו כרומטוגרפיה זיקה נגד apoA-לי. . בידוד של ליפופרוטאינים פלזמה ידי DGUC באמצעות KBR, כפי שתואר על ידי Redgraves ואח 26, מפריד VLDL (ד = 0.94 - 1,006 גר &#39;/ מ&quot;ל), LDL (ד = 1,006 - 1,063 גרם / מ&quot;ל) וה- HDL (ד = 1.063-1.21 g / מיליליטר) ומהווה שיטה אידיאלית עבור כמויות גדולות של פלזמה (2 - 60 מיליליטר לדגימה). המגבלהבאמצעות גישה זו לבדה היא exosomes ו מירנה אחרת המכילה כלי רכב חשמליים מדווחות יש צפיפות דומה HDL ועלולים להיות נוכח HDL DGUC (איור 2 א). חסרונות נוספים כוללים ניזק מבנים ניתן חלבונים כתוצאה מחשיפת מלח גבוהה מאגרים וכוחות ultracentrifugation חזקים כמו גם יציבות הפרש של תת-מחלקות HDL 27,28. למרות זאת, DGUC הוא נפוץ כמו התוצאה היא תשואה גבוהה של חלבון ה- HDL, ייצור קרוב ל -1 מ&quot;ג של חלבון HDL לכל 1 מ&quot;ל של פלזמה 29. הגישה FPLC, הכוללת סינון ג&#39;ל בגודל הדרה, דורש פחות זמן, תלוי בקצב זרימה (כ 6 שעות), ויש לו דיוק רב יותר להפריד HDL מן ליפופרוטאין המכיל apoB (לפי גודל) ותת-בכיתותיהם, כולל כלי רכב חשמליים כי הם הרבה יותר גדולים מאשר HDL אבל יש צפיפויות דומות. יצוין כי שימוש בשיטות שפורטו בפרוטוקול זה, שלפוחית ​​פלזמה בין כ 220 - 75 ננומטר בקוטר לאלעורר חתימת שומנים או חלבון שניתן לזיהוי כאשר מופרדות FPLC. בהתאם ההגדרה, FPLC דורש קלט קטן יחסית, 0.3 - 1 מיליליטר, אשר הוא שימושי עבור פלזמה מכרסמת aliquots הקפוא הקטן. מבחני כולסטרול colorimetric מהירים חשובים אף הם באים FPLC לאשר חלוקת HDL או שברים ליפופרוטאין אחרים. חלוקה מדללת דגימות ליפופרוטאינים; עם זאת, דגימות אז יכולות להיות מרוכזות באמצעות מסנני גודל צנטריפוגלי סטנדרטיים (למשל, 10 kDa MW חתוכים מסנן). בידוד HDL ידי apoA-I IP באמצעות עמודות מיקרו-ספין הם המהירה של שלוש גישות, אבל הם מוגבלים על ידי קלט נמוך (0.08 - 1 μL) נפח תשואה נמוכה (כ 0.1 מ&quot;ג). בעוד apoA-I IP יכול להיות מייגע, שיטה זו היא אידיאלית עבור supernatants תרבית תאים בנפח נמוך. בעוד כל אחת משיטות אלו יש את נקודות החוזק והחולשה, ניתן להפחית אלה אם נעשה שימוש טנדם (למשל, DGUC ואחריו FPLC). שימוש בשתי גישות במקבילות, תוצאות בטהרה גדולה יותר שלHDL לניתוח מירנה Srna. כאן, אנו פירט את הצעדים הנדרשים כדי לבודד HDL טהור מאוד בשיטת טנדם של DGUC ואחריו FPLC והתווה את הצעדים המשמשים לכמת HDL-miRNAs ו sRNAs או באמצעות רצף תפוקה גבוהה או בזמן אמת PCR. למרות בפרוטוקול זה תוכנן עבור HDL, יש לו תחולה גדולה בכימות sRNAs על ליפופרוטאינים אחרים, כולל LDL ו- VLDL, מבוסס על הצפיפויות והגדלים שלהם.

RNA הקטן ללא קידוד התאי (sRNAs) מייצג סוג חדש של סמנים ביולוגיים למחל מטרות טיפוליות פוטנציאליות להקל סביר תא אל תא תקשורת 1. הסוג למד הנרחב ביותר של Srna הוא מייקרו-רנ&quot;א (מירנה) שהם כ 22 nts באורך מעובדים מצורות מבשרות עוד תעתיק עיקרי 2. miRNAs הודגם שלאחר יעתיק לווסת ביטוי גנים באמצעות דיכוי תרגום חלבון והאינדוקציה של שפלת mRNA 2. אף על פי כן, miRNAs הוא רק אחד מסוגים רבים של sRNAs; כמו sRNAs ניתן ביקע מן tRNAs הורה (sRNAs הנגזרות tRNA, TDR), RNAs גרעיני קטן (Srna הנגזרות sRNAs, sndRNA), RNAs nucleolar קטן (snoRNA הנגזרות sRNAs, snRNA), RNAs ריבוזומלי (rRNA הנגזרות sRNAs, RDR RNAs, Y) (yDR), ו RNAs השונה אחרת 1. הנה כמה דוגמאות של sRNAs הרומן האלה דווחו לתפקד דומה miRNAs; לעומת זאת, פו הביולוגיnctions של רבי sRNAs אלה עדיין לא נקבע, אף תפקידי ויסות גנים צפויים 3-6. הדבר המעניין ביותר, miRNAs ו sRNAs אחרים נוכחים ביציבות בנוזלי תאיים, כולל רוק, פלזמה, שתן, ומרה. sRNAs התאי מוגן סביר מן RNases דרך התקשרותן עם שלפוחית ​​תאית (EV), ליפופרוטאינים, ו / או מתחמי ribonucleoprotein תאיים. בעבר, דיווחנו ליפופרוטאינים כי, כלומר ליפופרוטאין בצפיפות גבוהה (HDL), miRNAs תחבורה בפלסמה 7. במחקר זה, HDL בודדו בשיטה סדרתית של ultracentrifugation צפיפות שיפוע (DGUC), כרומטוגרפיה נוזלית מהיר חלבון (סינון ג&#39;ל כרומטוגרפיה בגודל הדרה, FPLC), ו כרומטוגרפיה זיקה (אנטי-אפוליפופרוטאין AI (apoA-לי immunoprecipitation) 7). שימוש בשני מערכים בצפיפות נמוכה בזמן אמת מבוססי PCR מבחני מירנה בודדים, רמות מירנה כומתו על HDL מבודד לרפאעמך ונושאים hypercholesterolemic 7. בגישה זו, הצלחנו פרופיל miRNAs ולכמת miRNAs הספציפי בהכנות HDL טהורות מאוד. מאז 2011, קבענו כי למרות כרומטוגרפיה זיקת משפר טוהרת HDL, רווית נוגדן מגבילה במידה ניכרת תשואה, והוא יכול להיות עלות אוסרני. נכון לעכשיו, הפרוטוקול שלנו ממליץ על שיטת טנדם רציפי שני שלבים של DGUC ואחריו FPLC, שיוצרים גם דגימות HDL באיכות גבוהה עבור בידוד RNA למטה זרם וכימות Srna. בשל ההתקדמות רצף תפוקה גבוהה של sRNAs (sRNAseq), למשל, miRNAs, והגברת המודעות של מעמדות אחרים שאינם מירנה Srna, sRNAseq הוא המדינה- of-the-art הנוכחי פרופיל מירנה Srna. ככזה, הפרוטוקול שלנו ממליץ miRNAs לכימות sRNAs אחר על דגימות HDL באמצעות sRNAseq. אף על פי כן, RNA הכולל מבודד HDL יכול לשמש גם לכמת miRNAs פרט sRNAs אחר או לאמת תוצאות sRNAseq באמצעות בזמן אמת PCRpproaches. כאן אנו מתארים בפרוטרוט פרוטוקול לאיסוף, טיהור, כימות, ניתוח נתונים, ואימות של sRNAs HDL טהור מאוד. המטרה הכללית של מאמר זה היא להוכיח את ההיתכנות ואת תהליך של כימות Srna ב- HDL טהור מאוד מבודד מפלסמה אנושית.

<table border="0" cellpadding="0" cellspacing="0" style="width:1033px;" width="1033">
	<tbody>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Ultracentrifuge&#160;</td>
			<td style="width:207px;">Beckman Coulter</td>
			<td style="width:205px;">A99839</td>
			<td style="width:307px;">Optima XPN-80</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Ultracentrifuge Rotor</td>
			<td style="width:207px;">Beckman Coulter</td>
			<td style="width:205px;">331362</td>
			<td>SW-41Ti</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">AKTA Pure FPLC System</td>
			<td style="width:207px;">GE Healthcare</td>
			<td style="width:205px;">29018224</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">3X FPLC Superdex 200 Increase Columns In-line</td>
			<td style="width:207px;">GE Healthcare</td>
			<td style="width:205px;">28990944</td>
			<td>10/300 gl</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">SynergyMx</td>
			<td style="width:207px;">BioTek Instruments</td>
			<td style="width:205px;">7191000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Tabletop centrifuge</td>
			<td style="width:207px;">Thermo Scientific</td>
			<td style="width:205px;">75004525</td>
			<td>Sorvall ST40R</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Refrigerated centrifuge</td>
			<td style="width:207px;">Eppendorf</td>
			<td style="width:205px;">22629867</td>
			<td>5417R (purchased through USA Scientific)</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Microfuge&#160;</td>
			<td style="width:207px;">USA Scientific</td>
			<td style="width:205px;">2631-0006</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">PippenPrep</td>
			<td style="width:207px;">Sage Science</td>
			<td style="width:205px;">PIP0001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">2100 Bioanalyzer&#160;</td>
			<td style="width:207px;">Agilent</td>
			<td>G2938B</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">High Sensitivity DNA Assay</td>
			<td style="width:207px;">Agilent</td>
			<td>5067-4626</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Sequencing Library qPCR Quantification Kit</td>
			<td style="width:207px;">Illumina</td>
			<td>SY-930-1010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">ProFlex Thermal Cycler</td>
			<td style="width:207px;">Applied Biosystems</td>
			<td style="width:205px;">4484073</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">QuantStudio 12k Flex</td>
			<td style="width:207px;">Applied Biosystems</td>
			<td style="width:205px;">4471134</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">EpMotion Robot</td>
			<td style="width:207px;">Eppendorf</td>
			<td style="width:205px;">960000111</td>
			<td>5070</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Ultra-clear centrifuge tubes</td>
			<td style="width:207px;">Beckman Coulter</td>
			<td style="width:205px;">344059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Potassium Bromide</td>
			<td style="width:207px;">Fisher Chemicals</td>
			<td style="width:205px;">P205-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">15 mL conical tube</td>
			<td style="width:207px;">Thermo Scientific</td>
			<td style="width:205px;">339650</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Micro-centrifugal filters 0.45&#181;m</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:205px;">UFC30HV00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Micro-centrifugal filters 0.22&#181;m</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:205px;">UFC30GV00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">miRNAEasy Total RNA Isolation Kits</td>
			<td style="width:207px;">Qiagen</td>
			<td style="width:205px;">217004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Total Cholesterol colormetric kit</td>
			<td style="width:207px;">Cliniqa (Raichem)</td>
			<td style="width:205px;">R80035</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">10,000 m.w. cut-off centrifugation filter</td>
			<td style="width:207px;">Amicon</td>
			<td style="width:205px;">UFC801024</td>
			<td>purchased through Millipore</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">PCR strip tubes</td>
			<td style="width:207px;">Axygen</td>
			<td style="width:205px;">PCR-0208-C</td>
			<td>purchased through Fisher</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">microRNA RT kit</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:205px;">4366597</td>
			<td>For 1000 reactions</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">PCR master mix</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:205px;">4440041</td>
			<td>50 mL bottle</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Pierce BCA kit</td>
			<td style="width:207px;">Thermo Scientific</td>
			<td style="width:205px;">23225</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Clean and Concentrator Kit</td>
			<td style="width:207px;">Zymo</td>
			<td style="width:205px;">D4014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Dialysis tubing</td>
			<td style="width:207px;">Spectrum Labs</td>
			<td style="width:205px;">132118</td>
			<td>purchased through Fisher</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">bcl2fastq2</td>
			<td style="width:207px;">Illumina</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Cutadapt</td>
			<td>https://github.com/marcelm/cutadapt</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">NGSPERL</td>
			<td>github.com/shengqh/ngsperl</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">CQSTools</td>
			<td>github.com/shengqh/CQS.Tools</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">Bowtie 1.1.2&#160;</td>
			<td>http://bowtie-bio.sourceforge.net</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
		<tr height="21">
			<td height="21" style="width:315px;height:21px;">GeneSpringGX13.1.1</td>
			<td style="width:207px;">Agilent</td>
			<td style="width:205px;">n/a</td>
			<td>Software</td>
		</tr>
	</tbody>
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
</table>

isolation of high-density lipoproteins for non-coding small rna quantification

המגוון של RNAs ללא קידוד קטן (Srna) היא מתרחבת במהירות ותפקידיהם בתהליכים ביולוגיים, כולל ויסות הגנים, הם מתעוררים. הדבר המעניין ביותר, sRNAs הם גם מצאו מחוץ לתאים ו נמצאים ביציבות בכל נוזלים ביולוגיים. ככזה, sRNAs התאי מייצג סוג רומן של סמנים ביולוגיים למחלות קרובות לוודאי מעורב איתות תא ורשתות תקשורת בין תאית. כדי להעריך את הפוטנציאל שלהם לשמש כסמנים ביולוגיים, sRNAs ניתן לכמת בפלסמה, בשתן, ונוזלים אחרים. אף על פי כן, כדי להבין את ההשפעה מלאה של sRNAs תאי כאותות האנדוקרינית, חשוב לקבוע אילו ספקים מעבירים והגנה אותם הנוזלים ביולוגיים (למשל, פלזמה), אשר תאים ורקמות לתרום ברכות Srna תאיות, ותאים ורקמות מסוגלות קבלה וניצול Srna התאי. כדי להשיג מטרות אלו, חשוב לבודד אוכלוסיות טהורות מאוד של ספקים תאייםעבור פרופיל וכימות Srna. אנחנו הוכחנו בעבר כי ליפופרוטאינים, במיוחד ליפופרוטאין בצפיפות גבוהה (HDL), להעביר מייקרו RNA הפונקציונלי (מירנה) בין תאים ו- HDL-miRNAs הם שינו באופן משמעותי מחלה. כאן, פרט לנו פרוטוקול חדש אשר מנצל בידוד HDL בד בבד עם ultracentrifugation צפיפות שיפוע (DGUC) ומהר-חלבון נוזלי כרומטוגרפיה (FPLC) להשיג HDL טהור מאוד עבור פרופיל במורד וכימות של כל sRNAs, כולל miRNAs, הן באמצעות גבוהה רצף -throughput וגישות PCR בזמן אמת. פרוטוקול זה יהיה משאב יקר ערך עבור החקירה של sRNAs על HDL.

פרוטוקול זוהי סדרה של שיטות הוקמה מקושר יחד כדי לאפשר כימות של sRNAs על HDL טהור מאוד על ידי רצף תפוקה גבוהה או בזמן אמת PCR (איור 1). כדי להוכיח את ההיתכנות וההשפעה של פרוטוקול זה, HDL היה מטוהרים מפלסמה אנושית בשיטת טנדם DGUC ו FPLC. מקטעים שנאספים FPLC המתאים HDL (על ידי חלוקת כולסטרול) רוכזו ו- RNA הכולל היה מבודד 1 מ&quot;ג של HDL (חלבון כולל). ספריות Srna נוצרו עם HDL שנאסף n = 4 בבני אדם בריאים. כל דגימות והדם / פלזמה נאספו תחת פרוטוקול פעיל מוסדי מועצה לביקורת (# 070,416), ונושאי אדם לומדים עם הסכמה מדעת, כפי שאושרו על ידי האוניברסיטה ונדרבילט לרפואה. ספריות Srna הוכנו היו רצף ב טכנולוגיות ונדרבילט עבור Genomics המתקדם (VANTAGE) ניתוחי מרכז רצפי DNA ונתונים בוצעובאמצעות צינורות ללא צורך במיקור חוץ. תצוגות נתונים שנוצרו על ידי גרפי תוכנה. הצורך הקריטי לבצע שיטה שנייה (FPLC) לבידוד HDL לאחר DGUC נובע אפשרית שיתוף טיהור של EVS. מכוניות חשמליות הם מחלקה כללית של שלפוחית הנגזרות הממברנה כי מקורן בגופים multivesicular (exosomes), קרום הפלזמה ניצני (microvesicles), ותהליכים אחרים, לרבות גופים אפופטוטיים 10. כלי רכב חשמליים, כלומר exosomes, דווחו יש צפיפות דומה כמו HDL הקטן (איור 2 א), ובכך, יכולים להיות נוכח שבר צפיפות HDL (1.063-1.21 g / מיליליטר) לאחר DGUC 11,12. כדי להסיר כלי רכב חשמליים ו ליפופרוטאינים אחרים (למשל, LDL), מ DGUC-HDL, FPLC שימש HDL נפרד מן שלפוחית וחלקיקים אחרים לפי גודל; HDL (7 - 12 ננומטר בקוטר) ו כלי רכב חשמליים (40 - 220 ננומטר בקוטר) הם מופרדים בקלות בשל הבדלי הגודל שלהם (איור 2 א &#39;, ב&#39;). חלק HDLהים היה ברור ממבט הראשון בשל חלוקת הכולסטרול, DGUC-HDL FPLC שברים היו נקוו ומרוכז באמצעות 10 kDa חתוכים מסננים צנטריפוגה. המרוכז HDL נאסף והשתמש לניתוח RNA במורד זרם (איור 2 ב). כדי להמחיש את הנקודה הזו, פלזמה מראש DGUC היה מופרד באמצעות FPLC וחלוקת פוספוליפידים (phosphatidylcholine, PC); כולסטרול כללי (TC), ורמות חלבון כומתו זממו ברחבי שברים. PC, TC, וחלבוני רמות כומתו באמצעות שלוש ערכות colorimetric. כל שלושה הפרמטרים שהוגדרו שברי HDL בבירור (19 - 24) ושברי VLDL / LDL (14 - 18). בפלזמה FPLC-מופרד, אותות חלבון והשומן אותרו מינימאליים או לא זוהו כלל שברים מתאימים שלפוחית גדלה יותר מ VLDL (שנשארה קופסא כתומה) (איור 3 א). כדי להדגים הפרדת DGUC של HDL, DGUC-HDL היה מופרד גם על ידי FPLC ו- PC, TC, ורמות חלבונים היו quantifIED (איור 3 ב). שרטוט ערכים אלה ממחיש את שיתוף חלוקה של כמות קטנה של LDL באמצעות DGUC ומחזק את הצורך להשתמש טנדם הגישה DGUC-FPLC לבודד HDL טהור מאוד. למרות מכוניות חשמליות הם חזו לשתף fractionate עם HDL במהלך DGUC חל מעט במעלה נמצא השומנים והחלבונים שברים המתאימים שלפוחית גדלה יותר מ LDL (איור 3 ב). שומני EV וחתימת חלבון בטווח גודל החזה הוא גם מינימאלי לזיהוי או נעדר DGUC-VLDL ו DGUC-LDL כאשר יחלקו FPLC (מידע לא מוצג). לניתוח RNA, RNA הכולל היה מבודד 1 מ&quot;ג של HDL מטוהרים במקביל לייצור הספרייה Srna. בקצרה, מתאמים היו ligated ל 3 &#39;ולאחר מכן 5&#39; קצוות הטרמינל של sRNAs, כולל miRNAs ו tDRs (איור 4 א). מוצרים ligated תומללו הפוך (RT) ו- PCR מוגבר באמצעות פריימרים PCR מחסה אינדקסים ספציפיים המיועדים דגימות ריבוב במהלך דאותגובות רצף nstream (איור 4 א). כל מתאם הוא 61 nts באורך; אם כן, ligated מירנה (כ 22 nts אורך) יפיק תוצר של 144 nts באורך. SRNAs הלא מירנה הרב מעט יותר miRNAs (למשל, 30 - 35 nts אורך). ככזה, האורך של מוצר במיקוד שלנו היה 156 bps באורך. מוצרים מוגברים היו שנבחר גודל באמצעות בורר גודל DNA אוטומטית וכל מוצרי cDNA 135 - 177 bps באורך נאספו (איור 4 א). האיכויות של ספריות גודל שנבחרו הוערכו על ידי שבבי דנ&quot;א רגישות גבוהה באמצעות bioanalyzer (איור 4B). Srna cDNA ספריות בגודל זה הופיע מעט גדול בגודל בשל אפשרי &quot;מבעבע&quot; תופעות במהלך הניתוח. עבור סידור מרובב, ריכוזים equimolar של ספריות cDNA היו נקווה, ניקה, מרוכז, reanalyzed באמצעות bioanalyzer (איור 4B). המדגם מרובב היה אז sequenCED באמצעות פרוטוקול נ&quot;ב יחיד לקרוא 50. ללא צורך במיקור חוץ צינורות ניתוח הנתונים שמשו demultiplex דגימות מבוססות על אינדקסים, לקצץ מתאמים, מדדי בקרת איכות לרוץ, ליישר את הגנום האנושי ולספור sRNAs המבואר. חלוקת מנורמל קורא (קורא למיליון, סל&quot;ד),&gt; 16 nts אורך, להמחיש את העשרת sRNAs 20 - 22 nts באורך ו -34 - 35 nts באורך על HDL (איור 4C). יישור וניתוח לספור של ארבע ספריות HDL-Srna מצא כי 38% של קורא יישור לאזורים המבואר של הגנום האנושי היו miRNAs (איור 5 א). לא פחות בשפע (37%) היו sRNAs-נגזר tRNAs (tDRs). sRNAs-נגזר RNAs השונה (למשל, Y RNAs), rRNAs, smRNAs, snoRNAs, ו RNAs ללא קידוד הארוך (lincRNAs) נכח גם על HDL (איור 5 א). לאחר נורמליזציה למספר הכולל של קורא לכל קבוצה, 50 העליון ביותר miR בשפעNAS (קורא Per ממופה מירנה, RPMM, איור 5), tDRs (קורא Per ממופה tDRs, RPMT, איור 5 ג), ו-TDR הלא sRNAs הלא מירנה האחרת (קורא Per ממופה Srna, RPM, איור 5D) אורגנו על ידי heatmaps . נתונים אלה ממחישים את הדמיון (למשל, HDL-miRNAs) והבדלים (למשל, tDRs) של HDL-sRNAs הנפוץ ביותר על פני אנשים בריאים (איור 5 ב-ד). תוצאות אלו מראות את העצמה של אסטרטגיה זו ופרוטוקול לספק תובנות מדהימים לתוך להובלת sRNAs ידי HDL. אף על פי כן, רצף Srna אין להסתמך על כדי לכמת מוחלט. sRNAs עניין צריך להיות מאומת על ידי PCR בזמן אמת. כמו כן, חוקרים רבים עשויים לדרוש רק את כימות של miRNAs פרט על HDL. ככזה, הכולל HDL RNA היה מבודד מכל נושא כימות יחסית של HDL-miRNAs באמצעות בזמן אמת PCR. חמישה miRNAs שופע יותר זוהה על HDL ידי sRNAseq שימשו Real-פעמית מבחני PCR כדי לקבוע רמות שלהם על כל דגימה HDL (איור 5E). הערכים הכמותיים ביחס חושבו באמצעות משק שרירותי CT של 32 (RQV = 2 - ΔCtArb) מנורמל 1,000 מיקרוגרם של קלט חלבון HDL לתוך בידוד RNA 13. תוצאות מהמחקר בזמן אמת PCR להוכיח כי פרוטוקול זה הוא גם יקר באיתור HDL-miRNAs וכימות ההבדלים על פני יחידים. באופן קולקטיבי, השרטוטים שהוצגו להגדיר את הפרטים הקריטיים של השיטות, והתוצאות משתי רצף תפוקה גבוהה בזמן אמת גישות PCR לייצג את התוצרים של פרוטוקול זה. <img alt="איור 1" src="/files/ftp_upload/54488/54488fig1.jpg" /> איור 1. נציגי זרימת תרשים של הפרוטוקול. HDL טהור מבודד ultracentrifugation שיפוע צפיפות chromatog מהר חלבון נוזלי<html> רפים. סה&quot;כ HDL RNA יכול להיות מנוצל אז עבור RNA הקטן (Srna) רצף. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig1large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 2" src="/files/ftp_upload/54488/54488fig2.jpg" /> בידוד איור 2. של HDL. (א) תרשים של הצפיפות בקוטר של ליפופרוטאינים ועל שלפוחית תאית (EV). (ב) סכמטי של בידוד HDL טנדם הרציף, כולל הפרדת פלזמה, ultracentrifugation שיפוע צפיפות (DGUC), מהר-חלבון כרומטוגרפיה נוזלית (FPLC), סינון, וריכוז. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig2large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> pload / 54488 / 54488fig3.jpg &quot;/&gt; איור 3. כרומטוגרפיה נוזלית מהיר-חלבון (FPLC) הפרדה ליפופרוטאינים EV, שלפוחית תאית.; VLDL, ליפופרוטאין בצפיפות נמוכה מאוד; LDL, ליפופרוטאין בצפיפות נמוכה; HDL, בצפיפות גבוהה ליפופרוטאינים; FP, חלבון חופשי; PC, phosphatidylcholine; ו TC, כולסטרול כללי. קו אדום, TC; קו כחול, חלבון, וקו שחור, PC. הפרדת ליפופרוטאינים מ- (A) מפלסמה אנושית לפני ultracentrifugation צפיפות שיפוע (DGUC) ו- (ב) חלק HDL לאחר DGUC. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig3large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 4" src="/files/ftp_upload/54488/54488fig4.jpg" /> דור איור 4. RNA קטנים הספריות. (א) סכמטי של RNA הקטן (Srna) ג ספרייהonstruction וגדל-בחירה. מירנה, microRNA; TDR, tRNA הנגזרות sRNAs; Srna, הלא מירנה שאינם TDR sRNAs; RT, שעתוק לאחור; נ&quot;ב, זוג בסיס; ו cDNA, משובטים DNA. (ב) ניתוח של ספריות HDL-Srna לפני ואחרי ריבוב באמצעות שבבים DNA רגישות גבוהה bioanalyzer. (C) חלוקת אורך של HDL-Srna קורא לאחר רצף. סל&quot;ד, קורא למיליון; M, בו נבדקים ממין זכר; F, נושאים נקבה; ו NT, נוקליאוטידים. N = 4. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig4large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <img alt="איור 5" src="/files/ftp_upload/54488/54488fig5.jpg" /> גיוון איור 5. של HDL-sRNAs. (א) חלוקת HDL-sRNAs בסוגי Srna. שבר של קורא מיושר sRNAs המבואר בגנום האנושי. (BD) heatmaps N = 4 דגימות HDL-Srna. <strאונג&gt; (B) Top 50-רנ&quot;א HDL הנפוץ ביותר (מירנה). 2 התחבר קורא Per הממופה מירנה, RPMM. (C) Top 50 בשכיחותו sRNAs HDL-tRNA הנגזרת (tDRs). התחבר 2 קורא Per ממופים TDR, RPMT. (ד) Top 50 בשכיחותו-HDL אחרים שאינם מירנה ולא TDR sRNAs (Srna). התחבר 2 קורא Per ממופים Srna, RPMs. (E) כימות PCR בזמן אמת של HDL-miRNAs. M, בו נבדקים ממין זכר; F, נחקרות. ערך כמותי יחסית נקבע על ידי CT משק שרירותי = 32, מנורמל 1,000 מיקרוגרם של קלט חלבון HDL 13. N = 4. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54488/54488fig5large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> 1. אנטי-אוקסידנטים להפרדת Lipoprotein </td><td> בצע פתרון המניה ב 100x </td&gt; </tr><tr><td> EDTA </td><td> חומצת Ethylenediaminetetraacetic (0.5 M מלאי) </td></tr><tr><td> AZT </td><td> 3-אמינו-1,2,4-triazole: 42 מ&quot;ג / מ&quot;ל H 2 O </td></tr><tr><td> BHT </td><td> Butylated Hydroxytoluene: 25 מ&quot;ג / 100 μL EtOH </td></tr><tr><td> TROLOX </td><td> (+) - 6-הידרוקסי-2,5,7,8-tetramethylchromane-2-קרבוקסיליות חומצה: 41.7 מ&quot;ג / 500 μL EtOH </td></tr><tr><td> 2. פתרונות כיסוי </td><td></td></tr><tr><td> פתרון # 1 </td><td> 1.019 גרם / מ&quot;ל H 2 O </td></tr><tr><td> פתרון # 2 </td><td> 1.025 גרם / מ&quot;ל KBR / H 2 O </td></tr><tr><td> פתרון # 3 </td><td> 1.063 גרם / מ&quot;ל KBR / H 2 O </td></tr><tr><td> פתרון # 4 </td><td> 1.080 גרם / מ&quot;ל KBR / H 2 O </td></tr><tr><td> פתרון # 5 </td><td> 1.255 גרם / מ&quot;ל KBR / H 2 O </td></tr><tr><td> 3. הצפת FPLC </td><td></td> &lt;/ Tr&gt; <tr><td> 1 מתכון L </td><td> 50 מ&quot;ל 3M NaCl; 20 מ&quot;ל 0.5 Tris-HCl, pH 7.6; 2 מ&quot;ל של 10% נתרן אזיד; 930 מ&quot;ל H 2 O </td></tr></tbody></table> טבלת 1. ריאגנטים מיוחדים. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שלב </td><td> Temp (° C) </td><td> זְמַן </td><td> מחזורים </td></tr><tr><td> א </td><td> 98 </td><td> 30 s </td><td> 1 </td></tr><tr><td> B </td><td> 98 </td><td> 10 שניות </td><td rowspan="3"> 25 </td></tr><tr><td></td><td> 60 </td><td> 30 s </td></tr><tr><td></td><td> 72 </td><td> 15 שניות </td></tr><tr><td> C </td><td> 72 </td><td> 10 דק &#39; </td><td> 1 </td></tr></tbody></table> טבלה 2.צעדי הגברת דור ספרייה. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> תֶחֶל </td><td> סדר פעולות </td></tr><tr><td> פריימר 1.1 </td><td> AATGATACGGCGACCACCGAGAT </td></tr><tr><td> פריימר 2.1 </td><td> CAAGCAGAAGACGGCATACGA </td></tr></tbody></table> Primers לוח 3. PCR. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> שלב </td><td> Temp (° C) </td><td> זְמַן </td><td> מחזורים </td></tr><tr><td> א </td><td> 95 </td><td> 10 דק &#39; </td><td> 1 </td></tr><tr><td> B </td><td> 95 </td><td> 10 שניות </td><td rowspan="2"> 40 </td></tr><tr><td></td><td> 60 </td><td&gt; 30 שניות </td></tr></tbody></table> לוח 4. צעדי הגברת כימות הספרייה.

Watch this Scientific Journal Video about Isolation of High-density Lipoproteins for Non-coding Small RNA Quantification at JoVE.com

Isolation of High-density Lipoproteins for Non-coding Small RNA Quantification

This protocol describes the isolation and quantification of high-density lipoprotein small RNAs.

בידוד של ליפופרוטאין בצפיפות גבוהה עבור Non-קידוד RNA קטנים כימות

The diversity of small non-coding RNAs (sRNA) is rapidly expanding and their roles in biological processes, including gene regulation, are emerging. Most ...

isolation-high-density-lipoproteins-for-non-coding-small-rna

Nanyang Technological University

Research

JoVE Journal

Biochemistry

11.2K Views.  Vanderbilt University School of Medicine. This protocol describes the isolation and quantification of high-density lipoprotein small RNAs.

Video: Isolation of High-density Lipoproteins for Non-coding Small RNA Quantification

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. They are composed of position-dependent, cis-acting RNA elements and unique combinations of RNA binding proteins. Defining the composition of a specific RNP is essential to achieving a fundamental understanding of gene regulation. The isolation of a select RNP is akin to finding a needle in a haystack. Here, we demonstrate an approach to isolate RNPs associated at the 5' untranslated region of a select mRNA in asynchronous, transfected cells. This cognate RNP has been demonstrated to be necessary for the translation of select viruses and cellular stress-response genes.
The demonstrated RNA-protein co-precipitation protocol is suitable for the downstream analysis of protein components through proteomic analyses, immunoblots, or suitable biochemical identification assays. This experimental protocol demonstrates that DHX9/RNA helicase A is enriched at the 5' terminus of cognate retroviral RNA and provides preliminary information for the identification of its association with cell stress-associated huR and junD cognate mRNAs.

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

בידוד של קומפלקסים RNA חלבון מאותו מקור מתאי שימוש Elution oligonucleotide מכוונת

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

An Efficient Method for the Isolation of Highly Purified RNA from Seeds for Use in Quantitative Transcriptome Analysis

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as industrial materials. Gene expression profiles are powerful tools for investigating metabolic regulation in plant cells. Therefore, detailed, accurate gene expression profiles during seed development are required for crop breeding. Acquiring highly purified RNA is essential for producing these profiles. Efficient methods are needed to isolate highly purified RNA from seeds. Here, we describe a method for isolating RNA from seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method enables highly purified RNA to be obtained from seeds without the use of phenol, chloroform, or additional processes for RNA purification. This method is applicable to Arabidopsis, rapeseed, and soybean seeds. Our method will be useful for monitoring the expression patterns of low level transcripts in developing and mature seeds.

We have succeeded in establishing a method for RNA isolation from plant seeds containing large amounts of oils, proteins, and polyphenols, which have inhibitory effects on high-purity RNA isolation. Our method is suitable for monitoring the expression of genes with low level transcripts in seeds.

שיטה יעילה עבור הבידוד של רנ&quot;א מאוד מטוהר מזרעים לשימוש ב כמוני transcriptome ניתוח

Plant seeds accumulate large amounts of storage reserves comprising biodegradable organic matter. Humans rely on seed storage reserves for food and as ...

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

ניתוח Toeprinting של תרגום חניכה היווצרות מורכבות על יונקים mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

הליך בידוד RNA טנדם מבוססי Oligonucleotide לשחזר את מתחמי ה-mRNA האיקריוטים-חלבון

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

לימודי המבנית של מקרומולקולות בפתרון באמצעות פיזור קרני רנטגן זווית קטנה

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

לכידת וזיהוי של RNA-מחייב חלבונים באמצעות לחץ בסיוע כימיה RNA-interactome ללכוד אסטרטגיה (CARIC)

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Studying RNA Interactors of Protein Kinase RNA-Activated during the Mammalian Cell Cycle

Protein kinase RNA-activated (PKR) is a member of the innate immune response proteins and recognizes the double-stranded secondary structure of viral RNAs. When bound to viral double-stranded RNAs (dsRNAs), PKR undergoes dimerization and subsequent autophosphorylation. Phosphorylated PKR (pPKR) becomes active and induces phosphorylation of the alpha subunit of eukaryotic initiation factor 2 (eIF2&#945;) to suppress global translation. Increasing evidence suggests that PKR can be activated under physiological conditions such as during the cell cycle or under various stress conditions without infection. However, our understanding of the RNA activators of PKR is limited due to the lack of a standardized experimental method to capture and analyze PKR-interacting dsRNAs. Here, we present an experimental protocol to specifically enrich and analyze PKR bound RNAs during the cell cycle using HeLa cells. We utilize the efficient crosslinking activity of formaldehyde to fix PKR-RNA complexes and isolate them via immunoprecipitation. PKR co-immunoprecipitated RNAs can then be further processed to generate a high-throughput sequencing library. One major class of PKR-interacting cellular dsRNAs is mitochondrial RNAs (mtRNAs), which can exist as intermolecular dsRNAs through complementary interaction between the heavy-strand and the light-strand RNAs. To study the strandedness of these duplex mtRNAs, we also present a protocol for strand-specific qRT-PCR. Our protocol is optimized for the analysis of PKR-bound RNAs, but it can be easily modified to study cellular dsRNAs or RNA-interactors of other dsRNA binding proteins.

We present experimental approaches for studying RNA-interactors of double-stranded RNA binding protein kinase RNA-activated (PKR) during the mammalian cell cycle using HeLa cells. This method utilizes formaldehyde to crosslink RNA-PKR complexes and immunoprecipitation to enrich PKR-bound RNAs. These RNAs can be further analyzed through high-throughput sequencing or qRT-PCR.

לומד RNA Interactors של חלבון ה-RNA-מופעל במהלך מחזור התא בתרבית

Protein kinase RNA-activated (PKR) is a member of the innate immune response proteins and recognizes the double-stranded secondary structure of viral ...

Translating Ribosome Affinity Purification (TRAP) for RNA Isolation from Endothelial Cells In Vivo

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis of transcriptome and gene expression by qPCR and RNA sequencing. Comprehensive transcriptome and gene expression analysis of specific cell types in complex tissues and organs will be critical to understand cellular and molecular mechanisms by which genes are regulated and their association with tissue homeostasis and organ functions. In this article, we demonstrate the methodology for isolation of ribosome-bound RNA directly in vivo in the vascular endothelia of animal lungs as an example. The specific materials and procedures for tissue processing and RNA purification will be described, including the assessment of RNA quality and yield as well as real time qPCR for arteriogenic gene assays. This approach, known as translating ribosome affinity purification (TRAP) technique, can be utilized for characterization of gene expression and transcriptome analysis of certain cell types directly in vivo in any specific type in complex tissues.

Translating Ribosome Affinity Purification TRAP for RNA Isolation from Endothelial Cells In Vivo

We present an approach to purify ribosome-bound mRNA from vascular endothelial cells (ECs) directly in mouse brain, lung and heart tissues via EC-specific genetic tag of enhanced green fluorescence protein (EGFP)in ribosomes in combination with RNA purification.

תרגום הריבוכמה אהדה לטיהור (מלכודת) לבידוד רנ א מתאי האנדותל בvivo

Many studies have been limited to using in vitro cellular assays and whole tissues or isolating of specific cell types from animals for in vitro analysis ...

RNA Blot Analysis for the Detection and Quantification of Plant MicroRNAs

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and animals. Most miRNAs act as negative switches of gene expression targeting key genes. In plants, primary miRNAs (pri-miRNAs) transcripts are generated by RNA polymerase II, and they form varying lengths of stable stem-loop structures called pre-miRNAs. An endonuclease, Dicer-like1, processes the pre-miRNAs into miRNA-miRNA* duplexes. One of the strands from miRNA-miRNA* duplex is selected and loaded onto Argonaute 1 protein or its homologs to mediate the cleavage of target mRNAs. Although miRNAs are key signaling molecules, their detection is often carried out by less than optimal PCR-based methods instead of a sensitive northern blot analysis. We describe a simple, reliable, and extremely sensitive northern method that is ideal for the quantification of miRNA levels with very high sensitivity, literally from any plant tissue. Additionally, this method can be used to confirm the size, stability and the abundance of miRNAs and their precursors.

This method demonstrates use of the northern hybridization technique to detect miRNAs from total RNA extract.

ה-RNA ניתוח כתמי לזיהוי וכימות של מיקרורונאס הצמח

MicroRNAs (miRNAs) are a class of endogenously expressed non-coding, ~21 nt small RNAs involved in the regulation of gene expression in both plants and ...

Isolation and Analysis of Plasma Lipoproteins by Ultracentrifugation

Analysis of plasma lipoproteins and apolipoproteins is an essential part for the diagnosis of dyslipidemia and studies of lipid metabolism and atherosclerosis. Although there are several methods for analyzing plasma lipoproteins, ultracentrifugation is still one of the most popular and reliable methods. Because of its intact separation procedure, the lipoprotein fractions isolated by this method can be used for analysis of lipoproteins, apolipoproteins, proteomes, and functional study of lipoproteins with cultured cells in vitro. Here, we provide a detailed protocol to isolate seven lipoprotein fractions including VLDL (d&#60;1.006 g/mL), IDL (d=1.02 g/mL), LDLs (d=1.04 and 1.06 g/mL), HDLs (d=1.08, 1.10, and 1.21 g/mL) from rabbit plasma using sequential floating ultracentrifugation. In addition, we introduce the readers how to analyze apolipoproteins such as apoA-I, apoB, and apoE by SDS-PAGE and Western blotting and show representative results of lipoprotein and apolipoprotein profiles using hyperlipidemic rabbit models. This method can become a standard protocol for both clinicians and basic scientists to analyze lipoprotein functions.

Several methods have been used for analyzing plasma lipoproteins; however, ultracentrifugation is still one of the most popular and reliable methods. Here, we describe a method regarding how to isolate lipoproteins from plasma using sequential density ultracentrifugation and how to analyze the apolipoproteins for both diagnostic and research purposes.