Name: 3' end sequencing library preparation with a-seq2
Uploaded: 2017-10-10T14:00:00.000+00:00
Duration: 12 min 1 s
Description: Watch this Scientific Journal Video about 3' End Sequencing Library Preparation with A-seq2 at JoVE.com

يشكر المؤلفون السيدة بياتريس ديميترياديس للحصول على مساعدة خلية ثقافة. هذا العمل كان تدعمه "مؤسسة العلوم الوطنية السويسرية" منح #31003A_170216 و 51NF40_141735 (الجيش الملكي النيبالي نككر &#38; المرض).

<ol>
	<li>Jan, C. H., Friedman, R. C., Ruby, J. G., Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation,+regulation+and+evolution+of+Caenorhabditis+elegans+3'UTRs.">Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs.</a> Nature. 469 (7328), 97-101 (2011).</li><li>Spies, N., Burge, C. B., Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'+UTR-isoform+choice+has+limited+influence+on+the+stability+and+translational+efficiency+of+most+mRNAs+in+mouse+fibroblasts.">3' UTR-isoform choice has limited influence on the stability and translational efficiency of most mRNAs in mouse fibroblasts.</a> Genome Res. 23 (12), 2078-2090 (2013).</li><li>Hoque, M., Ji, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+alternative+cleavage+and+polyadenylation+by+3'+region+extraction+and+deep+sequencing.">Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing.</a> Nat. methods. 10 (2), 133-139 (2013).</li><li>Martin, G., Gruber, A. R., Keller, W., Zavolan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+of+pre-mRNA+3’+end+processing+reveals+a+decisive+role+of+human+cleavage+factor+I+in+the+regulation+of+3'+UTR+length.">Genome-wide analysis of pre-mRNA 3’ end processing reveals a decisive role of human cleavage factor I in the regulation of 3' UTR length.</a> Cell Rep. 1 (6), 753-763 (2012).</li><li>Gruber, A. R., Martin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+3'+UTR+shortening+has+a+limited+effect+on+protein+abundance+in+proliferating+T+cells.">Global 3' UTR shortening has a limited effect on protein abundance in proliferating T cells.</a> Nat. Commun. 5, 5465 (2014).</li><li>Kivioja, T., V&#228;h&#228;rautio, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Counting+absolute+numbers+of+molecules+using+unique+molecular+identifiers.">Counting absolute numbers of molecules using unique molecular identifiers.</a> Nat. methods. 9 (1), 72-74 (2011).</li><li>Gruber, A. J., Schmidt, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comprehensive+analysis+of+3'+end+sequencing+data+sets+reveals+novel+polyadenylation+signals+and+the+repressive+role+of+heterogeneous+ribonucleoprotein+C+on+cleavage+and+polyadenylation.">A comprehensive analysis of 3' end sequencing data sets reveals novel polyadenylation signals and the repressive role of heterogeneous ribonucleoprotein C on cleavage and polyadenylation.</a> Genome Res. 26 (8), 1145-1159 (2016).</li><li>Lingner, J., Keller, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-end+labeling+of+RNA+with+recombinant+yeast+poly(A)+polymerase.">3'-end labeling of RNA with recombinant yeast poly(A) polymerase.</a> Nucleic Acids Res. 21 (12), 2917-2920 (1993).</li><li>Quail, M. A., Kozarewa, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+large+genome+center's+improvements+to+the+Illumina+sequencing+system.">A large genome center's improvements to the Illumina sequencing system.</a> Nat. methods. 5 (12), 1005-1010 (2008).</li><li>Rahmann, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snakemake--a+scalable+bioinformatics+workflow+engine.">Snakemake--a scalable bioinformatics workflow engine.</a> Bioinformatics. 28 (19), 2520-2522 (2012).</li><li>. Anaconda Software Distribution Available from: <a target="_blank" href="https://continuum.io">https://continuum.io</a> (2016)</li><li>Dobin, A., Davis, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STAR:+ultrafast+universal+RNA-seq+aligner.">STAR: ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10-12 (2011).</li><li>Li, H., Handsaker, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Robinson, J. T., Thorvaldsd&#243;ttir, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genomics+viewer.">Integrative genomics viewer.</a> Nat. Biotechnol. 29 (1), 24-26 (2011).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+a+flexible+suite+of+utilities+for+comparing+genomic+features.">BEDTools: a flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Ozsolak, F., Platt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+RNA+sequencing.">Direct RNA sequencing.</a> Nature. 461 (7265), 814-818 (2009).</li><li>Yao, C., Biesinger, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome-wide+analyses+of+CstF64-RNA+interactions+in+global+regulation+of+mRNA+alternative+polyadenylation.">Transcriptome-wide analyses of CstF64-RNA interactions in global regulation of mRNA alternative polyadenylation.</a> Proc. Natl. Acad. Sci. U. S. A. 109 (46), 18773-18778 (2012).</li><li>Lin, Y., Li, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+in-depth+map+of+polyadenylation+sites+in+cancer.">An in-depth map of polyadenylation sites in cancer.</a> Nucleic Acids Res. 40 (17), 8460-8471 (2012).</li><li>Shepard, P. J., Choi, E. -. A., Lu, J., Flanagan, L. A., Hertel, K. J., Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+and+dynamic+landscape+of+RNA+polyadenylation+revealed+by+PAS-Seq.">Complex and dynamic landscape of RNA polyadenylation revealed by PAS-Seq.</a> RNA. 17 (4), 761-772 (2011).</li><li>Fu, Y., Sun, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+genome-wide+profiling+of+tandem+3'+UTRs+among+human+breast+cancer+and+normal+cells+by+high-throughput+sequencing.">Differential genome-wide profiling of tandem 3' UTRs among human breast cancer and normal cells by high-throughput sequencing.</a> Genome Res. 21 (5), 741-747 (2011).</li></ol>

الكتاب ليس لها علاقة بالكشف عن.

العديد من الموارد الأساسية والعوامل المساعدة التي تشارك في تجهيز مرناً قبل 3 ' نهاية تتجلى في المناظر الطبيعية معقدة في المقابل بوليادينيليشن. بالإضافة إلى ذلك، بوليادينيليشن أيضا استجابة للتغيرات في العمليات الأخرى مثل النسخ والربط. 3 'نهاية الانقسام في مرناس قبل هي عادة تحديد مواقع استناداً إلى ذيول poly(A) المميزة التي يتم إضافتها إلى المنتجات انشقاق 5'. استخدام معظم وسائل الإشعال oligo(dT) الأطوال المتغيرة التي تسمح التحويل المحددة من بولي (أ)-تتضمن مرناس إلى كدناس في رد فعل نسخ عكسي. مشكلة شائعة لهذا النهج فتيلة الداخلية إلى تسلسل A الغنية نتج عنه انشقاق artifactual المواقع. وقد اقترحت اثنين من الأساليب التي تهدف إلى التحايل على هذه القطع الأثرية في مرحلة إعداد عينة. في أسلوب seq ف 3- 1، على وجه التحديد هي متصلة محولات لينتهي ذيول poly(A) مع مساعدة من اليغو جبيرة تليها الجزئي T1 رناسي الهضم والنسخ العكسي مع TTP في رد الفعل ديوكسينوكليوتيدي فقط. ثم يتم هضمها هيتيرودوبليكسيس poly(A)-poly(dT) الناتج مع "ح رناسي" والأجزاء رنا المتبقية هي معزولة ومتصلة لمحولات ومتسلسلة. طريقة بسيطة وأنيقة، ف 2-seq، يستخدم تسلسل مخصص التمهيدي تخطي وأبلغت تمتد oligo(dT) المتبقية في رد فعل تسلسل المؤلف نفسه 2. في أسلوب ذات صلة، 3 ' يقرأ 3، التمهيدي طويلاً على نحو غير عادي من 5 لنا و 45 واتس، التي تتضمن أيضا بيوتين هو تعتيق للجيش الملكي النيبالي مجزأة، تليها يغسل صارمة لتحديد لجزيئات الحمض النووي الريبي مع ذيول poly(A) النيوكليوتيدات ما يزيد على 50. على الرغم من أن يقرأ 3 ' تواتر فتيلة الداخلية يخفض بشكل كبير، فإنه لا تماما القضاء عليه 3. كما اقترحت بروتوكولات لتسلسل الحمض النووي الريبي مباشرة، ولكن القراءات الناتجة غير قصيرة ونسبة عالية من الخطأ وهذا النهج لم يكن كذلك نمواً 18،،من1920. بوليا-Seq والبروتوكولات Seq كوانت تجارياً ضم فتيلة oligo(dT) تقوم بخطوة فتيلة عشوائي لكدنا الثانية حبلا توليف 20. استخدام تبديل قالب رد فعل النسخ العكسي مع المنتسخة العكسية فيروس اللوكيميا مولوني موريني (مملف) يؤدي إلى توليد كدناس مع linkers في خطوة واحدة، ومما يمكن أن تظهر لا محول dimers Seq نظام تقييم الأداء وأساليب ساباس 21 , 22.
الأسلوب A-seq2 قدم هنا تبرز في استفادتها النوكليوتيدات كليفابل (dU) ضمن كتاب oligo(dT) بيوتينيلاتيد. يجمع هذا التعديل الأداة المساعدة لإثراء oligo(dT) المهجنة، بوليادينيلاتيد الأهداف مع إزالة معظم تسلسل25 اليغو (dT) من أجزاء معزولة قبل أن يتم إعداد المكتبات والحفاظ على الملخص الثلاثة، التي وتشير إلى وجود الذيل poly(A) السابقة. وفي المقابل، ترك الأساليب التي تستخدم "رناسي ح" لإزالة poly(A) من جزيئات الحمض النووي الريبي عشوائياً عدة كما. منذ في A-seq2، يتم تسلسل من 3 ' نهاية خيوط معنى المضادة، مواقع الانقسام ويتوقع أن تكون موجودة بعد عزر نننتت في بداية ما يلي تسلسل الخام. تيتراميرس معشاة ذات شواهد تخدم ليس فقط للسماح لقاعدة الدعوة بل أيضا في القضاء على بكر التضخيم التحف. كما يمكن أن تستوعب UMIs أطول. إمكانية فتيلة الداخلية لا تزال في seq2 أ ويتم معالجتها حسابياً، أولاً بتجاهل 3 'ينتهي مع تسلسل المتلقين للمعلومات المرمزة جينوميكالي، الغنية بألف ومن ثم طريق تجاهل 3' نهاية الكتل التي يمكن أن تفسر فتيلة الداخلية في إشارة poly(A) الغنية بحد ذاتها. تحليل حديث للمواقع poly(A) الاستدلال فريد من خلال عدد كبير من البروتوكولات يشير إلى أن المواقع التي فريدة من نوعها إلى A-seq2 بتوزيع النوكليوتيدات المتوقعة وموقع داخل الجينات، مماثلة لغيرها 3 ' في نهاية تسلسل البروتوكولات.
هو خطوة حاسمة في seq2 بتحديد بوليادينيلاتيد الجيش الملكي النيبالي وإزالة الريباسي الكشف والكشف الصغيرة المختلفة. يتم ذلك بسهولة بمجموعة مرناً وعزل مع اليغو (dT)25 المغناطيسي الخرز. من حيث المبدأ، يعطي مجموع الجيش الملكي النيبالي معزولة مع الفينول الذي يحتوي على الحلول أيضا الجيش الملكي النيبالي التي يمكن أن تخضع لاختيار المزيد من طقم مرناً والعزل أو اليغو (dT) [اغروس] ذات جودة عالية. خطوة التي يمكن أن تختلف في seq2 أ هو العلاج مع التحلل القلوية التي يمكن اختصارها أو الموسعة للحصول على الأجزاء رنا ذات أحجام مختلفة. الحرجة أيضا إضافة 3 'داتب إلى 3' نهايات الأجزاء رنا بوليميراز poly(A) بكفاءة. في البروتوكول هو موضح هنا، يتم تطبيق هذا العلاج على كافة الأجزاء رنا، لتجنب كونكاتيميريزيشن أثناء عملية التفاعل عملية ربط. وأخيراً، نلاحظ أنه على الرغم من أن الجيش الملكي النيبالي ليجاسى 1 يستخدم عادة ليجاسى الحمض النووي الريبي، فإنه أيضا ليجاتيس الحمض النووي الذين تقطعت بهم السبل كفاءة واحدة، كما فعلنا هنا سد محول إلى 5 ' نهاية الجزيئات كدنا.
وهكذا، A-seq2 فعالة وسهلة لتنفيذ البروتوكول المتعلق بتحديد مرناً قبل 3 ' نهاية تجهيز المواقع. ويمكن أن تشمل التطورات في المستقبل كذلك تقليل تعقيد البروتوكول وكمية المواد المطلوبة. تمكين مجموعة مرتبطة من أدوات تحليل البيانات الحسابية كذلك تجهيز 3 ' نهاية تسلسل ما يلي حصل مع طائفة واسعة من بروتوكولات متجانسة.

التقاط وتسلسل مرناً 3 ' ينتهي يتيح دراسة تجهيز مرناً والتحديد الكمي للتعبير الجيني. سبب ذيولها poly(A)، مرناس التوكسينات يمكن أن تكون كفاءة تنقيته من ليساتيس خلية الإجمالي مع المعطل تداولها حبة اليغو-ديوكسيثيميديني (oligo(dT)) الجزيئات، التي يمكن أيضا أن رئيس الوزراء كدنا التوليف. بيد أن هذا النهج قد اثنين من العوائق. أولاً، يمكن أن تمتد من أ أن تكون داخلية للنصوص أيضا رئيس الوزراء توليف كدنا، أسفر عن مواقع زائفة poly(A). Poly(A) الثاني، ومتجانسة تمتد تحديات محددة للتسلسل، إلى جانب كونها غير مفيدة لتحديد نص. قد اقترحت نهوج مختلفة للتحايل على هذه القيود، مثل النسخ العكسي عن طريق poly(A) ذيول تليها "ح رناسي" الهضم (ف 3-seq 1)، استخدم من التمهيدي تسلسل مخصص المنتهي في 20 Ts (seq 2 ف- 2)، الاختيار الأولى من الأجزاء رنا مع ذيول poly(A) النيوكليوتيدات ما يزيد على 50 مع تمهيدي45 CU5T متبوعاً بالهضم "ح رناسي" (ما يلي: 3 ' 3)، واستخدام اليغو-dT التمهيدي الذي يحتوي على محول 3' في دبوس (seq أ 4).
الأسلوب A-seq2 5 وضعت مؤخرا يهدف إلى تجاوز التسلسل عن طريق poly(A) وفي نفس الوقت تقليل نسبة dimers التي يتم إنشاؤها بواسطة ربط الذاتي لمحولات، خاصة التي تحدث عند تركيز مولى للمحولات يفوق تركيز إدراج. ويمكن القضاء على هذه المشكلة عندما تكون متصلة كلا محولات لنفس النوع من نهايات بولينوكليوتيدي كما هو الحال في أ-seq2، أين هي متصلة المحولات 3 'إلى 5' نهاية الأجزاء رنا والمحولات 5 'إلى 5' ينتهي كدناس بعد النسخ العكسي. الأسلوب أكثر ملاءمة من أعمالنا المقترح سابقا A-seq-التي كان تسلسلها في 5 '-إلى-3' التحكم في اتجاه مما يتطلب تحديداً الحمض النووي الريبي التجزؤ-، مع الحفاظ على درجة عالية من دقة في تحديد موقع poly(A). حوالي 80% من ما يلي التسلسل في عينات نموذجية خريطة فريدة للجينوم وتؤدي إلى كشف هوية من 20,000 أكثر مجموعات الموقع poly(A)، أكثر من 70% من أي تداخل مع المشروح 3 ' تحيلها.
وباختصار، يبدأ البروتوكول A-seq2 مع تجزئة مرناً وربط محولات عكس-تكملة 3 'إلى 5' نهايات الأجزاء رنا. بولي (A)-تحتوي على الكشف ثم يتم عكس نسخها مع تمهيدي oligo(dT) طويلة النوكليوتيدات 25 (nt) يحتوي النوكليوتيدات مرساة في نهاية 3 '، من دو في موقف 4 وبيوتين في 5' نهاية، يسمح ملزمة لكدنا الخرز streptavidin المغناطيسي. تتم إزالة معظم التمهيدي، بما في ذلك البيوتين، من كدنا قبل الانقسام في دو بمزيج الإنزيم المستخدم، التي تحتوي على "الحمض النووي اليوراسيل" glycosylase (UDG) و "الثامن اندونوكلياسي" جليكوسيلاسي لياز الحمض النووي. رد الفعل هذا يترك نهايات سليمة لربط محول 5 '، واليسار إتس الثلاثة بعد انشقاق تبقى لوضع علامة على موقع الذيل poly(A). لكل 5 '3' المحولات ومرفقه بربط للمستلم 5 ' الغايات، يتم إنشاء لا dimers محول. يسمح قرار الكتلة في تسلسل الدولة من أحدث الصكوك الأربعة النوكليوتيدات عشوائية-أسعار الصرف السوقية قدم في بداية ما يلي: ويمكن أيضا بمثابة المعرف الفريد الجزيئية (أومي) لكشف وإزالة الآثار التضخيم PCR. يمكن زيادة حجم أومي كما فعلت في دراسات أخرى 6. ينشئ البروتوكول بما يلي: أن يتم عكس مكملة مرناً 3 'ينتهي، كل شيء بدءاً من تيترامير معشاة ذات شواهد تليها 3 Ts-تجهيز من القراءات التي لها للملخص التشخيصي 3 في نهاية يبدأ 5' مع تصحيح PCR التضخيم التحف استغلال أميس، إزالة 3 ' تسلسل محول، وعكس التكامل. أيضا تحديد حسابياً القراءات التي قد تكون قد نشأت من فتيلة oligo(dT) الداخلية الغنية بالمواقع والتخلص منها. المواقع الزائفة التي تفتقر عموما إلى واحد من 18 تتسم جيدا وإشارات حفظت poly(A) الذي ينبغي أن يقع النيوكليوتيدات ~ 21 المنبع من موقع الانقسام الظاهر 7.
يتطلب البروتوكول وقت التدريب العملي على ح حوالي 8، لا عد زراعة الخلايا وليجيشنز بين عشية وضحاها. المرتبطة بها قراءة تحليل البرمجيات تمكن من تحديد موقع poly(A) درجة عالية من دقة. من موقع poly(A) إنشاء مجموعات استناداً إلى عينات 4 كذلك والضوء على هذه المخطوطة (اثنان replicates البيولوجية siRNA التحكم وخلايا سي-هنرنبك-تعامل) 84% التداخل مع جينات مشروح، وهذه، 75% من التداخل مع 3 ' UTR، 86% أما مع 3 ' UTR أو إكسون المحطة طرفية. معامل ارتباط Pearson للتعبير عن 3 ' ينتهي في عينات تكرار 0.92، وعادة ما يتم الحصول على قيم من خلال 0.9 مع الأسلوب. وهكذا، A-seq2 هو أسلوب مناسب يعطي نتائج جداً استنساخه.

<table><tbody><tr><td>&lt;strong&gt;Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Agarose, ultra pure</td><td>Invitrogen</td><td>16500-500</td><td></td></tr><tr><td>2100 Bioanalyzer</td><td>Agilent</td><td>G2940CA</td><td></td></tr><tr><td>Cordycepin triphosphate (3&amp;rsquo; dATP)</td><td>SIGMA</td><td>C9137</td><td></td></tr><tr><td>DNA low bind vials, 1.5 ml</td><td>Eppendorf</td><td>22431021</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline</td><td>SIGMA</td><td>D8637</td><td></td></tr><tr><td>Dynabeads mRNA-DIRECT Kit</td><td>Ambion</td><td>AM61012</td><td></td></tr><tr><td>GR-Green dye</td><td>Excellgen</td><td>EG-1071</td><td>use 1:10,000 dillution</td></tr><tr><td>HiSeq 2500 or NextSeq 500 next generation sequencers</td><td>Illumina</td><td>inquire with supplier</td><td></td></tr><tr><td>KAPA HiFi Hotstart DNA polymerase mix</td><td>KAPA/Roche</td><td>KK2602</td><td></td></tr><tr><td>Nuclease free water</td><td>Ambion</td><td>AM9937</td><td></td></tr><tr><td>Poly(A) polymerase, yeast</td><td>Thermo Fisher Scientific</td><td>74225Z25KU</td><td></td></tr><tr><td>Poly(A) polymerase, E.coli</td><td>New England Biolabs</td><td>M0276L</td><td></td></tr><tr><td>Polynucleotide kinase</td><td>Thermo Fisher Scientific</td><td>EK0032</td><td></td></tr><tr><td>QIAEX II Gel Extraction Kit</td><td>Qiagen</td><td>20021</td><td></td></tr><tr><td>QIAquick PCR Purification Kit</td><td>Qiagen</td><td>28104</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>RNA ligase 1, high concentration</td><td>New England Biolabs</td><td>M0437M</td><td>includes PEG-8000</td></tr><tr><td>RNeasy MinElute RNA Cleanup kit</td><td>Qiagen</td><td>74204</td><td></td></tr><tr><td>RNase H</td><td>New England Biolabs</td><td>M0279</td><td></td></tr><tr><td>RNasin Plus, ribonuclease inhibitor</td><td>Promega</td><td>N2618</td><td></td></tr><tr><td>Superscript IV reverse transcriptase</td><td>Thermo Fisher Scientiific</td><td>18090050</td><td></td></tr><tr><td>Turbo DNase</td><td>Ambion</td><td>AM2238</td><td></td></tr><tr><td>USER enzyme mix</td><td>New England Biolabs</td><td>M5505</td><td></td></tr><tr><td>Dyna-Mag-2 magnetic rack</td><td>Thermo Fisher Scientific</td><td>12321D</td><td></td></tr><tr><td>Thermomixer C</td><td>Eppendorf</td><td>5382000015</td><td>Heated mixer with heated lid</td></tr><tr><td>MicroSpin columns</td><td>GE-Healthcare</td><td>27-5325-01</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Buffers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Alkaline hydrolysis buffer, 1.5 x</td><td></td><td></td><td>Mix 1 part 0.1 M Na2CO3 and 9 parts 0.1 M NaHCO3. Add EDTA to 1 mM. Adjust pH to 9.2. Store aliquots at -20 &amp;deg;C.</td></tr><tr><td>5x poly(A) polymerase buffer</td><td>Thermo Fisher Scientiific</td><td></td><td>100 mM Tris-HCl, pH 7.0, 3 mM MnCl2, 0.1 mM EDTA, 1 mM DTT, 0.5 mg/ml acetylated BSA, 50% glycerol</td></tr><tr><td>Biotin binding buffer</td><td></td><td></td><td>20 mM Tris&amp;shy;Cl pH 7.5, 2 M NaCl, 0.1% NP&amp;shy;40</td></tr><tr><td>TEN buffer</td><td></td><td></td><td>10 mM Tris&amp;shy;Cl, pH 7.5, 1 mM EDTA, 0.02% NP&amp;shy;40</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Sequence&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Oligonucleotides according to Illumina TruSeq Small RNA Sample Prep Kits, for GA-IIx and Hiseq2000/2500 sequencers&lt;/strong&gt;</td><td>&lt;strong&gt;Microsynth&lt;/strong&gt;</td><td></td><td></td></tr><tr><td>revRA3 (RNA)</td><td>Microsynth</td><td></td><td>5&amp;rsquo; amino&amp;shy; CCUUGGCACCCGAGAAUUCCA&amp;shy; 3&amp;rsquo;</td></tr><tr><td>revDA5</td><td>Microsynth</td><td></td><td>5&amp;rsquo; amino&amp;shy; GTTCAGAGTTCTACAGTCCGAC GATCNNNN-3&amp;rsquo;</td></tr><tr><td>Bio-dU-dT25, RT primer</td><td>Microsynth</td><td></td><td>5&#039; Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3&#039; (V = G, A or C)</td></tr><tr><td>PCR primer forward, RP1</td><td>Microsynth</td><td></td><td>5&#039; AATGATACGGCGACCACCGAGA TCTACACGTTCAGAGTTCTACAG&lt;br/&gt;TCCGA 3&#039;</td></tr><tr><td>PCR primer reverse, RPI1, barcode in bold</td><td>Microsynth</td><td></td><td>5&#039; CAAGCAGAAGACGGCATACGAG&lt;br/&gt;
AT&lt;strong&gt;CGTGAT&lt;/strong&gt;GTGACTGGAGTTCCT&lt;br/&gt;
TGGCACCCGAGAATTCCA 3&#039;</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Oligonucleotides according to Illumina TruSeq HT-Small RNA Sample Prep Kits, for HiSeq2000/2500 and NextSeq500 sequencers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HT-rev3A (DNA/RNA)</td><td>Microsynth</td><td></td><td>5&#039;-amino-GTGACTGGAGTTCAGACGTGTG&lt;br/&gt;
CTCTTCCrGrAUrC-3&#039;</td></tr><tr><td>HT-rev5A</td><td>Microsynth</td><td></td><td>5&#039; amino-ACACTCTTTCCCTACACGACGCT&lt;br/&gt;
CTTCCGATCTNNNN 3&#039;</td></tr><tr><td>Bio-dU-dT25, RT primer</td><td>Microsynth</td><td></td><td>5&#039; Biotin-TTTTTTTTTTTTTTTTTTTTTTTTTT-dU-TTTVN 3&#039;</td></tr><tr><td>PCR primers forward (D501-506)</td><td>Microsynth or Illumina</td><td></td><td>5&#039;-AATGATACGGCGACCACCGAGAT&lt;br/&gt;CTACAC[i5]ACACTCTTTCCCTACA&lt;br/&gt;CGACGCTCTTCCGATCT -3&#039;</td></tr><tr><td>PCR primers reverse (D701-D712)</td><td>Microsynth or Illumina</td><td></td><td>5&#039;-CAAGCAGAAGACGGCATACGAG A[i7]GTGACTGGAGTTCAGACGTG TGCTCTTCCGATC-3&#039;</td></tr><tr><td>Documentation for Illumina multiplexing:</td><td>Illumina</td><td></td><td>https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences_1000000002694-01.pdf</td></tr></tbody></table>

3' end sequencing library preparation with a-seq2

وأظهرت الدراسات في العقد الماضي مجموعة متنوعة معقدة ودينامية مرناً قبل الانقسام وردود الفعل بوليادينيليشن. مرناس مع مناطق 3 'أهمل طويلاً (تحيلها) يتم إنشاؤها في الخلايا المتمايزة حين تكاثر الخلايا تفضيلي التعبير عن النصوص مع قصيرة 3' تحيلها. ونحن تصف البروتوكول A seq، الآن في نسخته الثانية، التي وضعت خريطة مواقع بوليادينيليشن على نطاق الجينوم ودراسة تنظيم مرناً قبل 3 ' نهاية المعالجة. كما يستفيد هذا البروتوكول الحالي من بوليادينيلاتي (ذيول poly(A)) التي يتم إضافتها أثناء نشوء حيوي لمعظم الثدييات مرناس لإثراء مرناس المجهزة تماما. محول الحمض النووي مع ديوكسيوراسيل في موقفها الرابعة تسمح معالجة دقيقة مرناً 3 ' نهاية الأجزاء للتسلسل. لا بما في ذلك زراعة الخلايا وليجيشنز بين عشية وضحاها، يتطلب البروتوكول وقت التدريب العملي على ح حوالي 8. جنبا إلى جنب معها، يتم توفير حزمة برامج سهلة الاستخدام لتحليل البيانات المشتقة من التسلسل. A-seq2 والبرامج المرتبطة بها تحليل توفر حلاً فعالة وموثوق بها للتعيين من قبل-مرناً 3 ' ينتهي في طائفة واسعة من الظروف، من 106 أو خلايا أقل.

بولي (A)-التي تحتوي على الحمض النووي الريبي قد تم عزلة من الخلايا المستزرعة، مجزأة بواسطة التحلل المائي القلوي، وقدمت كدناس عكس النسخ مع الإشعال oligo(dT). كدنا الناتجة كانت معطلة في الخرز streptavidin، كان المشقوق دو في رد فعل الختان محددة اليوراسيل ومحولات كانت متصلة إلى 5 'وكان التسلسل 3' ينتهي الجزء ملصوق وتدرج. ويصور الشكل 1 مخطط رسومي للتجربة.
لخلايا هيلا و HEK293، كانت 106 خلايا كافية لتحديد مواقع poly(A) للغالبية العظمى من الجينات ترميز البروتين في نهاية الإجراء. ومع ذلك، لأنواع الخلايا أو الأنسجة قد يكون من الضروري لاختبار التشبع في عدد المواقع poly(A) التي تم تحديدها كعدد الخلايا التي استخدمت في التجربة الأخرى زيادات. النتائج ممثلة لبكر التجريبية خطوة وجزء الحمض النووي وتحليل العينة قبل تسلسل ترد في الشكل 2.
ويبين الشكل 3 خطوات ما قبل المعالجة التحليل الحسابي، بدءاً من الملف فستق التي تم الحصول عليها من جهاز التسلسل وانتهاء بما يلي: التحقق من الجودة، وقلص محول التي على استعداد ليتم تعيينها إلى الجينوم. ويبين الشكل 4 تحليل الخطوات التي تبدأ برسم خرائط ليقرأ على الجينوم ونهاية المقابلة مع كتالوج مرناً 3 ' نهاية تجهيز المواقع التي تم تحديدها في نموذج معين. عندما يتم تحليل عينات متعددة، تنفذ خطوات إضافية لمطابقة نهاية 3 ' تجهيز المواقع التي تم العثور عليها في عينات الأفراد وتقديم تقرير وفرة عبر العينات. تظهر هذه الخطوات في الشكل 5.
وهكذا، مرة واحدة وقد تم تعيين تسلسل عينات، تحليل تسلسل الناتجة عن قراءة الملفات (في شكل فستق) عن طريق خط أنابيب المعالجة المتاحة مباشرة. بعد إضافة معلومات حول العينات لملف التكوين، سيؤدي تنفيذ خط الأنابيب في نوعين رئيسيين من ملفات الإخراج: 1) سرير--الملفات مع جميع 3 'إنهاء تجهيز المواقع المحددة في عينات فردية (مثل " sample1.3pSites.noIP.bed.gz ")، و 2) ملف-سرير مع جميع مجموعات موقع poly(A) (clusters.merged.bed) عبر كافة العينات للدراسة. يتضمن الإخراج أيضا إحداثيات الجينوم لكل القراءات من كل عينة فردية (مثل "sample1. STAR_out/Aligned.sortedByCoord.out.bam ") التي يمكن عرضها في وقت لاحق في مستعرض جينوم مثل إيجف16. عموما يوفر الفحص البصري للتشكيلات الجانبية لقراءة لمحة أولى توزيع مواقع poly(A) في الجينوم والتغييرات التي تحدث على الاضطرابات المحددة التي تم الاضطلاع بها في الدراسة. على سبيل المثال، يظهر في الشكل 6 استجابة جين معين لضرب إلى أسفل البروتين هنرنبك.
كما يتم توفير ملخصات لهذه التوزيعات على نطاق الجينوم (الجدول 1). على وجه التحديد، تحتوي ملفات الإخراج في الدليل "التهم/annotation_overlap" كسور مواقع التي تتداخل مع ميزات المشروح محددة (من الملف الفروق المقدمة كمدخل؛ والمشروح هي: 3 ' UTR، إكسون المحطة الطرفية، إكسون، إنترون، إينتيرجينيك). وأخيراً، لكل عينة، يتم أيضا حفظ النتائج من خطوات المعالجة الفردية (على سبيل المثال، "sample1.summary.tsv"). وهذا يشمل الإعداد: الخام يقرأ في كل عينة، ما يلي: أن يكون هيكل المتوقعة لنهاية 5 '، ما يلي: أن تبقى بعد انهيار كامل بكر التكرارات، يقرأ عالية الجودة وفقا للمعايير المحددة في الخطوة 9، 2، يقرأ تلك الخريطة فريد للجينوم (بعد انهيار تلك التي نتجت عن أخطاء التسلسل، راجع الخطوة 9.5)، يقرأ الخرائط المتعددة (بعد انهيار تلك التي نتجت عن أخطاء التسلسل، راجع الخطوة 9.5)، الخام (غير متفاوت المسافات) 3 'نهاية تجهيز مواقع في كل عينة، الخام 3' نهاية تجهيز المواقع دون فتيلة الداخلية المرشحين المحتملين، فريدة من نوعها 3 ' نهاية تجهيز المواقع من جميع العينات دون المرشحين فتيلة الداخلية، ومجموعة نهائية من مجموعات الموقع poly(A).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56129/56129fig1v2.jpg"> 
رقم 1: الخطوات الرئيسية للبروتوكول A-seq2- يتم الإشارة إلى الخطوات الفردية على الجانب الأيسر من هذا الرقم. إدراج الأجزاء رنا يصور كخطوط خضراء أن يتحول اللون الأحمر لكدنا بعد النسخ العكسي؛ محولات ملونة بالأزرق الفاتح أو اللون البرتقالي. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56129/56129fig1v2large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56129/56129fig2.jpg"> 
رقم 2: الطيار بكر والمنتج النهائي الشخصية- () مختبرين من رد فعل بكر جمعت في دورات مختلفة وفصلها عن المواد الهلامية [اغروس] 2%. تشير الأرقام إلى اليسار إلى الحجم في النيوكليوتيدات العصابات كل منها في سلم الحمض النووي. في هذه التجربة تم اختيار دورات 12 (*) لتفاعل PCR واسعة النطاق. (ب) مثال على عينة بعد اختيار حجم تشغيل محلل حجم جزء من الكشف عن حجم متوسط من النيوكليوتيدات حوالي 280. تشير الأرقام إلى اليسار [فو] إلى كثافة إشارة النسبي. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56129/56129fig2large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56129/56129fig3.jpg"> 
الشكل 3: مخطط لمعالجة ما قبل لتسلسل ما يلي:- تتم معالجة الملفات فستق مع القراءات التي يتم إنشاؤها بواسطة البرامج المرتبطة الصك تسلسل تحديد القراءات عالية الجودة التي سوف يتم تعيينها إلى الجينوم المقابلة. ويوضح الشكل مواصفات المدخلات والمخرجات من الخطوات الفردية في خط الأنابيب، مع وصلات إلى الخطوات الفردية للبروتوكول هو موضح في القسم "معالجة البيانات". <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56129/56129fig3large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56129/56129fig4.jpg"> 
الشكل 4: قراءة الخطوط العريضة لتسلسل المعالجة، من الخطوة لرسم خرائط الجينوم لتوليد الفردية 3 ' نهاية تجهيز المواقع. ويوضح الشكل مواصفات المدخلات والمخرجات من الخطوات الفردية في خط الأنابيب، مع وصلات إلى iنديفيدوال خطوات للبروتوكول هو موضح في القسم "معالجة البيانات". تم وضع علامة ملف الإخراج الرئيسية التي يتم تسليمها إلى المستخدم بخط غامق. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56129/56129fig4large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56129/56129fig5.jpg"> 
الرقم 5: الخطوط العريضة للخطوات التي يتم اتخاذها لإنشاء مجموعات من التنظيم المشترك 3 ' نهاية تسلسل المواقع. ويوضح الشكل مواصفات المدخلات والمخرجات من الخطوات الفردية في خط الأنابيب، مع وصلات إلى الخطوات الفردية للبروتوكول هو موضح في القسم "معالجة البيانات". تم وضع علامة ملف الإخراج الرئيسي بخط غامق. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56129/56129fig5large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56129/56129fig6.jpg"> 
رقم 6: نتائج المثال ملف من 3 ' إنهاء تجهيز ما يلي على طول إكسون المحطة الطرفية من الجينات NUP214، أظهرت في مستعرض الجينوم 16 إيجف- تم إعداد ما يلي: أ-seq2 من عينتين من الخلايا HEK 293، تعامل مع تحكم-siRNA أو siRNA هنرنبك. ما يلي: أن توثيق المواقع poly(A) التي كانت مشروحة بأنابيب تحليل تم حفظها في تنسيق سوق بكارا للأسلحة التي تم استخدامها كمدخلات لمستعرض الجينوم إيجف. 3 'نهايات قمم قراءة خريطة مرناً 3' الغايات التي هي مشروحة في انسيمبل. ملفات التعريف تشير إلى زيادة في استخدام isoform UTR طويلة 3 ' عند هنرنبك تدق لأسفل. <a href="//ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56129/56129fig6large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>سي-مراقبة النسخ المتماثل 1</td>
			<td>سي-مراقبة النسخ المتماثل 2</td>
		</tr>
		<tr>
			<td></td>
			<td>معرف: 29765</td>
			<td>معرف: 32682</td>
		</tr>
		<tr>
			<td>عدد الخام ما يلي:</td>
			<td>44210258</td>
			<td>68570640</td>
		</tr>
		<tr>
			<td>عدد القراءات صالحة بعد التشذيب وتصفية</td>
			<td>14024538</td>
			<td>21211793</td>
		</tr>
		<tr>
			<td>عدد فريد تعيين ما يلي:</td>
			<td>6953674</td>
			<td>13946436</td>
		</tr>
		<tr>
			<td>يقرأ عدد من رسم خرائط لمواقع متعددة</td>
			<td>2040646</td>
			<td>2925839</td>
		</tr>
		<tr>
			<td>عدد فردي 3 ' نهاية تجهيز المواقع</td>
			<td>1107493</td>
			<td>1710353</td>
		</tr>
	</tbody>
</table>
الجدول 1: إخراج المثال أنابيب التحليل. ملخصات القراءات التي تم الحصول عليها في الخطوات الفردية.

Watch this Scientific Journal Video about 3' End Sequencing Library Preparation with A-seq2 at JoVE.com

3' End Sequencing Library Preparation with A-seq2

ويصف هذا البروتوكول طريقة لرسم الخرائط مرناً قبل 3 ' نهاية تجهيز المواقع.

3 ' نهاية تسلسل إعداد مكتبة مع A-seq2

Studies in the last decade have revealed a complex and dynamic variety of pre-mRNA cleavage and polyadenylation reactions. mRNAs with long 3&#39; ...

3-end-sequencing-library-preparation-with-a-seq2

Nanyang Technological University

Research

JoVE Journal

Biology

10.5K Views.  University of Basel. ويصف هذا البروتوكول طريقة لرسم الخرائط مرناً قبل 3 ' نهاية تجهيز المواقع.

Video: 3' End Sequencing Library Preparation with A-seq2

Genome-wide Surveillance of Transcription Errors in Eukaryotic Organisms

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that control the fidelity of transcription. To fill this gap in scientific knowledge, we recently optimized the circle-sequencing assay to detect transcription errors throughout the transcriptome of Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. This protocol will provide researchers with a powerful new tool to map the landscape of transcription errors in eukaryotic cells so that the mechanisms that control the fidelity of transcription can be elucidated in unprecedented detail.

This protocol provides researchers with a new tool to monitor the fidelity of transcription in multiple model organisms.

المراقبة على نطاق الجينوم من أخطاء النسخ في الكائنات الحية حقيقية النواة

Accurate transcription is required for the faithful expression of genetic information. Surprisingly though, little is known about the mechanisms that ...

Genetics

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and effect sizes of regulatory elements to a target gene. Some progress has been made with the bioinformatic prediction of the existence and function of proximal epigenetic modifications associated with activated gene expression using conserved transcription factor binding sites. Chromatin conformation capture studies have revolutionized our ability to discover physical chromatin contacts between sequences and even within an entire genome. Circular chromatin conformation capture coupled with next-generation sequencing (4C-seq), in particular, is designed to discover all possible physical chromatin interactions for a given sequence of interest (viewpoint), such as a target gene or a regulatory enhancer. Current 4C-seq strategies directly sequence from within the viewpoint but require numerous and diverse viewpoints to be simultaneously sequenced to avoid the technical challenges of uniform base calling (imaging) with next generation sequencing platforms. This volume of experiments may not be practical for many laboratories. Here, we report a modified approach to the 4C-seq protocol that incorporates both an additional restriction enzyme digest and qPCR-based amplification steps that are designed to facilitate a greater capture of diverse sequence reads and mitigate the potential for PCR bias, respectively. Our modified 4C method is amenable to the standard molecular biology lab for assessing chromatin architecture.

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

The identification of physical interactions between genes and regulatory elements is challenging but has been facilitated by chromosome conformation capture methods. This modification to the 4C-seq protocol mitigates PCR bias by minimizing over-amplification of PCR templates and maximizes the mappability of reads by incorporating an addition restriction enzyme digest step.

تحديد تسلسل الجينات التنظيمية استخدام تسلسل الجيل المقبل من تكيف كروموسوم دائرية الفائق التقاط (ج 4-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

تحليل ديناميكيات الحمض النووي الريبوزي الناقل (tRNA) باستخدام AQRNA-seq

AQRNA-seq for Quantifying Small RNAs

AQRNA-seq provides a direct linear relationship between sequencing read counts and small RNA copy numbers in a biological sample, thus enabling accurate quantification of the pool of small RNAs. The AQRNA-seq library preparation procedure described here involves the use of custom-designed sequencing linkers and a step for reducing methylation RNA modifications that block reverse transcription processivity, which results in an increased yield of full-length cDNAs. In addition, a detailed implementation of the accompanying bioinformatics pipeline is presented. This demonstration of AQRNA-seq was conducted through a quantitative analysis of the 45 tRNAs in Mycobacterium bovis BCG harvested on 5 selected days across a 20-day time course of nutrient deprivation and 6 days of resuscitation. Ongoing efforts to improve the efficiency and rigor of AQRNA-seq will also be discussed here. This includes exploring methods to obviate gel purification for mitigating primer dimer issues after PCR amplification and to increase the proportion of full-length reads to enable more accurate read mapping. Future enhancements to AQRNA-seq will be focused on facilitating automation and high-throughput implementation of this technology for quantifying all small RNA species in cell and tissue samples from diverse organisms.

تسليط الضوء على المؤلف: دور AQRNA-seq في رسم خرائط الحمض النووي الريبي الصغير وكشف آليات ترجمة البروتين

Absolute quantification RNA sequencing (AQRNA-seq) is a technology developed to quantify the landscape of all small RNAs in biological mixtures. Here, both the library preparation and data processing steps of AQRNA-seq are demonstrated, quantifying changes in the transfer RNA (tRNA) pool in Mycobacterium bovis BCG during starvation-induced dormancy.

AQRNA-seq لقياس كمية الحمض النووي الريبي الصغير

AQRNA-seq provides a direct linear relationship between sequencing read counts and small RNA copy numbers in a biological sample, thus enabling accurate ...

<meta charset="utf8"></head><body>اكتشاف أحداث الانقسام CRISPR-Cas9 خارج الهدف باستخدام CIRCLE-Seq

CIRCLE-Seq for Interrogation of Off-Target Gene Editing

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of unintended cleavage sites of CRISPR-Cas9 through targeted sequencing of CRISPR-Cas9 cleaved DNA. The protocol involves circularizing genomic DNA (gDNA), which is subsequently treated with the Cas9 protein and a guide RNA (gRNA) of interest. Following treatment, the cleaved DNA is purified and prepared as a library for Illumina sequencing. The sequencing process generates paired-end reads, offering comprehensive data on each cleavage site. CIRCLE-seq provides several advantages over other in vitro methods, including minimal sequencing depth requirements, low background, and high enrichment for Cas9-cleaved gDNA. These advantages enhance sensitivity in identifying both intended and unintended cleavage events. This study provides a comprehensive, step-by-step procedure for examining the off-target activity of CRISPR-Cas9 using CIRCLE-seq. As an example, this protocol is validated by mapping genome-wide unintended cleavage sites of CRISPR-Cas9 during the modification of the AAVS1 locus. The entire CIRCLE-seq process can be completed in two weeks, allowing sufficient time for cell growth, DNA purification, library preparation, and Illumina sequencing. The input of sequencing data into the CIRCLE-seq pipeline facilitates streamlined interpretation and analysis of cleavage sites.

<meta charset="utf8"></head><body>CIRCLE-seq للاستجواب في تحرير الجينات غير المستهدف

A significant barrier to technologies like CRISPR is the off-target events that can disrupt vital genes. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is a technique designed to identify unintended cleavage sites. This method maps the genome-wide activity of CRISPR-Cas9 with high sensitivity and without bias.

CIRCLE-seq للاستجواب في تحرير الجينات غير المستهدف

Circularization for In Vitro Reporting of Cleavage Effects by Sequencing (CIRCLE-seq) is a novel technique developed for the impartial identification of ...

RIBO-seq in Bacteria: a Sample Collection and Library Preparation Protocol for NGS Sequencing

The ribosome profiling technique (RIBO-seq) is currently the most effective tool for studying the process of protein synthesis in vivo. The advantage of this method, in comparison to other approaches, is its ability to monitor translation by precisely mapping the position and number of ribosomes on a mRNA transcript.
In this article, we describe the consecutive stages of sample collection and preparation for RIBO-seq method in bacteria, highlighting the details relevant to the planning and execution of the experiment.
Since the RIBO-seq relies on intact ribosomes and related mRNAs, the key step is rapid inhibition of translation and adequate disintegration of cells. Thus, we suggest filtration and flash-freezing in liquid nitrogen for cell harvesting with an optional pretreatment with chloramphenicol to arrest translation in bacteria. For the disintegration, we propose grinding frozen cells with mortar and pestle in the presence of aluminum oxide to mechanically disrupt the cell wall. In this protocol, sucrose cushion or a sucrose gradient ultracentrifugation for monosome purification is not required. Instead, mRNA separation using polyacrylamide gel electrophoresis (PAGE) followed by the ribosomal footprint excision (28-30 nt band) is applied and provides satisfactory results. This largely simplifies the method as well as reduces the time and equipment requirements for the procedure. For library preparation, we recommend using the commercially available small RNA kit for Illumina sequencing from New England Biolabs, following manufacturer&#39;s guidelines with some degree of optimization.
The resulting cDNA libraries present appropriate quantity and quality required for next generation sequencing (NGS). Sequencing of the libraries prepared according to the described protocol results in 2 to 10 mln uniquely mapped reads per sample providing sufficient data for comprehensive bioinformatic analysis. The protocol we present is quick and relatively easy and can be performed with standard laboratory equipment.

Here we describe the stages of sample collection and preparation for RIBO-seq in bacteria. Sequencing of the libraries prepared according to these guidelines results in sufficient data for comprehensive bioinformatic analysis. The protocol we present is simple, uses standard laboratory equipment and takes seven days from lysis to obtaining libraries.

RIBO-seq في البكتيريا: مجموعة عينة وبروتوكول إعداد المكتبة لتسلسل NGS

The ribosome profiling technique (RIBO-seq) is currently the most effective tool for studying the process of protein synthesis in vivo. The advantage of ...

Biochemistry

Gel-seq: A Method for Simultaneous Sequencing Library Preparation of DNA and RNA Using Hydrogel Matrices

The ability to amplify and sequence either DNA or RNA from small starting samples has only been achieved in the last five years. Unfortunately, the standard protocols for generating genomic or transcriptomic libraries are incompatible and researchers must choose whether to sequence DNA or RNA for a particular sample. Gel-seq solves this problem by enabling researchers to simultaneously prepare libraries for both DNA and RNA starting with 100 - 1000 cells using a simple hydrogel device. This paper presents a detailed approach for the fabrication of the device as well as the biological protocol to generate paired libraries. We designed Gel-seq so that it could be easily implemented by other researchers; many genetics labs already have the necessary equipment to reproduce the Gel-seq device fabrication. Our protocol employs commonly-used kits for both whole-transcript amplification (WTA) and library preparation, which are also likely to be familiar to researchers already versed in generating genomic and transcriptomic libraries. Our approach allows researchers to bring to bear the power of both DNA and RNA sequencing on a single sample without splitting and with negligible added cost.

Gel-seq enables researchers to simultaneously prepare libraries for both DNA- and RNA-seq at negligible added cost starting from 100 - 1000 cells using a simple hydrogel device. This paper presents a detailed approach for the fabrication of the device as well as the biological protocol to generate paired libraries.

هلام-seq: طريقة لإعداد مكتبة تسلسل واحد من الحمض النووي والجيش الملكي النيبالي باستخدام مصفوفات المائية

The ability to amplify and sequence either DNA or RNA from small starting samples has only been achieved in the last five years. Unfortunately, the ...

3 ' نهاية تسلسل إعداد مكتبة مع A-seq2

Summary

Explore More Videos

Chapters in this video

المراقبة على نطاق الجينوم من أخطاء النسخ في الكائنات الحية حقيقية النواة

تحديد تسلسل الجينات التنظيمية استخدام تسلسل الجيل المقبل من تكيف كروموسوم دائرية الفائق التقاط (ج 4-seq)

AQRNA-seq لقياس كمية الحمض النووي الريبي الصغير

AQRNA-seq لقياس كمية الحمض النووي الريبي الصغير

AQRNA-seq لقياس كمية الحمض النووي الريبي الصغير

CIRCLE-seq للاستجواب في تحرير الجينات غير المستهدف

CIRCLE-seq للاستجواب في تحرير الجينات غير المستهدف

CIRCLE-seq للاستجواب في تحرير الجينات غير المستهدف

RIBO-seq في البكتيريا: مجموعة عينة وبروتوكول إعداد المكتبة لتسلسل NGS

هلام-seq: طريقة لإعداد مكتبة تسلسل واحد من الحمض النووي والجيش الملكي النيبالي باستخدام مصفوفات المائية