Diese Forschung wurde von der National Science Foundation Grant IOS-1025642 (GBM) unterstützt. Wir danken Maria Harrison für den ARqua1 Stamm bereitstellt.

1. Leitfaden RNA Entwurf und Vektorkonstruktion <ol><li> Identifizieren Sie Zielsequenzen für die Gene von Interesse. Es gibt eine Vielzahl von Online - CRISPR Zielfindungsprogramme geeignet für diesen Schritt 13,14. HINWEIS: Hier verwenden wir den GN 20 GG Zielmotiv, aber andere Konstruktionen geeignet sein können , abhängig von der Anwendung oder Vektorsystem verwendet wird . </li><li> Design 60-mer gRNA Oligos der GN 19 Teil der Zielmotive von 5 &#39;und 3&#39; 20-nt - Sequenzen flankiert umfassen , die für die DNA - Anordnung erforderlich sind. Das endgültige 60-mer - Motiv ist: 5&#39;-TCAAGCGAACCAGTAGGCTT-GN 19 -GTTTTAGAGCTAGAAATAGC-3 &#39;. HINWEIS: Standard, entsalzt Primer funktionieren. </li><li> Bereiten Sie die vier DNAs für die Montage (Figur 1). Siehe ergänzende Datei für DNA-Sequenzen. <ol><li> Digest von 1 bis 5 &amp; mgr; g p201N: Cas9 10 Plasmid mit dem Restriktionsenzym Spe I in 1x Puffer 4 bei 37 ° C für 2 Stunden. Column-reinigen die eine verdauenL aut den Anweisungen des Herstellers. Resuspendieren in ~ 15 &amp; mgr; l 10 mM Tris-HCl, und Quantifizierung durch UV-Spektrophotometrie. </li><li> Durchführen einer zweiten mit dem Restriktionsenzym Swa I in 1x Puffer 3,1 bei 25 ° C für 2 Stunden zu verdauen. Überprüfen 100-200 ng auf einem 0,8% Agarosegel vollständige Verdauung zu bestätigen. HINWEIS: Ein richtig verdaute Plasmid wird bei 14.313 bp eine einzelne Bande haben. Anmerkung: Die Hitzeinaktivierung des Enzyms und Dephosphorylierung sind nicht erforderlich. Verdauten Plasmid kann bei -20 ° C gelagert werden. </li><li> PCR - Amplifikation der Medicago truncatula (Mt) U6 - Promotor und Gerüst DNAs aus dem pUC gRNA Shuttle 10 - Plasmid der Primer Swa I_MtU6F / MtU6R und ScaffoldF / Spe I_ScaffoldR jeweils unter Verwendung. Verwenden, um eine High-Fidelity-Polymerase mit den PCR-Bedingungen: 95 ° C für 3 min; 31 Zyklen (98 ° C für 20 sec, 60 ° C für 15 sec, 72 ° C für 30 sec); und 72 ° C für 5 min. <ol><li> Visualisieren ~ 3 ul Aliquots der PCR-products auf einem 1% Agarosegel der Amplifikation zu bestätigen. Die MtU6 Amplikon beträgt 377 bp und das Gerüst Amplikon beträgt 106 bp. Column-reinigen die verbleibenden PCR-Produkte gemäß den Anweisungen des Herstellers, zu quantifizieren durch UV-Spektrometrie und bei -20 ° C. </li></ol></li><li> Resuspendieren das gesamte Rohr von gRNA Oligos bis 100 &amp; mgr; M in Laborqualität Wasser. 1 ul 100 uM Oligo 500 ul 1x Buffer 2.1. Gut mischen. Wenn mehrere Oligos Pooling, fügen 1 ul jeder 100 &amp; mgr; M Oligo zum 1x Buffer 2.1 Rohr. Verwässertes Oligos können bei -20 ° C gelagert werden. </li></ol></li><li> Programmieren Sie einen Thermocycler bei 50 ° C zu halten, einen beheizten Deckel verwenden. Kombinieren von 100 ng (0,011 pmol) des linearisierten Vektor, 50 ng (0,2 pMol) von MtU6 Promotor, 12 ng (0,2 pMol) des Gerüsts, 1 ul (0,2 pmol) verdünntes gRNA oligo (n) und Wasser auf ein Volumen von 5 &amp; ​​mgr; l. In 5 ul 2x High-Fidelity DNA Montage Master-Mix, gut mischen und Spin-down. Inkubieren Reaktion für 60 min in der50 ° C Thermocycler. Dann legen Sie die Reaktion auf Eis. Hinweis: Die Reaktionsvolumina erhöht werden niedrige DNA-Ausbeuten zu werden. </li><li> Transformieren 2 &amp; mgr; l der Reaktion in kompetente E. coli - Zellen unter Verwendung von Standardtechniken und Platte auf LB , ergänzt mit 50 mg L -1 Kanamycin (Kan 50). Wachsen kontaktierten Zellen bei 37 ° C über Nacht. Speichern Sie die verbleibende DNA Montage Reaktion bei -20 ° C. </li><li> Colony Bildschirm durch PCR der Primer StUbi3P218R und ISceIR verwenden. Einen aliquoten der verbleibenden DNA-Baugruppe Reaktion mit Wasser 1: 5. Verwenden Sie 1 ul als positive Kontrolle für die Kolonie-Bildschirm und 1 ng Kreis p201N: Cas9 Plasmid als no-Insert Kontrolle. <ol><li> PCR amplifizieren unter den Bedingungen; 95 ° C für 3 min; 31 Zyklen (95 ° C für 30 sec, 58 ° C für 30 sec, 72 ° C für 30 sec); und bei 72 ° C für 5 min. Visualisieren PCR-Produkte auf einem 1% Agarosegel. Stellen Sie sicher, dass die korrekte Einfügungen haben eine Bande bei 725 bp und Vektoren Witzhout Einsätze (zB ungeschnittenen Vektor) wird eine 310-bp - Bande. </li></ol></li><li> Wachsen positive Kolonien in LB Kan 50 Flüssigkulturen über Nacht bei 37 ° C und reinigen Plasmide gemäß den Anweisungen des Herstellers. Sanger-Sequenz Plasmide mit dem StUbi3P218R Primer und richten Chromatogramme zu den MtU6 Promotor, Ziel und Gerüstsequenzen keine Fehler zu gewährleisten, wurden während der Klonierung. </li><li> Führen Sie Diagnose ein verdauen durch ~ 1 ug Plasmid Verdauen mit Eco RV und Sty I. Visualisierung auf einem 0,8% Agarosegel. Fragmente (in bp) sind: 4192, 2001, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318 und 174. </li><li> Verwenden DNA Montagevektoren zu konstruieren, mit mehreren gRNAs. <ol><li> Um einen Vektor mit zwei Kassetten gRNA konstruieren, verstärken die erste PCR-Position gRNA mit den Primern Swa I_MtU6F / UNS1_ScaffoldR und die zweite Position gRNA mit den Primern UNS1_MtU6F / Spe I_ScaffoldR von 1 ng von jedem der jeweiligen1.8 - Plasmide in den Schritten 1.1 aufgebaut. Verwenden Sie die PCR-Bedingungen in Schritt 1.3.3. Visualisieren ~ 3 &amp; mgr; l-Aliquote der PCR-Produkte auf einem 1% Agarosegel der Amplifikation zu bestätigen. Amplicons sind ~ 500 bp. </li><li> Kombinieren und un-gereinigte PCR-Produkte in einem 200 ul Röhrchen mischen etwa gleiche Mengen an (in der Regel 3 bis 4 &amp; mgr; l von jedem). Zur Montage fügen 1 ul PCR - Produkte kombiniert, 50 ng Swa I und Spe I linearisiert p201N: Cas9, Laborqualität Wasser zu 2,5 ul und 2,5 ul 2x High-Fidelity - Master - Mix DNA - Montage. Inkubieren in einem 50 ° C-Thermocycler für 15 min. Hinweis: Die DNA-Montageanleitungen eine 2 15 min Inkubation empfiehlt - 3 Fragmente. </li><li> Verwandeln Sie 1 bis 2 &amp; mgr; l in kompetente E. coli - Zellen und Platte auf LB Kan 50. Wachsen ausplattierten Zellen bei 37 ° C über Nacht. Speichern Sie die restlichen Reaktion bei -20 ° C. </li><li> Colony Bildschirm durch PCR mit Primern StUbi3P218R und ISceIR mit den gleichen Bedingungen wie in Schritt 1.6. Richtig cLones wird ein 1200 bp Amplikon haben. Wachsen positive Kolonien in LB Kan 50 Flüssigkulturen über Nacht und reinigen Plasmide. </li><li> Sanger-Sequenz Plasmide mit den Primern StUbi3P218R (deckt erster Position gRNA) und p201R (deckt zweiter Position gRNA). Richten Sie Chromatogramme zu den MtU6 Promotor, Ziel und Gerüstsequenzen. Diagnose verdauen mit Eco RV und Sty I in den folgenden Fragmente (in bp) führen wird: 4192, 2476, 1743, 1544, 1381, 995, 831, 702, 460, 423, 318, 174. Bolded Fragment der zweite gRNA enthält. </li></ol></li><li> Nach Erfüllung aller Qualitätskontrolle Erwartungen, verwandeln Plasmide in Agrobacterium 15 Stamm ARqua1 rhizogenes. 1 ul der Plasmid-prep bis 50 &amp; mgr; l elektrokompetente Zellen und elektroporieren in einem 1 mm Küvette mit den Einstellungen: 2,4 kV, 25 &amp; mgr; F und 200 Ω. Recover Zellen in ~ 500 ul SOC und schütteln bei 28 ° C für 2 Stunden. Platte auf LB Kan 50 und gZeile bei 28 ° C für 2 Tage. Führen Kolonie Bildschirm der gleichen Primer und PCR-Bedingungen als 1.3.3 verwenden. Machen Glycerin Aktien aus positiven Klonen. </li></ol> 2. Haarwurzel Transformation <ol><li> Sterilisieren Tomatensamen in 20% Haushaltsbleiche für 15 min unter konstantem Mischen. In einer Laminar-Flow-Haube, entfernen Sie das Bleichmittel und waschen in sterilen Labor-grade Wasser 3 mal. </li><li> Die Platte 30 Samen in einem GA-7 - Box mit ½ MS - Medium (2,22 g L -1 MS - Salze + Gamborg Vitamine, 10 g L -1 Saccharose, 3 g L -1 Gellangummi, pH - Wert 5,8). Keimen für ~ 2 Tage im Dunkeln, dann bewegen GA-7-Boxen zum Vorschein. Wachsen Sämlinge für ca. 4 Tage im Licht. </li><li> Der Tag vor der Transformation, Streifen aus A. rhizogenes Kulturen auf festem LB Kan 50 und wachsen über Nacht bei 28 ° C. </li><li> Tag der Transformation, in der Laminar-Flow-Haube montieren sterilen Materialien: 12 ml Kulturröhrchen, 50 ml konischen Röhrchen, ½ MS Flüssigkeit (kein Gellan gmgr; m), 200 uM Acetosyringons, Filterpapier, Petrischalen, Pinzetten und Skalpell, Pipetten und Pipettenspitzen. Zugeben von 25 &amp; mgr; l Acetosyringon zu 50 ml ½ MS und gieße ~ 6 ml in jedes Kulturröhrchen. </li><li> Verwenden Sie einen gebogenen 200 ul Spitze A. zu kratzen rhizogenes Zellen von der Platte und resuspendieren in den 6 ml ½ MS Flüssigkeit. Vortex das Rohr um die Zellen zu resuspendieren vollständig. Nach Resuspendieren Zellen aus jedem Vektor, messen die optische Dichte (OD) von 1 ml Zellen bei einer festen Wellenlänge von 600 nM. Sicherzustellen OD zwischen 0,2 und 0,4; verdünnen oder mehr Zellen als nötig hinzuzufügen. Wiederholen Sie dies für jedes Konstrukt. </li><li> In ~ 2 ml ½ MS Flüssigkeit in eine Petrischale mit einem sterilen Filterpapier. Excise Cotyledonen aus den Keimlingen und auf den angefeuchteten Filterpapier. Sobald alle Kotyledonen gesammelt worden ist, schneiden die distalen ~ 1 cm aus der Keimblätter, die sich in cotyledon Stücke mit zwei Schnittenden. In Explantate auf A. rhizogenes Lösungen, Mischung und Inkubation für 20 minmit gelegentlichen Invertierung. Anmerkung: Etwa 12 Explantaten pro Konstrukt werden routinemäßig verwendet, obwohl so viel wie 80 Explantate in 6 ml A. inokuliert wurden rhizogenes Lösung. </li><li> Während der A. rhizogenes Inkubation Filterpapier auf Petrischalen hinzufügen, eine pro Konstrukt transformiert. Auch setzen ½ MS feste Medien, keine Antibiotika, in der Laminar-Flow-Haube, um zu trocknen. </li><li> Scoop Cotyledonen aus A. rhizogenes Lösung mit einer sterilen Pinzette und auf trockenes Filterpapier. Deckel mit Petri Deckel Gewebe, um sicherzustellen, nicht austrocknen, während auf die nächste Transformation fortfahren. Blot Kotyledonen auf dem Filterpapier und Transfer, abaxial Seite nach oben, MS Medien auf ½. Wrap-Platten mit chirurgischen Band und Co-kultivieren im Dunkeln bei Raumtemperatur für 2 Tage. </li><li> Nach der Co-Kultivierung, Transfer Kotyledonen bis abaxial Seite mit MS - Medien mit 300 mg L -1 Ticarcillin / Clavulansäure (Tim 300, ergänzt ½ das Wachstum von resid zu verhindernual A. rhizogenes) und Kan 50 (für die Pflanzenauswahl) und wickeln mit chirurgischen Band. Pflegen Kulturen unter Leuchtstofflampen bei Raumtemperatur mit einer 16-Stunden-Photoperiode. </li><li> Nach ~ 1,5-2 Wochen Wurzeln mindestens 2 cm Länge werden aus den Cotyledonen Verwendung einer sterilen Pinzette herausgeschnitten und mit einem Skalpell und an MS Kan 50 Tim 300 media ½. Übertragen Sie 10 bis 15 Wurzeln auf einer einzigen Platte. Markieren Sie die Position der Wurzelspitzen mit einem Marker, wickeln mit chirurgischen Band, und halten in Kulturraum. </li><li> Nach einer Woche werden transformierte Wurzeln wachsen auf selektiven Medien gesehen. Ernten Sie eine Teilstichprobe von transformierten Wurzeln zur DNA-Extraktion die bevorzugte DNA-Extraktionsverfahren. Hinweis: Die Platten mit Kotyledonen kann für 2 gehalten werden - 3 wöchentliche Ernten, wonach die Wurzeln in einem wirren Durcheinander wachsen zeigen und sind schwer zu isolieren. Nicht geernteten Wurzelgewebe kann auf unbestimmte Zeit aufrechterhalten werden. Eine Vielzahl von Tests kann auf dem isolierten DNA-Probe durchgeführt werden,s auf DNA-Mutation Häufigkeit und Art bestimmen. Ergebnisse von einigen solchen Assays werden unten beschrieben. </li></ol>

<ol><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li>
<li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li>
<li>Zhou, Y. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((High-throughput+screening+of+a+CRISPR%2FCas9+library+for+functional+genomics+in+human+cells%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (509), 487-491 (2014).</li>
<li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+new+frontier+of+genome+engineering+with+CRISPR-Cas9%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346 (6213), (2014).</li>
<li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Editing+plant+genomes+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22Current+Opinion+in+Biotechnology%22%5BJournal%5D)">Editing plant genomes with CRISPR/Cas9.</a> Current Opinion in Biotechnology. 32, 76-84 (2015).</li>
<li>Bortesi, L., Fischer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+CRISPR%2FCas9+system+for+plant+genome+editing+and+beyond%5BTitle%5D)+AND+%22Biotechnology+Advances%22%5BJournal%5D)">The CRISPR/Cas9 system for plant genome editing and beyond.</a> Biotechnology Advances. 33 (1), 41-52 (2015).</li>
<li>Jia, H. G., Wang, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+genome+editing+of+sweet+orange+using+Cas9%2FsgRNA%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">Targeted genome editing of sweet orange using Cas9/sgRNA.</a> Plos One. 9, (2014).</li>
<li>Upadhyay, S. K., Kumar, J., Alok, A., Tuli, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA-Guided+Genome+Editing+for+Target+Gene+Mutations+in+Wheat%5BTitle%5D)+AND+%22G3-Genes+Genomes+Genetics%22%5BJournal%5D)">RNA-Guided Genome Editing for Target Gene Mutations in Wheat.</a> G3-Genes Genomes Genetics. 3 (12), 2233-2238 (2013).</li>
<li>Ron, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Hairy+root+transformation+using+Agrobacterium+rhizogenes.+as+a+tool+for+exploring+cell+type-specific+gene+expression+and+function+using+tomato+as+a+model%5BTitle%5D)+AND+%22Plant+Physiology%22%5BJournal%5D)">Hairy root transformation using Agrobacterium rhizogenes. as a tool for exploring cell type-specific gene expression and function using tomato as a model.</a> Plant Physiology. 166 (2), 455-U4442 (2014).</li>
<li>Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., Parrott, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+genome+modifications+in+soybean+with+CRISPR%2FCas9%5BTitle%5D)+AND+%22BMC+Biotechnology%22%5BJournal%5D)">Targeted genome modifications in soybean with CRISPR/Cas9.</a> BMC Biotechnology. 15, (2015).</li>
<li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Chemical+synthesis+of+the+mouse+mitochondrial+genome%5BTitle%5D)+AND+%22Nature+Methods%22%5BJournal%5D)">Chemical synthesis of the mouse mitochondrial genome.</a> Nature Methods. 7 (11), 901-903 (2010).</li>
<li>Zhou, X., Jacobs, T. B., Xue, L. J., Harding, S. A., Tsai, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exploiting+SNPs+for+biallelic+CRISPR+mutations+in+the+outcrossing+woody+perennial+Populus+reveals+4-coumarate%3ACoA+ligase+specificity+and+redundancy%5BTitle%5D)+AND+%22New+Phytologist%22%5BJournal%5D)">Exploiting SNPs for biallelic CRISPR mutations in the outcrossing woody perennial Populus reveals 4-coumarate:CoA ligase specificity and redundancy.</a> New Phytologist. , (2015).</li>
<li>Stemmer, M., Thumberger, T., Keyer, M. D., Wittbrodt, J., Mateo, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CCTop%3A+An+Intuitive%2C+Flexible+and+Reliable+CRISPR%2FCas9+Target+Prediction+Tool%5BTitle%5D)+AND+%22Plos+One%22%5BJournal%5D)">CCTop: An Intuitive, Flexible and Reliable CRISPR/Cas9 Target Prediction Tool.</a> Plos One. 10, (2015).</li>
<li>Lei, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-P%3A+A+Web+Tool+for+Synthetic+Single-Guide+RNA+Design+of+CRISPR-System+in+Plants%5BTitle%5D)+AND+%22Molecular+Plant%22%5BJournal%5D)">CRISPR-P: A Web Tool for Synthetic Single-Guide RNA Design of CRISPR-System in Plants.</a> Molecular Plant. 7 (9), 1494-1496 (2014).</li>
<li>Quandt, H. J., Puhler, A., Broer, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((TRANSGENIC+ROOT-NODULES+OF+VICIA-HIRSUTA+-+A+FAST+AND+EFFICIENT+SYSTEM+FOR+THE+STUDY+OF+GENE-EXPRESSION+IN+INDETERMINATE-TYPE+NODULES%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%22%5BJournal%5D)">TRANSGENIC ROOT-NODULES OF VICIA-HIRSUTA - A FAST AND EFFICIENT SYSTEM FOR THE STUDY OF GENE-EXPRESSION IN INDETERMINATE-TYPE NODULES.</a> Molecular Plant-Microbe Interactions. 6, 699-706 (1993).</li>
<li>Zhu, X. X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+efficient+genotyping+method+for+genome-modified+animals+and+human+cells+generated+with+CRISPR%2FCas9+system%5BTitle%5D)+AND+%22Scientific+Reports%22%5BJournal%5D)">An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system.</a> Scientific Reports. 4 (8), (2014).</li>
<li>Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Plant+genome+editing+made+easy%3A+targeted+mutagenesis+in+model+and+crop+plants+using+the+CRISPR%2FCas+system%5BTitle%5D)+AND+%22Plant+Methods%22%5BJournal%5D)">Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system.</a> Plant Methods. 9 (1), 39(2013).</li>
<li>Cong, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+genome+engineering+using+CRISPR%2FCas+systems%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li>
<li>Li, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+and+homologous+recombination-mediated+genome+editing+in+Arabidopsis+and+Nicotiana+benthamiana+using+guide+RNA+and+Cas9%5BTitle%5D)+AND+%22Nat+Biotech%22%5BJournal%5D)">Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9.</a> Nat Biotech. 31 (8), 688-691 (2013).</li>
<li>Fu, Y. F., Sander, J. D., Reyon, D., Cascio, V. M., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improving+CRISPR-Cas+nuclease+specificity+using+truncated+guide+RNAs%5BTitle%5D)+AND+%22Nature+Biotechnology%22%5BJournal%5D)">Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.</a> Nature Biotechnology. 32 (3), 279-284 (2014).</li>
<li>Torella, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Unique+nucleotide+sequence-guided+assembly+of+repetitive+DNA+parts+for+synthetic+biology+applications%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications.</a> Nat Protoc. 9 (9), 2075-2089 (2014).</li>
<li>Ono, N. N., Tian, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+multiplicity+of+hairy+root+cultures%3A+Prolific+possibilities%5BTitle%5D)+AND+%22Plant+Science%22%5BJournal%5D)">The multiplicity of hairy root cultures: Prolific possibilities.</a> Plant Science. 180 (3), 439-446 (2011).</li>
<li>Tepfer, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transformation+of+several+species+of+higher+plants+by+Agrobacterium+rhizogenes.%3A+sexual+transmission+of+the+transformed+genotype+and+phenotype%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Transformation of several species of higher plants by Agrobacterium rhizogenes.: sexual transmission of the transformed genotype and phenotype.</a> Cell. 37 (3), 959-967 (1984).</li>
<li>Li, H., Deng, Y., Wu, T. L., Subramanian, S., Yu, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Misexpression+of+miR482%2C+miR1512%2C+and+miR1515+Increases+Soybean+Nodulation%5BTitle%5D)+AND+%22Plant+Physiology%22%5BJournal%5D)">Misexpression of miR482, miR1512, and miR1515 Increases Soybean Nodulation.</a> Plant Physiology. 153 (4), 1759-1770 (2010).</li>
<li>Boisson-Dernier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agrobacterium+rhizogenes-transformed+roots+of+Medicago+truncatula+for+the+study+of+nitrogen-fixing+and+endomycorrhizal+symbiotic+associations%5BTitle%5D)+AND+%22Molecular+Plant-Microbe+Interactions%22%5BJournal%5D)">Agrobacterium rhizogenes-transformed roots of Medicago truncatula for the study of nitrogen-fixing and endomycorrhizal symbiotic associations.</a> Molecular Plant-Microbe Interactions. 14 (6), 695-700 (2001).</li>
<li>Collier, R., Fuchs, B., Walter, N., Kevin Lutke, W., Taylor, C. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Ex+vitro.+composite+plants%3A+an+inexpensive%2C+rapid+method+for+root+biology%5BTitle%5D)+AND+%22Plant+Journal%22%5BJournal%5D)">Ex vitro. composite plants: an inexpensive, rapid method for root biology.</a> Plant Journal. 43 (3), 449-457 (2005).</li>
</ol>

Die Autoren haben nichts zu offenbaren.

Since DNA assembly is used to recombine any overlapping DNA sequences, this cloning method can be applied to any CRISPR vector construction. Most CRISPR cloning schemes use either gene synthesis of the gRNA, type IIS restriction enzymes17,18, or overlap-extension PCR19. Each of these techniques has inherent advantages and disadvantages, but they typically require multiple hands-on cloning steps. The primary advantage of the cloning method presented here is that the entire process occurs in a single, one-hour reaction and gRNA oligos can be pooled to further streamline the cloning procedure. Furthermore, the DNA assembly mechanism is independent of restriction enzymes, which makes this method compatible with virtually any DNA sequence. Conveniently, a master mix of the invariable DNA components (linearized vector, MtU6 promoter, and scaffold) can be made and stored at -20 &#176;C for later assemblies. 
While we use the GN20GG gRNA target motif, there are several alternative gRNA target motifs that can be used17. Shorter gRNAs have been demonstrated to increase specificity in animal cells20. By using a 5' G with a U6 promoter in the gRNA sequence (or A in the case of a U3 promoter), regardless if it matches the intended target sequence, the more abundant target motif N21GG may be used. However, the GN20GG target motif does not present a major technical limitation as several suitable targets can be found in most plant genes. The cloning scheme presented here can be easily modified to accommodate any gRNA design; simply substitute bases in the gRNA oligo.
Another advantage of the DNA assembly cloning system is that the same reagents can be used to insert multiple gRNAs into a single vector. A protocol for two gRNAs is presented here, and with the same methodology, using unique nucleotide sequences21 as spacers between gRNAs, it should be possible to assemble six gRNAs or more in a single cloning reaction.
As presented in step 1.9, the sequential cloning of gRNA vectors into a final multi-gRNA vector will take several days to perform because of the multiple cloning and screening steps. A modification of this protocol permits the construction of multi-gRNA vectors in a single day by bypassing the single-gRNA vector cloning step. First assemble individual gRNAs with just the MtU6 amplicon, gRNA oligo, and scaffold amplicon. Individual reactions must be performed for each gRNA. Following step 1.4, omit the linearized vector and reduce the 50 &#176;C incubation to 15 minutes. A 1:5 dilution of the reactions can be used as template in step 1.9.1. 
A potential problem with step 1.9 is the carry-over of residual single-gRNA plasmids from the PCR amplification of the gRNAs since all plasmids are selected with kanamycin. While we have never observed single-gRNA vectors in any of our colony screens following the specified protocol, gel purification of the PCR products or DpnI treatment of the PCR reactions could be used should the problem occur.
The ability to generate CRISPR vectors in a high-throughput manner necessitates a high-throughput method of generating transgenic materials to use the CRISPR vectors. Hairy roots are well suited for this task as they are technically simple to generate, require relatively little laboratory space to maintain and can be produced in a wide range of plant species22,23. However one limitation is that hairy roots are generally not used to generate whole plants and root systems are not suitable models for investigating most above-ground phenotypes. The former limitation may be advantageous when targeting genes that are null-lethal in whole-plant systems.
An important consideration for any transformation experiment is that results may vary with the different genotypes of plants and bacterial strains used. We routinely induce hairy roots in the cultivar (cv.) Rio Grande but have had difficulty obtaining hairy roots with cv. Moneymaker. Here, we report the use of the A. rhizogenes strain ARqua1, but it should be noted that strain ATCC 15834 has also been reported to work in tomato9.
Another critical consideration for hairy root transformation is the potential for overgrowth of A. rhizogenes on the cotyledon explants. Bacterial overgrowth typically leads to cotyledon death and low transformation efficiencies. Cotyledons must be blotted dry after soaking with A. rhizogenes. Likewise, co-cultivation should be limited to two days to prevent excessive bacterial overgrowth. Some bacterial growth is typically observed on co-cultivation plates, but should be absent once cotyledons are transferred to media containing ticarcillin/clavulanic acid.
The ease of constructing CRISPR vectors and generating hairy roots enables large-scale reverse-genetic screens, similar to those that are used in animal cell culture systems2. Hairy roots have been used to study a variety of plant functions including root development9, symbiotic associations24,25, and nematode resistance26 and the use of hairy roots for screening immunity-related genes is an area of active research in our lab. In addition to overexpression, gene silencing, and other transgenic technologies, targeted gene deletion via CRISPR/Cas9 is a powerful tool for functional genomic studies.

Die Möglichkeit, gezielte DNA-Modifikationen mit CRISPR zu erzeugen / Cas9 hat ein großes Potenzial für funktionelle Genomik Studien. Es gibt zwei Komponenten des CRISPR / Cas9 Systems; die Cas9 Nuklease, abgeleitet von Staphylococcus pyogenes und einer etwa 100-nt Führungs RNA (gRNA) Molekül , das Cas9 die gezielte DNA - Stelle (n) 1 leitet. Zielerkennung wird durch den ersten übertragenen ~ 20-nt der gRNA, die für Hochdurchsatzproduktion von Targeting - Vektoren 2,3 ermöglicht. Die meisten Organismen , die so konstruiert werden können, bereits mit CRISPR / Cas9 Technologie 4,5 haben. In Pflanzen, konstitutive Promotoren, wie den CaMV 35S - Promotor, werden üblicherweise zum Antrieb der Expression der Nuklease Cas9 6 verwendet. Die gRNAs exprimiert werden, die RNA-Polymerase III U6 oder U3 Promotoren, die die erste Basis des gRNA schränkt entweder ein G, für U6 oder A für U3, für eine effiziente Transkription. Allerdings prom RNA-Polymerase IIOters, die frei von diesen Beschränkungen sind, wurden ebenfalls 7,8 verwendet. Verschiedene gRNAs DNA-Mutationen mit unterschiedlichen Effizienzen, induzieren und so kann es wichtig sein, um erste CRISPR Vektoren validieren, bevor in Ganzpflanzentransformationen zu investieren oder umfangreiche phänotypische Bildschirme einrichten. Transiente Expression von CRISPR - Konstrukte in Pflanzen durch Agroinfiltration beispielsweise unter Verwendung, führt im allgemeinen zu einer niedrigeren Frequenz Modifikations DNA im Vergleich zu stabilen Pflanzen 6, was den Nachweis von Mutationen schwieriger und phänotypischen Assays unpraktisch mit solchen Ansätzen. Sogenannte Haarwurzeln sind eine bequeme, alternative System, da eine große Anzahl von unabhängigen, stabil transformierte Materialien können innerhalb von Wochen erzeugt werden, wie für eine stabile Pflanzen Monate gegenüber. CRISPR Vektoren sind sehr effektiv DNA - Mutationen in Haarwurzeln 9,10 bei der Induktion. DNA-Montageverfahren abzubinden effizient DNA-Fragmente enthalten, überlastapping Enden 11. Ein wesentlicher Vorteil einiger DNA Montageverfahren ist die Fähigkeit , ssDNA (dh Oligos) in die zusammengesetzten Produkte einzuarbeiten. Da gRNAs nur ~ 20-nt lang und neue Ziele sind mit synthetisierten Oligos hergestellt werden, sind diese DNA-Montageverfahren gut zu CRISPR Klonen geeignet. Die Protokolle werden hier beschrieben auf der P201 - Reihe von CRISPR Vektoren basieren , die 10 Sojabohnen-, Pappel 12 erfolgreich eingesetzt wurde und nun Tomate. Das Klonierungsverfahren präsentiert bietet mehrere Vorteile gegenüber dem aktuellen Klonmethode 10. Nämlich voll funktionsfähige Vektoren können in einem einzigen Reaktions Klonierung in einem einzigen Tag erzeugt werden. Vektorkonstruktion kann auch mehrere CRISPR Vektoren parallel weiter zu reduzieren Handhabungszeit und Materialkosten zu erzeugen gepoolt werden. Wir stellen auch ein Protokoll für die Erzeugung von Tomatenhaarwurzeln als eine effiziente Methode transgenen Materialien mit Zielgen Deletionen zu erzeugen. Hairy Wurzeln sind gültig verwendetaßen die CRISPR Vektoren und liefern Material für nachfolgende Experimente.

<table><tbody><tr><td>NEBuilder&amp;reg; (HiFi DNA assembly mix)</td><td>New England Biolabs</td><td>E5520</td><td></td></tr><tr><td>p201N:Cas9</td><td>Addgene</td><td>59175</td><td>The p201H:Cas9 plasmid (59176) is also compatible with the reported overlaps and enzymes.</td></tr><tr><td>pUC gRNA Shuttle</td><td>Addgene</td><td>47024</td><td></td></tr><tr><td>&lt;em&gt;Swa&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0604S</td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I</td><td>New England Biolabs</td><td>R0133S</td><td></td></tr><tr><td>Zymo clean and concentrator-5 column purification</td><td>Zymo Research</td><td>D4003</td><td></td></tr><tr><td>NEB Buffer 2.1</td><td>New England Biolabs</td><td>B7202S</td><td></td></tr><tr><td>NEB CutSmart (Buffer 4)</td><td>New England Biolabs</td><td>B7204S</td><td></td></tr><tr><td>NEB Buffer 3.1</td><td>New England Biolabs</td><td>B7203S</td><td></td></tr><tr><td>EconoSpin Mini Spin Column (plasmid prep)</td><td>Epoch Life Sciences</td><td>1910-050/250</td><td></td></tr><tr><td>EcoRV-HF&amp;reg;</td><td>New England Biolabs</td><td>R3195S</td><td></td></tr><tr><td>StyI-HF&amp;reg;</td><td>New England Biolabs</td><td>R3500S</td><td></td></tr><tr><td>MS Salts + Gamborg Vitamins</td><td>Phytotechnology Laboratories</td><td>M404</td><td></td></tr><tr><td>Phytagel&amp;trade; (gellan gum)</td><td>Sigma Aldrich</td><td>P8169</td><td></td></tr><tr><td>GA-7 Boxes</td><td>Sigma Aldrich</td><td>V8505</td><td></td></tr><tr><td>Micropore&amp;trade; surgical tape</td><td>3M</td><td>1535-0</td><td></td></tr><tr><td>Timentin&amp;reg; (Ticarcillin/Clavulanic acid)</td><td>Various</td><td>0029-6571-26</td><td></td></tr><tr><td>Primers 5&#039; &amp;#8594; 3&#039;</td><td></td><td></td><td></td></tr><tr><td>SwaI_MtU6F&amp;nbsp;</td><td>&lt;strong&gt;GATATTAATCTCTTCGATGA&lt;br/&gt;AATTT&lt;/strong&gt;ATGCCTATCTTATAT&lt;br/&gt;GATCAATGAGG</td><td></td><td></td></tr><tr><td>MtU6R&amp;nbsp;&amp;nbsp;</td><td>AAGCCTACTGGTTCGCTTG&lt;br/&gt;AAG</td><td></td><td></td></tr><tr><td>ScaffoldF&amp;nbsp;</td><td>GTTTTAGAGCTAGAAATAGC&lt;br/&gt;AAGTT</td><td></td><td></td></tr><tr><td>&lt;em&gt;Spe&lt;/em&gt;I_Scaffold R</td><td>&lt;strong&gt;GTCATGAATTGTAATACGACTC&lt;br/&gt;A&lt;/strong&gt;AAAAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>StUbi3P218R&amp;nbsp;</td><td>ACATGCACCTAATTTCACTA&lt;br/&gt;GATGT</td><td></td><td></td></tr><tr><td>ISceIR</td><td>GTGATCGATTACCCTGTTAT&lt;br/&gt;CCCTAG</td><td>Cannot be used for Sanger sequencing since there is a second binding site on the plasmid</td><td></td></tr><tr><td>UNS1_Scaffold R&amp;nbsp;</td><td>GAGAATGGATGCGAGTAATGAA&lt;br/&gt;AAAAAGCACCGACTCGGTG</td><td></td><td></td></tr><tr><td>UNS1_MtU6 F&amp;nbsp;&amp;nbsp;</td><td>CATTACTCGCATCCATTCTCAT&lt;br/&gt;GCCTATCTTATATGATCAATGAGG</td><td></td><td></td></tr><tr><td>p201R&amp;nbsp;</td><td>CGCGCCGAATTCTAGTGATCG</td><td></td><td></td></tr><tr><td>Bolded sequences denote 20-nt overlaps with linearized p201N:Cas9.</td><td></td><td></td><td></td></tr></tbody></table>

high-throughput crispr vector construction and characterization of dna modifications by generation of tomato hairy roots

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for functional genomics studies. While most cloning strategies are simple to perform, they generally use multiple steps and can require several days to generate the ultimate constructs. The method presented here is based on DNA assembly and can produce fully functional CRISPR vectors in a single cloning reaction. Vector construction can also be pooled, further increasing the efficiency and utility of the process. A modification of the method is used to create CRISPR vectors with multiple gene targets. CRISPR vectors are then transformed into tomato hairy roots to generate transgenic materials with targeted DNA modifications. Hairy roots are a useful system for testing vector functionality as they are technically simple to generate and amenable to large-scale production. The methods presented here will have wide application as they can be used to generate a variety of CRISPR vectors and be used in a wide range of plant species.

CRISPR Vektorkonstruktion mit DNA-Baugruppe erzeugt typischerweise Dutzende bis Hunderte von unabhängigen Klonen. Colony Screening durch PCR identifiziert leicht korrekte Klone und kann zwischen Plasmide mit und ohne Einlagen (2A) unterscheiden , die für die Fehlersuche nützlich ist. Typischerweise enthalten alle Klone ein Insert und ein Benutzer entscheiden kann, die Kolonie-Screening Schritte ganz zu überspringen. Diagnostische Digests (2B) und Sanger - Sequenzierung werden zur Qualitätskontrolle eingesetzt. Wenn Fehler auftreten, werden sie in der Regel in den überlappenden DNA - Regionen, dh das 5&#39; - Ende des MtU6 - Promotor, der gRNA oder 3&#39; - Ende der Gerüstsequenz beobachtet. Wenn mehrere gRNA Oligos in einem einzigen Reaktions gepoolt werden, werden die gRNAs durch Sanger-Sequenzierung bestimmt. Die Einarbeitung der einzelnen gRNAs gleichmäßig verteilt ist und die meisten der gRNAs kann aus einer einzigen Transformation (2C , isoliert werden </strong&gt;). Die High-Fidelity DNA - Montage - Mix wird als High-Fidelity - Version über die Standard - DNA - Montage - Mix bevorzugt ist weniger fehleranfällig (Abbildung 2C). Tomato Haarwurzeln werden in der Regel ein bis zwei Wochen nach der Transformation (3A) beobachtet. Roots ≥2 cm Länge ausgeschnitten und an selektivem Medium und Kanamycin-resistente Wurzeln können später (3B) 1 Woche identifiziert werden. Die meisten Wurzeln bis zu einem gewissen Grad auf selektiven Medien und das Wurzelwachstum in transformierten Wurzeln variabel sein kann, wird wachsen; wenn möglich, wählen Sie die am stärksten wachsenden Wurzeln für die Analyse. Ein bis zwei Kanamycin-resistenten Wurzeln sind in der Regel pro cotyledon beimpft gewonnen. Mit regelmäßigen Transfers können transformiert Wurzeln unbegrenzt auf selektiven Medien aufrechterhalten werden. DNA wird aus Kanamycin-resistenten Wurzeln extrahiert und PCR wird verwendet, um Amplify die Zielregion (en). PCR - Produkte können in einer Vielzahl von Assays verwendet werden , Mutationseffizienz, wie Klonierung und Sequenzierung (3C) , um zu bestimmen, Restriktionsfragmentlängen - Polymorphismus - Analyse, Polyacrylamid - Gelelektrophorese 16 (Figur 3D), T7E1 Endonuklease 16 oder hohem Durchsatz Amplikon - Sequenzierung 10. Wie in 6 anderen CRISPR-Anlagensysteme berichtet, abhängig von der gRNA / Zielsequenz ausgewählt wird , kann eine Reihe von Mutationen und Mutationseffizienz beobachtet werden. <img alt="Abbildung 1" src="/files/ftp_upload/53843/53843fig1.jpg" /> . Abbildung 1. Prinzip der CRISPR Versammlung in der DNA - Baugruppe Reaktion vier DNAs miteinander vermischt werden ; p201N: Cas9 linearisiert mit Swa I und Spe I (schwarzer Kreis), MtU6 Promotor (grüner Pfeil), Scaffold (gelber Balken) und dem 60-mer gRNA Oligo das GN 19 Zielsequenz enthält (blue bar). Die Enden jedes DNA-Moleküls überlappt 20 bp mit dem benachbarten Stück. Die DNA-Baugruppe Reaktion rekombiniert diese DNAs in einem einzigen, ringförmigen Moleküls. Die StUbi3p218R und ISceIR Primerbindungsstellen mit schwarzen Pfeilen angedeutet sind, die 2x35S: Cas9 Kassette lila, die StUbi3: nptII Kassette ist orange und linke und rechte Ränder sind mit graue Balken dargestellt. Hinweis:. Vektorkarte nicht maßstäblich ist <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig1large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" src="/files/ftp_upload/53843/53843fig2.jpg" /> Abbildung 2. Colony Screening und Plasmid - Qualitätskontrolle. A) Colony Screening von 20 Klonen aus DNA Montage und Transformation. M, 100-bp-Leiter; +, P201N: Cas9: GFPT2 positive Kontrolle; NI, p201N: Cas9 no-Insert-Steuerung; GA, verdünnte DNA Montage Reaktion; NT, no-Template Kontrolle. B) Repräsentative Spaltung von vier p201N: Cas9: gRNA Vektoren mit den Restriktionsenzymen Eco RV und Sty I. M, 2-Log - Leiter. C) Vergleich der Treue der Standard- und High-Fidelity DNA - Montage mischt und die Verteilung der gewonnenen Vektoren , wenn 11 gRNA Oligos in einer einzigen Reaktion wurden gepoolt. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig2large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 3" src="/files/ftp_upload/53843/53843fig3.jpg" /> Abbildung 3. Haarwurzelkulturen und Nachweis von DNA - Modifikation. A) Hairy Wurzeln von Kotyledonen 11 Tage nach der Transformation. B) Die Wurzeln werden für etwa eine Woche auf ½ MS Kan 50 Medien ausgewählt werden können , gesehen entsteht. Graue Balken bezeichnen Position der Wurzelspitzen zum Zeitpunkt der Beschichtung. C) Beispiel für das Klonen undSequenzierung von DNA-Mutationen mit zwei verschiedenen Genziele in vier verschiedenen behaarten-root Ereignisse zu bestimmen. Grau Box bezeichnet 20 GN GG Zielsequenz, Δ Mutationstyp anzeigt, und die Anzahl der Klone mit der angegebenen Mutation. D) Beispiel für Polyacrylamid - Gelelektrophorese von DNA - Mutationen zu bestimmen. Große Deletionen und Heteroduplex-Banden zeigen die Gegenwart von DNA-Mutationen an den Zielsequenzen. Sechs von 12 unabhängigen Ereignisse wurden als Mutanten (Δ) erzielt. WT, Wildtyp-Kontrolle; NT, no-Template Kontrolle. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig3large.jpg" target="_blank">Bitte hier klicken</a> , um <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53843/53843fig3large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots at JoVE.com

High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

High-throughput CRISPR Vector Konstruktion und Charakterisierung von DNA-Modifikationen durch Erzeugung von Tomaten Hairy Roots

Verwendung von DNA-Baugruppe können mehrere CRISPR Vektoren parallel in einem einzigen Reaktions Klonierung konstruiert werden, wodurch die Konstruktion einer großen Anzahl von CRISPR Vektoren eine einfache Aufgabe. Tomato Haarwurzeln sind ein ausgezeichnetes Modellsystem CRISPR Vektoren zu validieren und mutierten Materialien erzeugen.

Targeted DNA mutations generated by vectors with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technology have proven useful for ...

high-throughput-crispr-vector-construction-characterization-dna

Nanyang Technological University

Research

JoVE Journal

Biology

17.9K Aufrufe.  Boyce Thompson Institute for Plant Research.  Verwendung von DNA-Baugruppe können mehrere CRISPR Vektoren parallel in einem einzigen Reaktions Klonierung konstruiert werden, wodurch die Konstruktion einer großen Anzahl von CRISPR Vektoren eine einfache Aufgabe. Tomato Haarwurzeln sind ein ausgezeichnetes Modellsystem CRISPR Vektoren zu validieren und mutierten Materialien erzeugen. 

Serie: High-throughput CRISPR Vector Construction and Characterization of DNA Modifications by Generation of Tomato Hairy Roots

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to possess medicinally relevant biological activity. However, thus far this potential has not translated into a plethora of triterpene-derived drugs in the clinic. This is arguably (at least partially) a consequence of limited practical synthetic access to this class of compound, a problem that can stifle the exploration of structure-activity relationships and development of lead candidates by traditional medicinal chemistry workflows. Despite their immense diversity, triterpenes are all derived from a single linear precursor, 2,3-oxidosqualene. Transient heterologous expression of biosynthetic enzymes in N. benthamiana can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products that are not naturally produced by this host. Agro-infiltration is an efficient and simple means of achieving transient expression in N. benthamiana. The process involves infiltration of plant leaves with a suspension of Agrobacterium tumefaciens carrying the expression construct(s) of interest. Co-infiltration of an additional A. tumefaciens strain carrying an expression construct encoding an enzyme that boosts precursor supply significantly increases yields. After a period of five days, the infiltrated leaf material can be harvested and processed to extract and isolate the resulting triterpene product(s). This is a process that is linearly and reliably scalable, simply by increasing the number of plants used in the experiment. Herein is described a protocol for rapid preparative-scale production of triterpenes utilizing this plant-based platform. The protocol utilizes an easily replicable vacuum infiltration apparatus, which allows the simultaneous infiltration of up to four plants, enabling batch-wise infiltration of hundreds of plants in a short period of time.

Transient Expression in Nicotiana Benthamiana Leaves for Triterpene Production at a Preparative Scale

Transient heterologous expression of biosynthetic enzymes in Nicotiana benthamiana leaves can divert endogenous supplies of 2,3-oxidosqualene towards the production of new high-value triterpene products. Herein is described a detailed protocol for rapid (5 days) preparative-scale production of triterpenes and analogs utilizing this powerful plant-based platform.

Transiente Expression in Nicotiana Benthamiana Blätter für Triterpene Produktion im präparativen Maßstab

The triterpenes are one of the largest and most structurally diverse families of plant natural products. Many triterpene derivatives have been shown to ...

Forschung

Biochemie

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to agriculture. However, the Ralstonia model is considerably underexplored in comparison to other models involving bacterial plant pathogens, such as Pseudomonas syringae in Arabidopsis. Research targeted to understanding the interaction between Ralstonia and crop plants is essential to develop sustainable solutions to fight against bacterial wilt disease but is currently hindered by the lack of straightforward experimental assays to characterize the different components of the interaction in native host plants. In this scenario, we have developed a method to perform genetic analysis of Ralstonia infection of tomato, a natural host of Ralstonia. This method is based on Agrobacterium rhizogenes-mediated transformation of tomato roots, followed by Ralstonia soil-drenching inoculation of the resulting plants, containing transformed roots expressing the construct of interest. The versatility of the root transformation assay allows performing either gene overexpression or gene silencing mediated by RNAi. As a proof of concept, we used this method to show that RNAi-mediated silencing of SlCESA6 in tomato roots conferred resistance to Ralstonia. Here, we describe this method in detail, enabling genetic approaches to understand bacterial wilt disease in a relatively short time and with small requirements of equipment and plant growth space.

Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease

Here, we present a versatile method for tomato root transformation followed by inoculation with Ralstonia solanacearum to perform straightforward genetic analysis for the study of bacterial wilt disease.

Tomatenwurzeltransformation gefolgt von Impfung mit Ralstonia Solanacearum für einfache genetische Analyse der bakteriellen Wilt-Krankheit

Ralstonia solanacearum is a devastating soil borne vascular pathogen that can infect a large range of plant species, causing an important threat to ...

Genetik

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant secondary metabolites such as flavonoids, especially rutin. Agrobacterium rhizogenes have been gradually used worldwide to induce hairy roots in medicinal plants to investigate gene functions and increase the yield of secondary metabolites. In this study, we have described a detailed method to generate A. rhizogenes-mediated hairy roots in TB. Cotyledons and hypocotyledonary axis at 7&#8211;10 days were selected as explants and infected with A. rhizogenes carrying a binary vector, which induced adventitious hairy roots that appeared after 1 week. The generated hairy root transformation was identified based on morphology, resistance selection (kanamycin), and reporter gene expression (green fluorescent protein). Subsequently, the transformed hairy roots were self-propagated as required. Meanwhile, a myeloblastosis (MYB) transcription factor, FtMYB116, was transformed into the TB genome using the A. rhizogenes-mediated hairy roots to verify the role of FtMYB116 in synthesizing flavonoids. The results showed that the expression of flavonoid-related genes and the yield of flavonoid compounds (rutin and quercetin) were significantly (p &#60; 0.01) promoted by FtMYB116, indicating that A. rhizogenes-mediated hairy roots can be used as an effective alternative tool to investigate gene functions and the production of secondary metabolites. The detailed step-by-step protocol described in this study for generating hairy roots can be adopted for any genetic transformation or other medicinal plants after adjustment.

Inducing Hairy Roots by Agrobacterium rhizogenes-Mediated Transformation in Tartary Buckwheat Fagopyrum tataricum

We describe a method of inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in Tartary buckwheat (Fagopyrum tataricum). This can be used to investigate gene functions and production of secondary metabolites in Tartary buckwheat, be adopted for any genetic transformation, or used for other medicinal plants after improvement.

Induzieren hairy Roots von Agrobacterium rhizogenes-Mediated Transformation in Tartary Buchweizen (Fagopyrum tataricum)

Tartary buckwheat (TB) [Fagopyrum tataricum (L.) Gaertn] possesses various biological and pharmacological activities because it contains abundant ...

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

<meta charset="utf8"></head><body>CcCIPK14 Genfunktionsanalyse zur Aufklärung des effizienten wurzeltransgenen Systems

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

CcCIPK14 Genfunktionsanalyse zur Aufklärung des effizienten wurzeltransgenen Systems

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an ...

Aufbau einer UAS-cDNA/ORF-Plasmidbibliothek mit hohem Durchsatz unter Verwendung von CRISPRmass

CRISPR-Based Modular Assembly for High-Throughput Construction of a UAS-cDNA/ORF Plasmid Library

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. Conventional approaches for plasmid library construction are time-consuming and laborious. Therefore, we recently developed a simple and efficient method, CRISPR-based modular assembly (CRISPRmass), for high-throughput construction of a genome-wide upstream activating sequence-complementary DNA/open reading frame (UAS-cDNA/ORF) plasmid library. Here, we present a protocol for CRISPRmass, taking as an example the construction of a GAL4/UAS-based UAS-cDNA/ORF plasmid library. The protocol includes massively parallel two-step test tube reactions followed by bacterial transformation. The first step is to linearize the existing complementary DNA (cDNA) or open reading frame (ORF) cDNA or ORF library plasmids by cutting the shared upstream vector sequences adjacent to the 5&#39; end of cDNAs or ORFs using CRISPR/Cas9 together with single guide RNA (sgRNA), and the second step is to insert a UAS module into the linearized cDNA or ORF plasmids using a single step reaction. CRISPRmass allows the simple, fast, efficient, and cost-effective construction of various plasmid libraries. The UAS-cDNA/ORF plasmid library can be utilized for gain-of-function screening in cultured cells and for constructing a genome-wide transgenic UAS-cDNA/ORF library in Drosophila.&#160;

Autor im Rampenlicht: Vereinfachung des aufbaus genomweiter Plasmidbibliotheken mit CRISPRmass

We present a protocol for CRISPR-based modular assembly (CRISPRmass), a method for high-throughput construction of UAS-cDNA/ORF plasmid library in Drosophila using publicly available cDNA/ORF resources. CRISPRmass can be applied to editing various plasmid libraries.

CRISPR-basierter modularer Aufbau für den Hochdurchsatzaufbau einer UAS-cDNA/ORF-Plasmidbibliothek

Functional genomics screening offers a powerful approach to probe gene function and relies on the construction of genome-wide plasmid libraries. ...

Gene Digital Circuits Based on CRISPR-Cas Systems and Anti-CRISPR Proteins

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the CRISPR-Cas systems and their natural inhibitors-the anti-CRISPR proteins (Acrs)-provides a new tool to design and implement in vivo gene digital circuits. Here, we describe a protocol that follows the idea of the "Design-Build-Test-Learn" biological engineering cycle and makes use of dCas9/dCas12a together with their corresponding Acrs to establish small transcriptional networks, some of which behave like Boolean gates, in Saccharomyces cerevisiae. These results point out the properties of dCas9/dCas12a as transcription factors. In particular, to achieve maximal activation of gene expression, dSpCas9 needs to interact with an engineered scaffold RNA that collects multiple copies of the VP64 activation domain (AD). In contrast, dCas12a shall be fused, at the C terminus, with the strong VP64-p65-Rta (VPR) AD. Furthermore, the activity of both Cas proteins is not enhanced by increasing the amount of sgRNA/crRNA in the cell. This article also explains how to build Boolean gates based on the CRISPR-dCas-Acr interaction. The AcrIIA4 fused hormone-binding domain of the human estrogen receptor is the core of a NOT gate responsive to &#946;-estradiol, whereas AcrVAs synthesized by the inducible GAL1 promoter permits to mimic both YES and NOT gates with galactose as an input. In the latter circuits, AcrVA5, together with dLbCas12a, showed the best logic behavior.

CRISPR-Cas systems and anti-CRISPR proteins were integrated into the scheme of Boolean gates in Saccharomyces cerevisiae. The new small logic circuits showed good performance and deepened the understanding of both dCas9/dCas12a-based transcription factors and the properties of anti-CRISPR proteins.

Digitale Genschaltkreise auf Basis von CRISPR-Cas-Systemen und Anti-CRISPR-Proteinen

Synthetic gene Boolean gates and digital circuits have a broad range of applications, from medical diagnostics to environmental care. The discovery of the ...

Biotechnik

Hocheffiziente Produktion von transgenen Sojabohnen-Haarwurzeln

Soybean Hairy Root Transformation for the Analysis of Gene Function

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with soil-borne microbes that form symbiosis to fix nitrogen and pathogens, which makes research involving soybean root genetics of prime importance to improve its agricultural production. The genetic transformation of soybean hairy roots (HRs) is mediated by the Agrobacterium rhizogenes strain NCPPB2659 (K599) and is an efficient tool for studying gene function in soybean roots, taking only 2 months from start to finish. Here, we provide a detailed protocol that outlines the method for overexpressing and silencing a gene of interest in soybean HRs. This methodology includes soybean seed sterilization, infection of cotyledons with K599, and the selection and harvesting of genetically transformed HRs for RNA isolation and, if warranted, metabolite analyses. The throughput of the approach is sufficient to simultaneously study several genes or networks and could determine the optimal engineering strategies prior to committing to long-term stable transformation approaches.

Autor im Rampenlicht: Sojabohnen-Haarwurzeltransformation für die Analyse der Genfunktion  

Here, we present a protocol for the high-efficiency production of transgenic soybean hairy roots.

Sojabohnen-Haarwurzeltransformation zur Analyse der Genfunktion

Soybean (Glycine max) is a valuable crop in agriculture that has thousands of industrial uses. Soybean roots are the primary site of interaction with ...

High-throughput CRISPR Vector Konstruktion und Charakterisierung von DNA-Modifikationen durch Erzeugung von Tomaten Hairy Roots

Zusammenfassung

Weitere Videos entdecken

Transiente Expression in Nicotiana Benthamiana Blätter für Triterpene Produktion im präparativen Maßstab

Tomatenwurzeltransformation gefolgt von Impfung mit Ralstonia Solanacearum für einfache genetische Analyse der bakteriellen Wilt-Krankheit

Induzieren hairy Roots von Agrobacterium rhizogenes-Mediated Transformation in Tartary Buchweizen (Fagopyrum tataricum)

CcCIPK14 Genfunktionsanalyse zur Aufklärung des effizienten wurzeltransgenen Systems

CcCIPK14 Genfunktionsanalyse zur Aufklärung des effizienten wurzeltransgenen Systems

CRISPR-basierter modularer Aufbau für den Hochdurchsatzaufbau einer UAS-cDNA/ORF-Plasmidbibliothek

CRISPR-basierter modularer Aufbau für den Hochdurchsatzaufbau einer UAS-cDNA/ORF-Plasmidbibliothek

CRISPR-basierter modularer Aufbau für den Hochdurchsatzaufbau einer UAS-cDNA/ORF-Plasmidbibliothek

Digitale Genschaltkreise auf Basis von CRISPR-Cas-Systemen und Anti-CRISPR-Proteinen

Sojabohnen-Haarwurzeltransformation zur Analyse der Genfunktion