This work was supported by funds to S.S. from the National Institutes of Health (R21CA170786 and R01GM127464) and the American Cancer Society (the Institutional Research Grant 74-001-34-IRG) and to S.S. and W.M. from the Valley Research Partnership Program (P1-4009 and VRP77). The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

1. Reagents and buffers
NOTE: All sterilization using vacuum filters should be performed with 0.2 &#181;m polyethersulfone (PES) membrane in a biosafety cabinet.
<ol>
	<li>Prepare RNase-free water by adding 1.0 mL of diethylpyrocarbonate (DEPC) to 1.0 L of deionized water, mix for at least 1 hr at room temperature (RT), autoclave twice, and then cool to RT before use.</li>
	<li>Prepare Dulbecco&#39;s Modified Eagle Medium (DMEM) by mixing one packet of DMEM powder (13.4 g), 3.7 g of sodium bicarbonate, 100 mL of fetal bovine serum (FBS), penicillin, and streptomycin to ~800 mL of sterile deionized water. The final concentration of penicillin and streptomycin in DMEM should be 50 U/mL and 50 &#181;g/mL, respectively. Adjust the pH to 7.4 and then make up the volume to 1.0 L with sterile deionized water. Sterilize by filtration and store at 4 &#176;C.</li>
	<li>Prepare 10x phosphate buffered saline (10x PBS) by adding 25.6 g of disodium hydrogen heptahydrate (Na2HPO4&#183;7H2O), 2 g of potassium dihydrogen phosphate (KH2PO4), 2 g of potassium chloride (KCl), and 80 g of sodium chloride (NaCl) to 800 mL of deionized water. Mix to dissolve and make up the volume to 1.0 L. Sterilize by filtration and store at 4 &#176;C.</li>
	<li>Prepare 0.5 M ethylene diamine tetra-acetic acid (EDTA) by dissolving 186.1 g of Na2&#8226;EDTA&#8226;2H2O into ~800 mL of deionized water. Adjust pH to 8.0 and then make up the volume to 1.0 L with sterile deionized water. Sterilize by filtration and store at 4 &#176;C.</li>
	<li>Prepare 1x trypsin-EDTA solution by mixing 100 mL of 10x trypsin (2.5%), 2 mL of 0.5 M EDTA, and add 1x PBS up to 1.0 L. Sterilize by filtration and aliquot into 50 mL conical tubes. Store at 4 &#176;C for 1-2 weeks or freeze at -20 &#176;C for long-term&#160;use.</li>
	<li>Prepare 2x formamide DNA/RNA loading dye by mixing 14.4 mL of formamide and 0.6 mL of 0.5 M EDTA for a final volume of 15 mL. Add bromophenol blue and xylene cyanol powder to a final concentration of 0.02% and store at 4 &#176;C. 
	NOTE: Formamide is toxic and corrosive. Read the material safety data sheets for additional safety recommendations.</li>
	<li>Prepare 5x Tris/Borate/EDTA (5x TBE) buffer by mixing 54.0 g of tris base, 27.5 g of boric acid, and 20 mL of 0.5 M EDTA into ~800 mL of deionized water. Mix to dissolve and make up the volume to 1.0 L with deionized water.</li>
	<li>Prepare urea-polyacrylamide gel electrophoresis (urea-PAGE) solution by mixing 200 mL of 5x TBE, 250 mL of 40% 19:1 bis/acrylamide, and 450.5 g of urea. Then add deionized water up to 1.0 L. Mix until the ingredients are completely dissolved, then sterilize by filtration, and store at 4 &#176;C in an amber glass bottle. 
	NOTE: Bis/acrylamide is toxic. Read the material safety data sheets for additional safety procedures.</li>
	<li>Prepare 10% ammonium persulfate (APS) by dissolving 1 g of APS in 10 mL of deionized water and store at 4 &#176;C.</li>
</ol>
2. Cotransfection of HeLa cells with the reporter and U1 snRNA plasmids
NOTE: The transfection of Hela cells must be performed under sterile conditions in a biological safety cabinet. The outer surface of all materials must be sprayed with 70% ethanol before being introduced into the biological safety cabinet.
<ol>
	<li>Maintain Hela cells in DMEM in a 37 &#176;C incubator with 5% CO2 by passaging every 2-3 days when the cells are about 80-90% confluent.</li>
	<li>For passaging HeLa cells, aspirate the spent medium and then incubate cells with 3 mL of 0.25% trypsin containing 1 mM EDTA at 37 &#176;C for 3 min.</li>
	<li>After incubation, add 7 mL of fresh DMEM. Transfer the cell suspension to a 10 mL tube, centrifuge at 1,000 x g for 5 min.</li>
	<li>Resuspend the cell pellet in 10 mL of fresh DMEM, and then plate the cells on a new tissue culture dish at 20% confluence.</li>
	<li>For transient transfections, count Hela cells with a clean hemocytometer slide and prepare a suspension with a density of 2.5 x 105 cells/mL.</li>
	<li>Seed 1.0 mL of 2.5 x 105 cells/mL Hela cell suspension into each well of a 12-well plate and incubate overnight at 37 &#176;C.</li>
	<li>The next day, aspirate the spent medium and add 0.8 mL of fresh DMEM with serum.</li>
	<li>Prepare Solution I by adding 0.2 &#181;g of Dup51 or Dup51p reporter plasmid, 1.8 &#181;g of pcDNA, pNS6U1, or pNS6U1-5a plasmid, and 100 &#181;L of transfection medium into a new 1.5 mL microcentrifuge tube.</li>
	<li>Prepare a master mix of Solution II for all samples to be transfected by adding 100 &#181;L of transfection medium and 4.0 &#181;L of transfection reagent per sample.</li>
	<li>Prepare the transfection mix by adding 100 &#181;L of Solution II into each microcentrifuge tube containing Solution I.</li>
	<li>Vortex the transfection mixes for 15 s, centrifuge in a tabletop microcentrifuge at 3,000 x g for 10 s at RT, and then incubate at RT for 5 min.</li>
	<li>Add all 200 &#181;L of the transfection mix into one well of the 12-well HeLa cell plate to achieve a final volume of 1.0 mL per well and incubate the plate at 37 &#176;C for 48 hrs.</li>
	<li>After incubation, extract RNA from the transfected HeLa cells with commercially available guanidine thiocyanate and phenol solution. 
	NOTE: This reagent contains phenol&#160;and&#160;this step should be performed in a fume hood. The use of DEPC treated water is recommended for resuspension of extracted RNA.
	<ol>
		<li>Aspirate the spent medium and add 500 &#181;L of the reagent into each well. Incubate at RT for 5 min.</li>
		<li>Homogenize by pipetting up and down. Then transfer the solution to a new 1.5 mL microcentrifuge tube.</li>
		<li>Add 100 &#181;L of chloroform and vortex for 15 s.</li>
		<li>Centrifuge at 12,000 x g for 15 min at RT.</li>
		<li>Transfer 200 &#181;L of the RNA containing, top aqueous layer to a new 1.5 mL microcentrifuge tube.</li>
		<li>Add 2 &#181;g of glycogen and 200 &#181;L of isopropanol to each RNA sample. Mix by inverting the tubes.</li>
		<li>Collect the RNA precipitate by centrifugation at 12,000 x g for 10 min at 4 &#176;C.</li>
		<li>Remove and discard the supernatant without disturbing the RNA pellet.</li>
		<li>Wash the pellet twice by adding 1.0 mL of 70% ethanol, inverting the tubes, and centrifuging as described in Step 2.13.7.</li>
		<li>Air dry the pellet for ~10-20 min at RT and resuspend the RNA in 10-20 &#181;L of RNase-free water.</li>
		<li>Determine RNA concentration by measuring absorbance at 260 nm as described by Desjardins and Conklin9.</li>
	</ol>
	</li>
	<li>Proceed with primer extension or store RNA samples in -20 &#176;C. Isolated RNA can be stored at -20 &#176;C for 6-12 months.</li>
</ol>
3. 32P-labeling of oligonucleotides
NOTE: Steps involving the use of 32P-ATP and 32P-labeled oligonucleotides must be performed behind an acrylic shield by trained individuals with approval from authorized institutional entities. The protocol described below can be used for labeling of oligonucleotides, Dup3r and U17-26-R, and markers for urea-PAGE. Use of DEPC treated water is recommended for resuspension of oligonucleotides and size exclusion beads.
<ol>
	<li>To a 1.5 mL microcentrifuge tube, add oligonucleotide, T4 polynucleotide kinase (T4 PNK), T4 PNK buffer, and 32P-ATP as described in Table 1. Add 32P-ATP last to the mixture; this is important. 
	NOTE: For the addition of radioactive solutions, use of filter tips is recommended.</li>
	<li>Incubate in a water bath at 37 &#176;C for 30 min.</li>
	<li>While the labeling reactions are incubating, resuspend the size exclusion beads with a 25 kDa molecular weight cut off by gently vortexing for ~10 s. 
	NOTE: The size exclusion beads should be prepared according to the manufacturer&#39;s instructions and stored as a 50% suspension in 25% ethanol at 4 &#176;C.</li>
	<li>Prepare columns by transferring 600 &#956;L of the resuspended beads to a disposable mini column placed in a 1.5 mL collection tube and returning the bead&#160;stock to 4 &#176;C.</li>
	<li>Centrifuge at 2,000 x g for 1 min at RT and discard the flow through.</li>
	<li>Wash the beads by adding 300 &#181;L of RNase-free water to the column.</li>
	<li>Repeat steps 3.5. and 3.6. twice and transfer the mini-column to a new 1.5 mL centrifuge tube.</li>
	<li>Add the kinase reaction mix to the size-exclusion bead column and centrifuge at 5000 x g for 1 min at RT.</li>
	<li>Collect and save the flow through, which has the 32P-labeled oligonucleotide, and discard all tips and tubes into an acrylic waste box.</li>
	<li>Add 20 &#181;L of RNase-free water to dilute 32P-labeled oligonucleotide to a final concentration of 2.5 &#181;M. 
	NOTE: Dilute the labeled markers as needed for loading on urea-PAGE gels.</li>
	<li>Store the labeled oligonucleotide in an acrylic microtube box at -20 &#176;C or proceed with primer extension analysis.</li>
</ol>
4. Analysis of the spliced reporter transcripts by primer extension
NOTE: It is recommended to clean surfaces and equipment with an RNase inactivating reagent before use.
<ol>
	<li>Add 2.0 &#181;g of RNA extracted from the Hela cells into separate 200 &#956;L microcentrifuge tubes and add RNase-free water to make up the volume to 6.55 &#181;L.</li>
	<li>Prepare Master Mix I with the diluted 32P-Dup3r and dNTPs as shown in Table 2 and add 0.9 &#181;L of the mix to each PCR tube containing RNA samples.</li>
	<li>Incubate the tubes, first at 65 &#176;C for 5 min and then on ice for 1 min.</li>
	<li>Prepare Master Mix II with 5x First Strand Buffer, dithiothreitol (DTT), RNase inhibitor, and reverse transcriptase as shown in Table 2.</li>
	<li>Add 2.55 &#181;L of the mix to each tube containing RNA and Master Mix 1; the total volume of the reaction should be 10 &#181;L. Keep the tubes at RT for 10 min.</li>
	<li>Transfer the tubes to a dry bath or a thermal cycler and incubate, first at 50 &#176;C for 60 min and then at 70 &#176;C for 15 min.</li>
	<li>After incubation, add 10 &#181;L of 2x formamide RNA loading dye to each sample and store in an acrylic box at -20 &#176;C or proceed with the separation of fragments by urea-PAGE using a 14-cm long gel and visualization of gel image as described below in Step 8.</li>
	<li>Perform densitometric scanning of the gel image with an image analysis software and use the band intensities of included and skipped products to calculate the percentage of exon 2 inclusion as shown below. 
	<img alt="Equation 1" src="/files/ftp_upload/63014/63014eq01v2.jpg" /></li>
</ol>
5. Analysis of the spliced reporter transcripts by fluorescent RT-PCR
NOTE: The RT-PCR analysis described below uses random hexamers for cDNA synthesis and a combination of unlabeled Dup8f and Cy5-labeled Dup3r oligonucleotides for PCR amplification of the spliced products.
<ol>
	<li>For cDNA synthesis, add 2.0 &#181;g of RNA extracted from the transfected Hela cells into separate 200 &#956;L microcentrifuge tubes and add RNase-free water to make up the volume to 11.0 &#181;L.</li>
	<li>Prepare Master Mix I, containing random hexamers and dNTP as shown in Table 3 and add 2.0 &#956;L of the mix to each sample. Incubate, first at 65 &#176;C for 5 min then on ice for 1 min.</li>
	<li>Prepare Master Mix II, containing First Strand Buffer, RNase inhibitor, DTT, and reverse transcriptase as shown in Table 3 and add 7.0 &#956;L of the mix to each tube containing RNA and Master Mix I.</li>
	<li>Keep the tubes at RT for 10 min, and then incubate at 50 &#176;C for 60 min and 70 &#176;C for 15 min. 
	NOTE: Completed cDNA reactions may be stored at -20 &#176;C.</li>
	<li>For PCR, transfer 1.0 &#956;L (100 ng/&#956;L) of each cDNA sample to new PCR tubes.</li>
	<li>Prepare a master mix consisting of Dup8f, Cy5-Dup3r, dNTPs, Taq buffer, Taq polymerase, and water as described in Table 4 and add 11.5 &#956;L of the mix to each tube containing cDNA.</li>
	<li>Perform PCR using a thermal cycler with an initial denaturation step at 94 &#176;C for 3 min; followed by 20 cycles of denaturation (94 &#176;C for 30 s), annealing (65 &#176;C for 30 s), and extension (72 &#176;C for 15 s), and a termination step at 72 &#176;C for 5 min.</li>
	<li>Add 12.5 &#181;L of 2x formamide DNA loading dye to each tube and heat at 95 &#176;C for 5 min.</li>
	<li>Store the PCR reaction at -20 &#176;C or proceed with urea-PAGE as described below in Step 8.1-8.4.</li>
	<li>After electrophoresis, remove the glass plates from the electrophoresis apparatus and scan using a fluorescence imager to visualize the gel.</li>
	<li>Perform densitometric scanning of the gel image and use band intensity of the included and the skipped products to calculate percentage of exon 2 inclusion as described in Step 4.8.</li>
</ol>
6. Analysis of variant U1 snRNA expression by primer extension
<ol>
	<li>Add 2.0 &#181;g of RNA extracted from the Hela cells into separate 200 &#956;L microcentrifuge tubes and add RNase-free water to make up the volume to 4.325&#160;&#181;L and then add dATP, as shown in Table 5.</li>
	<li>Add 10,000 CPM of the 32P-U17-26-R oligonucleotide to each tube. 
	NOTE: To prepare a 10,000 cpm/&#956;L solution of 32P-U17-26-R (from Step 3), dilute the labeled oligonucleotide (1:20 dilution), determine cpm in 1.0 &#956;L using a scintillation counter, and further dilute with deionized water to prepare a solution of 10,000 cpm/&#956;L in a new 1.5 mL microcentrifuge tube.</li>
	<li>Incubate at 65 &#176;C for 5 min, and then on ice for 1 min.</li>
	<li>Prepare a master mix with 5x First Strand Buffer, RNase inhibitor, DTT, and reverse transcriptase as shown in Table 5 and add 1.8 &#181;L of the mix to each sample.</li>
	<li>Incubate, first at RT for 10 min and then at 42 &#176;C for 10 min.</li>
	<li>After incubation, add 10 &#181;L of 2x formamide RNA loading dye into each sample and store in an acrylic box at -20 &#176;C or proceed with separation of fragments by urea-PAGE using a 38-cm long gel (see Step 8).</li>
</ol>
7. Analysis of variant U1 snRNA expression by RT-qPCR
<ol>
	<li>Dilute the cDNA stock prepared as described above in Steps 5.1 - 5.4 to a concentration of 0.2 ng/&#181;L.</li>
	<li>Pipette 5.0 &#181;L of diluted cDNA into individual wells of a 96-well qPCR plate in triplicate. Add deionized water instead of cDNA for no-template control (NTC).</li>
	<li>Prepare two separate primer mixes consisting of the forward and reverse primers for U1 and U2 snRNAs, and water as shown in Table 6. 
	NOTE: Sequences for U1 and U2 snRNA specific primers are provided in Table 7.</li>
	<li>Add 5.0 &#181;L of the U1 and U2 snRNA primer mix to the sample and NTC wells.</li>
	<li>Add 10.0 &#181;L of real-time PCR mix to each well.</li>
	<li>Seal the plates with an optical film, then centrifuge at 1,000 x g for 2 min at RT to collect the reactions to the bottom of the wells.</li>
	<li>Perform qPCR with an initial denaturation step at 95 &#176;C for 10 min, followed by 40 cycles of a 2-step protocol consisting of denaturation (95 &#176;C for 15 s) and annealing/extension (62 &#176;C for 60 s) while collecting the threshold quantification cycle (Cq) values of target amplicons.</li>
	<li>Finish the qPCR reaction by checking for a single peak in the dissociation curve for U1 and U2 snRNA reactions.</li>
	<li>From the Cq&#160;values, calculate delta Cq (&#916;Cq) for U1 and U2 snRNAs as compared to the pcDNA control.</li>
	<li>Determine variant U1 snRNA expression as relative quantity (RQ) of U1 as compared to U2 using the &#916;&#916;Cq value as shown below for all samples. 
	<img alt="Equation 2" src="/files/ftp_upload/63014/63014eq02.jpg" /> 
	<img alt="Equation 3" src="/files/ftp_upload/63014/63014eq03.jpg" /> 
	<img alt="Equation 4" src="/files/ftp_upload/63014/63014eq04.jpg" /></li>
</ol>
8. Setup and running of Urea-PAGE gels
NOTE: Assembly of glass plates and the gel running apparatus should be performed according to manufacturer&#39;s instructions. The casting of the 10% urea-PAGE gel can be performed according to a previously described protocol by Summer et al.10. Steps involving the preparation of markers and samples, and of running and visualization of gels are described below. Optionally, to prevent the gel from sticking to glass plates, the inner surface may be coated with silicone solution by adding 1 mL of the solution onto the surface and evenly spreading over the entire surface with tissue. Once dry, the plates should be washed with deionized water and dried again.
CAUTION: Unpolymerized acrylamide is neurotoxic and must be handled with protections recommended in the material safety data sheet.
<ol>
	<li>Prepare the primer extension samples and markers by heating at 95 &#176;C for 5 min and then centrifuging in a tabletop microcentrifuge at 3,000 x g for 5 s at RT.</li>
	<li>Prior to loading the markers and samples, flush out the wells with 1x TBE buffer to remove the settled urea.</li>
	<li>Load 10 &#956;L/sample/well and run the gel at 300-500V for 2-3 hrs or until the xylene cyanol reaches the bottom. 
	NOTE: About 1,000 cpm of the 32P-labeled marker can be loaded.</li>
	<li>After electrophoresis, remove the glass plates from the electrophoresis apparatus.</li>
	<li>Carefully separate the two plates so that the gel lays flat on either glass surface and transfer the gel onto a filter paper and cover it with plastic wrap.</li>
	<li>Vacuum dry the gel on the filter paper at 80 &#176;C for 30 min using a gel dryer.</li>
	<li>Place the dried gel in a phosphor imaging cassette and keep at RT overnight. 
	NOTE: The phosphor screen should be erased using a light box prior to use.</li>
	<li>To visualize the gel image, remove the screen and scan using a phosphor imager.</li>
</ol>

<ol><li>Zhuang, Y., Weiner, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+compensatory+base+change+in+U1+snRNA+suppresses+a+5%27+splice+site+mutation%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">A compensatory base change in U1 snRNA suppresses a 5' splice site mutation.</a> Cell. 46 (6), 827-835 (1986).</li>
<li>Scotti, M. M., Swanson, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((RNA+mis-splicing+in+disease%5BTitle%5D)+AND+%22Nature+Review+Genetics%22%5BJournal%5D)">RNA mis-splicing in disease.</a> Nature Review Genetics. 17 (1), 19-32 (2016).</li>
<li>Ward, A. J., Cooper, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+pathobiology+of+splicing%5BTitle%5D)+AND+%22Journal+of+Pathology%22%5BJournal%5D)">The pathobiology of splicing.</a> Journal of Pathology. 220 (2), 152-163 (2010).</li>
<li>Scalet, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Disease-causing+variants+of+the+conserved+%2B2T+of+5%27+splice+sites+can+be+rescued+by+engineered+U1snRNAs%5BTitle%5D)+AND+%22Human+Mutatation%22%5BJournal%5D)">Disease-causing variants of the conserved +2T of 5' splice sites can be rescued by engineered U1snRNAs.</a> Human Mutatation. 40 (1), 48-52 (2019).</li>
<li>Yamazaki, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Use+of+modified+U1+small+nuclear+RNA+for+rescue+from+exon+7+skipping+caused+by+5%27-splice+site+mutation+of+human+cathepsin+A+gene%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">Use of modified U1 small nuclear RNA for rescue from exon 7 skipping caused by 5'-splice site mutation of human cathepsin A gene.</a> Gene. 677, 41-48 (2018).</li>
<li>Yanaizu, M., Sakai, K., Tosaki, Y., Kino, Y., Satoh, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Small+nuclear+RNA-mediated+modulation+of+splicing+reveals+a+therapeutic+strategy+for+a+TREM2+mutation+and+its+post-transcriptional+regulation%5BTitle%5D)+AND+%22Science+Reports%22%5BJournal%5D)">Small nuclear RNA-mediated modulation of splicing reveals a therapeutic strategy for a TREM2 mutation and its post-transcriptional regulation.</a> Science Reports. 8 (1), 6937(2018).</li>
<li>Balestra, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Splicing+mutations+impairing+CDKL5+expression+and+activity+can+be+efficiently+rescued+by+U1snRNA-based+therapy%5BTitle%5D)+AND+%22International+Journal+of+Molecular+Sciences%22%5BJournal%5D)">Splicing mutations impairing CDKL5 expression and activity can be efficiently rescued by U1snRNA-based therapy.</a> International Journal of Molecular Sciences. 20 (17), 20174130(2019).</li>
<li>Donadon, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exon-specific+U1+snRNAs+improve+ELP1+exon+20+definition+and+rescue+ELP1+protein+expression+in+a+familial+dysautonomia+mouse+model%5BTitle%5D)+AND+%22Human+Molecular+Genetics%22%5BJournal%5D)">Exon-specific U1 snRNAs improve ELP1 exon 20 definition and rescue ELP1 protein expression in a familial dysautonomia mouse model.</a> Human Molecular Genetics. 27 (14), 2466-2476 (2018).</li>
<li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((NanoDrop+microvolume+quantitation+of+nucleic+acids%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. (45), e2565(2010).</li>
<li>Summer, H., Gramer, R., Droge, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Denaturing+urea+polyacrylamide+gel+electrophoresis+%28Urea+PAGE%29%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Denaturing urea polyacrylamide gel electrophoresis (Urea PAGE).</a> Journal of Visualized Experiments. (32), e1485(2009).</li>
<li>Dominski, Z., Kole, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Selection+of+splice+sites+in+pre-mRNAs+with+short+internal+exons%5BTitle%5D)+AND+%22Molecular+Cell+Biology%22%5BJournal%5D)">Selection of splice sites in pre-mRNAs with short internal exons.</a> Molecular Cell Biology. 11 (12), 6075-6083 (1991).</li>
<li>Amir-Ahmady, B., Boutz, P. L., Markovtsov, V., Phillips, M. L., Black, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Exon+repression+by+polypyrimidine+tract+binding+protein%5BTitle%5D)+AND+%22RNA%22%5BJournal%5D)">Exon repression by polypyrimidine tract binding protein.</a> RNA. 11 (5), 699-716 (2005).</li>
<li>Le Guedard-Mereuze, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sequence+contexts+that+determine+the+pathogenicity+of+base+substitutions+at+position+%2B3+of+donor+splice-sites%5BTitle%5D)+AND+%22Human+Mutation%22%5BJournal%5D)">Sequence contexts that determine the pathogenicity of base substitutions at position +3 of donor splice-sites.</a> Human Mutation. 30 (9), 1329-1339 (2009).</li>
<li>Sharma, S., Wongpalee, S. P., Vashisht, A., Wohlschlegel, J. A., Black, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Stem-loop+4+of+U1+snRNA+is+essential+for+splicing+and+interacts+with+the+U2+snRNP-specific+SF3A1+protein+during+spliceosome+assembly%5BTitle%5D)+AND+%22Genes+and+Development%22%5BJournal%5D)">Stem-loop 4 of U1 snRNA is essential for splicing and interacts with the U2 snRNP-specific SF3A1 protein during spliceosome assembly.</a> Genes and Development. 28 (22), 2518-2531 (2014).</li>
<li>Steitz, J. A., et al. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSteitz%2C+JA+%22Functions+of+the+abundant+U-snRNPs.+Structure+and+function+of+major+and+minor+small+nuclear+ribonucleoprotein+particles%22">Functions of the abundant U-snRNPs. Structure and function of major and minor small nuclear ribonucleoprotein particles</a>. , Springer Berlin Heidelberg. Berlin, Heidelberg. 115-154 (1988).</li>
<li>Fortes, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Inhibiting+expression+of+specific+genes+in+mammalian+cells+with+5%27+end-mutated+U1+small+nuclear+RNAs+targeted+to+terminal+exons+of+pre-mRNA%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+U.S.A%22%5BJournal%5D)">Inhibiting expression of specific genes in mammalian cells with 5' end-mutated U1 small nuclear RNAs targeted to terminal exons of pre-mRNA.</a> Proceedings of the National Academy of Sciences U.S.A. 100 (14), 8264-8269 (2003).</li>
<li>Roca, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Widespread+recognition+of+5%27+splice+sites+by+noncanonical+base-pairing+to+U1+snRNA+involving+bulged+nucleotides%5BTitle%5D)+AND+%22Genes+and+Development%22%5BJournal%5D)">Widespread recognition of 5' splice sites by noncanonical base-pairing to U1 snRNA involving bulged nucleotides.</a> Genes and Development. 26 (10), 1098-1109 (2012).</li>
<li>Roca, X., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Recognition+of+atypical+5%27+splice+sites+by+shifted+base-pairing+to+U1+snRNA%5BTitle%5D)+AND+%22Nature+Structural+Molecular+Biology%22%5BJournal%5D)">Recognition of atypical 5' splice sites by shifted base-pairing to U1 snRNA.</a> Nature Structural Molecular Biology. 16 (2), 176-182 (2009).</li>
<li>Taladriz-Sender, A., Campbell, E., Burley, G. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Splice-switching+small+molecules%3A+A+new+therapeutic+approach+to+modulate+gene+expression%5BTitle%5D)+AND+%22Methods%22%5BJournal%5D)">Splice-switching small molecules: A new therapeutic approach to modulate gene expression.</a> Methods. 167, 134-142 (2019).</li>
<li>Hamid, F. M., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+mechanism+underlying+position-specific+regulation+of+alternative+splicing%5BTitle%5D)+AND+%22Nucleic+Acids+Research%22%5BJournal%5D)">A mechanism underlying position-specific regulation of alternative splicing.</a> Nucleic Acids Research. 45 (21), 12455-12468 (2017).</li>
<li>Martelly, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synergistic+roles+for+human+U1+snRNA+stem-loops+in+pre-mRNA+splicing%5BTitle%5D)+AND+%22RNA+Biology%22%5BJournal%5D)">Synergistic roles for human U1 snRNA stem-loops in pre-mRNA splicing.</a> RNA Biology. , 1-18 (2021).</li>
</ol>

The authors have nothing to disclose.

The assay can be adapted for splicing analysis in cell lines other than HeLa, however, factors affecting transfection efficiency, such as cell confluency and quantity of DNA may need to be optimized. The reporter to U1 construct ratio is another critical parameter that may need to be determined depending upon the expression levels observed in other cell types. The quality of extracted RNA is critical for splicing analysis; therefore, the use of RNase-free water and decontamination of surfaces with RNase inactivating agents is highly recommended.
Analysis of reporter transcripts by either primer extension or fluorescent RT-PCR yield similar results, hence either technique can be employed for monitoring changes in the inclusion of exon 2 in the mature transcript. The fluorescent PCR reaction must be stopped and quantified in the exponential phase of amplification, which is dependent on the initial RNA concentration. Thus, the number of amplification cycles may have to be determined for assays with different transfections conditions than those described here. The ease of use due to the non-radioactive nature is an advantage of the RT-PCR assay. Although primer extension with radioactively labeled primer requires extra safety precautions, it can detect signals from a low amount of RNA. The low throughput of primer extension and RT-PCR is a limitation of this assay.
The U1 snRNP complementation assay has been employed for multiple purposes. In addition to reversing the effects of 5&#180;-splice site mutations, U1 snRNAs carrying changes to the 5&#180;-region have been applied for gene silencing and for studying splicing mechanisms. Fortes et al. showed that targeting U1 snRNAs to terminal exons of endogenous transcripts can efficiently inhibit gene expression16. Roca et al. used the U1 complementation to study the noncanonical mechanisms of 5&#39;-splice site recognition and showed that the U1 snRNA can basepair to 5&#180;-splice sites in an alternate register where basepairing is shifted by one nucleotide and also in &#34;bulge registers&#34; where bulged nucleotides are present in either the pre-mRNA or the snRNA17,18. This reporter system can potentially be used to study the role of U1 snRNP in splicing modulation by small molecules and splicing regulatory proteins. By substituting exon 2 of Dup51p with a target exon, the assay can be applied for examining the mechanism of action of small molecules that are known to enhance or repress splicing of specific exons, as in the case of splice switching compounds19. By incorporating regulatory sequences for alternative splicing factors into the exons or introns, it should be possible to examine U1 dependence in splicing regulation. This concept was applied by Hamid et al. to demonstrate the involvement of the stem-loop 4 of the U1 snRNA in splicing regulation by the polypyrimidine tract binding protein 120. We have used this assay to study the functions of stem-loops 3 and 4 of the U1 snRNA. By incorporating mutations in the stem-loop of the suppressor U1-5a snRNA that activates a mutant 5&#39;-splice site in the Dup51p splicing reporter, we have identified their critical roles in the formation of cross intron contacts with the U2 snRNP specific protein SF3A1 in the early steps of spliceosome assembly14,21. Thus, the three-exon two-intron Dup51 reporter serves as an adaptive tool for monitoring splicing efficiency in studies on mechanisms underlying spliceosome assembly and splicing-associated disease.

Pre-mRNA splicing is an essential processing step that removes non-coding introns and precisely ligates coding exons to form mature mRNA. Recognition of consensus sequences at exon-intron junctions, referred to as 5&#8242;-splice site and 3&#8242;-splice site, by components of the splicing machinery initiates the splicing process. The U1 small nuclear ribonucleoprotein (snRNP) recognizes the 5&#8242;-splice site by base pairing of the U1 snRNA to the pre-mRNA1. Genetically inherited mutations that alter 5&#8242;-splice site sequences are associated with many diseases2,3. It is predicted that the loss of basepairing of U1 snRNA with the mutant 5&#8242;-splice sites&#160;causes aberrant splicing, which can compromise translation of the affected transcript. A potential therapeutic approach to correct the splicing defects involves suppression of mutations by modified U1 snRNA carrying compensatory nucleotide changes in its 5&#8242;-region that basepairs with the 5&#8242;-splice site. Such modified U1 snRNAs, also referred to as exon specific U1 snRNAs, have been found to be effective in reversing splicing defects, resulting in increased protein expression from the rescued mRNA4,5,6,7,8.
Here, we describe the U1 snRNP complementation assay, a reporter-based cellular splicing assay that allows assessment of the effect of 5&#8242;-ss mutations on splicing of an exon and can also be used for the development of modified U1 snRNAs to enable the rescue of exon inclusion. We also provide protocols for monitoring of the spliced reporter transcripts by primer extension and RT-PCR, and for determining the expression of modified U1 snRNAs by primer extension and RT-qPCR.

<table><tbody><tr><td>Reagent Grade Deionized Water</td><td>ThermoFisher Scientific</td><td>23-751628</td><td></td></tr><tr><td>Diethyl pyrocarbonate (DEPC)</td><td>Sigma-Aldrich</td><td>D5758-25ML</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM) powder packet</td><td>Gibco</td><td>12100-046</td><td></td></tr><tr><td>Sodium Bicarbonate</td><td>ThermoFisher Scientific</td><td>S233-500</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS), Australian Source, Heat Inactivated</td><td>Omega Scientific</td><td>FB-22</td><td></td></tr><tr><td>Penicillin-Streptomycin (P/S)</td><td>Sigma-Aldrich</td><td>P4458-100ML</td><td></td></tr><tr><td>Sodium Hydroxide, Standard Solution 1.0N</td><td>Sigma-Aldrich</td><td>S2567-16A</td><td></td></tr><tr><td>Hydrochloric Acid, Certified ACS Plus, 36.5 to 38.0%</td><td>ThermoFisher Scientific</td><td>A144-500</td><td></td></tr><tr><td>Disposable PES Bottle Top Filters</td><td>ThermoFisher Scientific</td><td>FB12566510</td><td></td></tr><tr><td>EDTA Disodium Salt Dihydrate</td><td>Amresco</td><td>0105-2.5KG</td><td></td></tr><tr><td>2.5% Trypsin (10x), no phenol red</td><td>ThermoFisher Scientific</td><td>15090046</td><td></td></tr><tr><td>Sodium Chloride</td><td>Fisher Bioreagent</td><td>BP358-212</td><td></td></tr><tr><td>Potassium Chloride</td><td>Fisher Bioreagent</td><td>BP366-1</td><td></td></tr><tr><td>Disodium Hydrogen Phosphate Heptahydrate</td><td>Fisher Bioreagent</td><td>BP332-1</td><td></td></tr><tr><td>Potassium Dihydrogen Phosphate</td><td>Fisher Bioreagent</td><td>BP362-1</td><td></td></tr><tr><td>Transfection medium - Opti-MEM&amp;trade; I Reduced Serum Medium, no phenol red</td><td>ThermoFisher Scientific</td><td>11058021</td><td></td></tr><tr><td>Transfection Reagent - Lipofectamine&amp;trade; 2000</td><td>ThermoFisher Scientific</td><td>13778150</td><td></td></tr><tr><td>TRIzol&amp;trade; Reagent</td><td>ThermoFisher Scientific</td><td>15596018</td><td></td></tr><tr><td>Chloroform (Approx. 0.75% Ethanol as Preservative/Molecular Biology)</td><td>ThermoFisher Scientific</td><td>BP1145-1</td><td></td></tr><tr><td>Ethanol, Absolute (200 Proof), Molecular Biology Grade, Fisher BioReagents</td><td>ThermoFisher Scientific</td><td>BP2818-4</td><td></td></tr><tr><td>Isopropanol, Molecular Biology Grade, Fisher BioReagents</td><td>ThermoFisher Scientific</td><td>BP2618-212</td><td></td></tr><tr><td>Glycogen (5 mg/ml)</td><td>ThermoFisher Scientific</td><td>AM9510</td><td></td></tr><tr><td>Direct-zol RNA Miniprep Kit</td><td>Zymo Research</td><td>R2052</td><td></td></tr><tr><td>ATP, [&amp;gamma;-32P]- 6000Ci/mmol 150mCi/ml Lead, 1 mCi</td><td>PerkinElmer</td><td>NEG035C001MC</td><td></td></tr><tr><td>T4 Polynucleotide Kinase</td><td>New England Biolabs</td><td>M0201L</td><td></td></tr><tr><td>Size exclusion beands - Sephadex&amp;reg; G-25</td><td>Sigma-Aldrich</td><td>G2580-10G</td><td></td></tr><tr><td>Size exclusion mini columns</td><td>USA Scientific</td><td>1415-0600</td><td></td></tr><tr><td>pBR322 DNA-MspI Digest</td><td>New England Biolabs</td><td>N3032S</td><td></td></tr><tr><td>Low Molecular Weight Marker, 10-100 nt</td><td>Affymetrix</td><td>76410 100 UL</td><td></td></tr><tr><td>Rnase inactivating reagents - RNaseZAP&amp;trade;</td><td>Sigma-Aldrich</td><td>R2020-250ML</td><td></td></tr><tr><td>dNTP Mix (10 mM ea)</td><td>ThermoFisher Scientific</td><td>18427013</td><td></td></tr><tr><td>RNaseOUT&amp;trade; Recombinant Ribonuclease Inhibitor</td><td>ThermoFisher Scientific</td><td>10777019</td><td></td></tr><tr><td>Reverse Transcriptase - M-MLV Reverse Transcriptase</td><td>ThermoFisher Scientific</td><td>28025013</td><td>used for primer extension</td></tr><tr><td>Taq DNA Polymerase</td><td>ThermoFisher Scientific</td><td>10342020</td><td></td></tr><tr><td>Random Hexamers (50 &amp;micro;M)</td><td>ThermoFisher Scientific</td><td>N8080127</td><td></td></tr><tr><td>Real time PCR mix - SYBR&amp;trade; Select Master Mix</td><td>ThermoFisher Scientific</td><td>4472903</td><td></td></tr><tr><td>SuperScript&amp;trade; III Reverse Transcriptase</td><td>ThermoFisher Scientific</td><td>18080093</td><td>used for cDNA preparation</td></tr><tr><td>Dithiothreitol (DTT)</td><td>ThermoFisher Scientific</td><td>18080093</td><td></td></tr><tr><td>5X First-Strand Buffer</td><td>ThermoFisher Scientific</td><td>18080093</td><td></td></tr><tr><td>Formamide (&amp;ge;99.5%)</td><td>ThermoFisher Scientific</td><td>BP228-100</td><td>Review Material Safety Data Sheets</td></tr><tr><td>Bromophenol Blue sodium salt</td><td>Sigma-Aldrich</td><td>114405-5G</td><td></td></tr><tr><td>Xylene Cyanol FF</td><td>Sigma-Aldrich</td><td>2650-17-1</td><td></td></tr><tr><td>Tris Base (White Crystals or Crystalline Powder/Molecular Biology)</td><td>ThermoFisher Scientific</td><td>BP152-5</td><td></td></tr><tr><td>Boric Acid (Crystalline/Electrophoresis)</td><td>ThermoFisher Scientific</td><td>BP168-500</td><td></td></tr><tr><td>Acrylamide: Bis-Acrylamide 19:1 (40% Solution/Electrophoresis)</td><td>ThermoFisher Scientific</td><td>BP1406-1</td><td>Review Material Safety Data Sheets</td></tr><tr><td>Urea (Colorless-to-White Crystals or Crystalline Powder/Mol. Biol.)</td><td>ThermoFisher Scientific</td><td>BP169-212</td><td></td></tr><tr><td>Ammonium peroxodisulphate (APS) &amp;ge;98%, Pro-Pure, Proteomics Grade</td><td>VWR</td><td>M133-25G</td><td></td></tr><tr><td>Sigmacote</td><td>Sigma-Aldrich</td><td>SL2-100ML</td><td></td></tr><tr><td>N,N,N&#039;,N&#039;-Tetramethylethylenediamine (TEMED) &amp;ge;99%, Ultrapure</td><td>VWR</td><td>0761-25ML</td><td>Review Material Safety Data Sheets</td></tr><tr><td>Adjustable Slab Gel Systems, Expedeon</td><td>VWR</td><td>ASG-400</td><td></td></tr><tr><td>Vertical Gel Wrap&amp;trade; Glass Plate Sets, 16.5 x 14.5cm</td><td>VWR</td><td>NGP-125NR</td><td></td></tr><tr><td>Vertical Gel Wrap&amp;trade; Glass Plate Sets, 16.5 x 22.0cm</td><td>VWR</td><td>NGP-200NR</td><td></td></tr><tr><td>Vertical Gel Wrap&amp;trade; Glass Plate Sets, 16.5 x 38.7cm</td><td>VWR</td><td>NGP-400NR</td><td></td></tr><tr><td>GE Storage Phosphor Screens</td><td>Sigma-Aldrich</td><td>GE28-9564</td><td></td></tr><tr><td>Typhoon&amp;trade; FLA 7000 Biomolecular Imager</td><td>GE Healthcare</td><td>28-9610-73 AB</td><td></td></tr><tr><td>Beckman Coulter LS6500 Liquid Scintillation Counter</td><td>GMI</td><td>8043-30-1194</td><td></td></tr><tr><td>C1000 Touch Thermal Cycler</td><td>ThermoFisher Scientific</td><td></td><td></td></tr><tr><td>QuantStudio 6 Flex Real-Time PCR Systems</td><td>ThermoFisher Scientific</td><td></td><td></td></tr></tbody></table>

a reporter based cellular assay for monitoring splicing efficiency

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes to join exons and remove introns prior to cytoplasmic export of the mature mRNA. Splicing efficiency can be altered by the presence of mutations at splice sites, the influence of trans-acting splicing factors, or the activity of therapeutics. Here, we describe the protocol for a cellular assay that can be applied for monitoring the splicing efficiency of any given exon. The assay uses an adaptable plasmid encoded 3-exon/2-intron minigene reporter, which can be expressed in mammalian cells by transient transfection. Post-transfection, total cellular RNA is isolated, and the efficiency of exon splicing in the reporter mRNA is determined by either primer extension or semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We describe how the impact of disease associated 5&#8242; splice-site mutations can be determined by introducing them in the reporter; and how the suppression of these mutations can be achieved by co-transfection with U1 small nuclear RNA (snRNA) construct carrying compensatory mutations in its 5&#8242; region that basepairs with the 5&#8242;-splice sites at exon-intron junctions in pre-mRNAs. Thus, the reporter can be used for the design of therapeutic U1 particles to improve recognition of mutant 5&#8242; splice-sites. Insertion of cis-acting&#160;regulatory sites, such as splicing enhancer or silencer sequences, into the reporter can also be used to examine the role of U1 snRNP in regulation mediated by a specific alternative splicing factor. Finally, reporter expressing cells can be incubated with small molecules to determine the effect of potential therapeutics on constitutive pre-mRNA splicing or on exons carrying mutant 5&#8242; splice sites. Overall, the reporter assay can be applied to monitor splicing efficiency in a variety of conditions to study fundamental splicing mechanisms and splicing-associated diseases.

The splicing reporter Dup51, a three exon-two intron minigene, was derived from the human &#946;-globin gene and has been described previously (Figure 1A)11,12 . We created a mutant reporter, Dup51p, by introducing Usher syndrome associated 5&#180;-splice site mutations that occur in exon 3 of the protocadherin 15 (PCDH15) gene13. The 5&#180;-splice site sequence at the exon 2-intron 2 junction was changed from CAG/GUUGGUAUC to AUG/GUGUGUAUC (/ is the exon-intron boundary) (Figure 1B)14. These sequence changes alter the predicted pattern of 5&#180;-splice site basepairing with the endogenous U1 snRNA and also result in skipping of exon 2 in the mature transcript (Figure 2). The effect of these mutations could be suppressed by a compensatory change in the 5&#180;-region of the U1 snRNA. Substitution of the uracil with adenine at the 5th position of the U1 snRNA (U1-5a) reversed the effect of 5&#180;-splice site mutations in Dup51p (Figure 1B).
The splicing of the Dup51 and Dup51p transcripts can be monitored by primer extension using 32P-Dup3r or by semi quantitative RT-PCR using Dup8f and Dup3r oligonucleotides (Figure 1); sequences are provided in Table 7. When expressed in HeLa cells, the Dup51 minigene expresses the mature full-length transcript in which exon 2 is spliced-in efficiently (Figure 2A,B, lane 1). The 5&#180;-splice site mutations in Dup51p reduce exon 2 inclusion from ~95% to ~30%, leading to the formation of the shorter transcript (lane 5). Coexpression of Dup51p with U1-5a snRNA rescues exon 2 splicing and restores formation of full-length transcript (lane 8). Coexpression with wildtype U1 (U1-WT) or U1-5g variant does not have a similar effect on Dup51p splicing (lanes 6 and 7). U1-WT, U1-5g, or U1-5a coexpression also does not alter the splicing pattern of the Dup51 reporter (lanes 2-4). Overall, these results indicate that the rescue of exon 2 splicing in Dup51p transcripts is specifically due to the U&#62;A mutation in the U1-5a snRNA.
To monitor the expression of transfected U1 snRNAs, primer extension or RT-qPCR can be applied. Detection of U1-5a variant transcripts by primer extension uses the U17-26 oligonucleotide, which is 20 nucleotides long and basepairs near the adenine at the 5th position of U1 snRNA (Figure 3A). In the presence of dATP alone, U17-26 allows incorporation of 2-3 nucleotides for the endogenous wildtype U1 snRNA yielding 22 or 23 nucleotides long product (Figure 3B, lanes 1, 2, 5, and 6). For the U1-5a and U1-5g variants, extension terminates after addition of a single adenosine producing a 21 nucleotides long product (lanes 3, 4, 7, and 8). Analysis by RT-qPCR allows estimation of fold increase in expression of the variant U1 over the endogenous wildtype snRNA. Here, U1 specific primer pairs are designed so that no overlap exists with the mutations introduced into the variant snRNAs (Figure 3A). After normalization to U2 snRNA expression, the transfected U1-WT, and the U1-5g and U1-5a variants were found to be expressed at 3-5 folds over the endogenous snRNA (Figure 3C). Endogenous U1 is estimated to be present at 106 copies per cell in HeLa cells15. Thus, the exogenous variant snRNAs are expressed at ~3-5 fold over the endogenous U1. The ability of the U1-5a snRNA to rescue exon 2 inclusion to ~95% demonstrates that levels of the exogenous variant snRNAs are sufficient for the splicing of the nascent reporter transcripts.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ingredients</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>PNK Buffer (10x)</td>
			<td>2.0 &#181;L</td>
		</tr>
		<tr>
			<td>T4 Polynucleotide Kinase (T4 PNK) (10,000 U/mL)</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Oligonucleotide* (10 &#181;M)</td>
			<td>10.0 &#181;L</td>
		</tr>
		<tr>
			<td>32P-ATP (10 mM)</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>H2O (DEPC treated)</td>
			<td>6.0&#160;&#956;L</td>
		</tr>
		<tr>
			<td colspan="2">*For labeling markers, 0.5 &#181;L of the pBR322 DNA-MspI Digest or the Low Molecular Weight Marker is used.</td>
		</tr>
	</tbody>
</table>
Table 1: 32P-labeling of oligonucleotides. Reaction for preparation of a 5&#8242;-32P-labeled primer using 32P-ATP.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ingredients - Master Mix I</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>RNA and H2O (DEPC treated)</td>
			<td>6.55 &#181;L</td>
		</tr>
		<tr>
			<td>32P-Dup3r (2.5 &#181;M)</td>
			<td>0.4 &#181;L</td>
		</tr>
		<tr>
			<td>dNTP (10 mM)</td>
			<td>0.5 &#181;L</td>
		</tr>
		<tr>
			<td>Ingredients &#8211; Master Mix II</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>First-Strand Buffer (5x)</td>
			<td>2.00 &#181;L</td>
		</tr>
		<tr>
			<td>RNase Inhibitor (40 U/&#181;L)</td>
			<td>0.25 &#181;L</td>
		</tr>
		<tr>
			<td>DTT (0.1 M)</td>
			<td>0.05 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse Transcriptase (RT) (200U/&#181;L)</td>
			<td>0.25 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 2: 32P-Dup3r primer extension. Reaction for the analysis of spliced reporter transcripts by primer extension.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ingredients - Master Mix I</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>RNA and ddH2O (DEPC treated)</td>
			<td>11.0 &#181;L</td>
		</tr>
		<tr>
			<td>Random Hexamer (50 ng/&#181;L)</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>dNTP (10 mM)</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Ingredients &#8211; Master Mix II</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>First-Strand Buffer (5x)</td>
			<td>4.0 &#181;L</td>
		</tr>
		<tr>
			<td>RNase Inhibitor (40 U/&#181;L)</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>DTT (0.1 M)</td>
			<td>1.0 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse Transcriptase (RT) (200U/&#181;L)</td>
			<td>1.0 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 3: cDNA Synthesis. Reaction for the synthesis of cDNA from total RNA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ingredients</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>cDNA Template (100 ng/&#181;L)</td>
			<td>1.00 &#181;L</td>
		</tr>
		<tr>
			<td>Forward Primer (Dup8f) (10 &#181;M)</td>
			<td>0.25 &#181;L</td>
		</tr>
		<tr>
			<td>Cy5 Reverse Primer (Cy5-Dup3r) (10 &#181;M)</td>
			<td>0.25 &#181;L</td>
		</tr>
		<tr>
			<td>dNTP (10 &#181;M)</td>
			<td>0.25 &#181;L</td>
		</tr>
		<tr>
			<td>Taq Buffer (10x)</td>
			<td>1.25 &#181;L</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase (5000 U/mL)</td>
			<td>0.25 &#181;L</td>
		</tr>
		<tr>
			<td>H2O (DEPC treated)</td>
			<td>9.25 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 4: Fluorescent RT-PCR. Reaction for the analysis of the spliced reporter transcripts by RT-PCR using Cy5-labeled primer.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ingredients</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>RNA and H2O (DEPC treated)</td>
			<td>4.325 &#181;L</td>
		</tr>
		<tr>
			<td>dATP (10 mM)</td>
			<td>0.375 &#181;L</td>
		</tr>
		<tr>
			<td>32P-U17-26-R oligo nucleotide*</td>
			<td>1.000 &#181;L</td>
		</tr>
		<tr>
			<td>Ingredients &#8211; Master Mix</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>First-Strand Buffer (5x)</td>
			<td>1.5 &#181;L</td>
		</tr>
		<tr>
			<td>RNase Inhibitor (40 U/&#181;L)</td>
			<td>0.1 &#181;L</td>
		</tr>
		<tr>
			<td>DTT (0.1 M)</td>
			<td>0.1 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse Transcriptase (RT) (200U/&#181;L)</td>
			<td>0.1 &#181;L</td>
		</tr>
		<tr>
			<td colspan="2">*10,000 CPM of the 32P-U17-26-R oligonucleotide should be added to the diluted RNA (Step 6.2.).</td>
		</tr>
	</tbody>
</table>
Table 5: 32P-U1-snRNA primer extension. Reaction for the analysis of variant U1 snRNA expression by primer extension.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ingredients</td>
			<td>Amount for One Reaction</td>
		</tr>
		<tr>
			<td>Real Time PCR Mix</td>
			<td>10.0 &#181;L</td>
		</tr>
		<tr>
			<td>cDNA (0.2 ng/&#181;L)</td>
			<td>5.0 &#181;L</td>
		</tr>
		<tr>
			<td>Forward Primer (10 &#181;M)</td>
			<td>0.2 &#181;L</td>
		</tr>
		<tr>
			<td>Reverse Primer (10 &#181;M)</td>
			<td>0.2 &#181;L</td>
		</tr>
		<tr>
			<td>H2O (DEPC treated)</td>
			<td>4.6 &#181;L</td>
		</tr>
	</tbody>
</table>
Table 6: Quantitative RT-qPCR. Reactions for quantitative analysis of variant U1 snRNA expression by RT-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Oligo Name</td>
			<td>Sequence (5&#8242; to 3&#8242;)</td>
			<td>Technique</td>
		</tr>
		<tr>
			<td>Dup8f</td>
			<td>GACACCATGCATGGTGCACC</td>
			<td>Fluorescent RT-PCR</td>
		</tr>
		<tr>
			<td>Cy5-Dup3r</td>
			<td>/5Cy5/AACAGCATCAGGAGTGGACAGATCCC</td>
			<td>Fluorescent RT-PCR</td>
		</tr>
		<tr>
			<td>Dup3r</td>
			<td>AACAGCATCAGGAGTGGACAGATCCC</td>
			<td>Primer Extension</td>
		</tr>
		<tr>
			<td>U17-26R</td>
			<td>TGGTATCTCCCCTGCCAGGT</td>
			<td>Primer Extension</td>
		</tr>
		<tr>
			<td>U1/17-39F</td>
			<td>GGAGATACCATGATCACGAAGG</td>
			<td>RT-qPCR</td>
		</tr>
		<tr>
			<td>U1/58-80R</td>
			<td>CATCCGGAGTGCAATGGATAAG</td>
			<td>RT-qPCR</td>
		</tr>
		<tr>
			<td>U2/8-19F</td>
			<td>CTCGGCCTTTTGGCTAAGATCA</td>
			<td>RT-qPCR</td>
		</tr>
		<tr>
			<td>U2/62-84R</td>
			<td>TCCTCGGATAGAGGACGTATCA</td>
			<td>RT-qPCR</td>
		</tr>
	</tbody>
</table>
Table 7: Sequence of oligonucleotides primers. List of primer names, sequences, and the technique the primers were used for.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63014/63014fig01.jpg" /> 
Figure 1: Dup51 and Dup51p Minigene Reporters. (A) Schematic representation of the three-exon/two-intron minigene reporters, Dup51 and Dup51p. Locations of the Dup8f and Dup3r in exons 1 and 3, respectively, are indicated. (B)&#160;Predicted basepairing of the wildtype U1 snRNA and the U1-5a variant with the 5&#39;-splice site sequences of Dup51 and Dup51p reporter transcripts. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63014/63014fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63014/63014fig02.jpg" /> 
Figure 2: Analysis of Spliced Reporter Transcripts. HeLa cells were cotransfected with the Dup51 or Dup51p minigene plasmids and pcDNA control or pNS6U1 plasmids for U1-WT, U1-5g, or U1-5a snRNAs. (A) Primer extension analysis with 32P-labeled Dup3r primer demonstrating the splicing of the Dup51&#160;and Dup51p minigene transcripts. The mRNA products are indicated to the left of the gel image. The percentage of the full-length product (&#177; s.d., n = 3) was calculated from band intensities of the two mRNA isoforms and is represented in the graphs below. (B) RT-PCR analysis with Dup8f and Cy5-Dup3r primers on cDNA prepared from total RNA extracted from HeLa cells demonstrating splicing of the Dup51 or Dup51p minigene transcripts. The mRNA products are indicated to the left of the gel image. The percentage of the full-length product (&#177; s.d., n = 3) was calculated from band intensities of the two mRNA isoforms and is represented in the graphs below. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63014/63014fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63014/63014fig03.jpg" /> 
Figure 3: Analysis of the variant U1-5a snRNA. HeLa cells were cotransfected with the Dup51 or Dup51p minigene plasmids and pcDNA control or pNS6U1 plasmids for U1-WT, U1-5g, or U1-5a snRNAs. (A) A two-dimensional representation of the U1 snRNA sequence. Position of the U17-26R primer, used for primer extension analysis of U1 snRNA, is indicated by the red line. Position of U1/17-39F and U1/58-80R primers, used for RT-qPCR of U1 snRNA, is indicated by the blue lines.(B) Primer extension analysis with 32P-labeled U17-26 to detect the expression of the wildtype U1 snRNA, and the U1-5g and U1-5a variants. Positions of the products formed from U1-WT and the variants snRNAs are indicated. (C) RT-qPCR analysis of the levels of U1 snRNA expression in Hela cells. The fold change in U1-snRNA expression was calculated relative to the pcDNA negative control and normalized to U2-snRNA, fold change (&#177; s.d.; n = 3) in U1 is graphed. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/63014/63014fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about A Reporter Based Cellular Assay for Monitoring Splicing Efficiency at JoVE.com

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

This protocol describes a minigene reporter assay to monitor the impact of 5&#180;-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes ...

a-reporter-based-cellular-assay-for-monitoring-splicing-efficiency

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Biochemistry

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

2.7K Views.  College of Medicine-Phoenix, University of Arizona. This protocol describes a minigene reporter assay to monitor the impact of 5´-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

Video: A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

Merging Absolute and Relative Quantitative PCR Data to Quantify STAT3 Splice Variant Transcripts

Human signal transducer and activator of transcription 3 (STAT3) is one of many genes containing a tandem splicing site. Alternative donor splice sites 3 nucleotides apart result in either the inclusion (S) or exclusion (&#916;S) of a single residue, Serine-701. Further downstream, splicing at a pair of alternative acceptor splice sites result in transcripts encoding either the 55 terminal residues of the transactivation domain (&#945;) or a truncated transactivation domain with 7 unique residues (&#946;). As outlined in this manuscript, measuring the proportions of STAT3's four spliced transcripts (S&#945;, S&#946;, &#916;S&#945; and &#916;S&#946;) was possible using absolute qPCR (quantitative polymerase chain reaction). The protocol therefore distinguishes and measures highly similar splice variants. Absolute qPCR makes use of calibrator plasmids and thus specificity of detection is not compromised for the sake of efficiency. The protocol necessitates primer validation and optimization of cycling parameters. A combination of absolute qPCR and efficiency-dependent relative qPCR of total STAT3 transcripts allowed a description of the fluctuations of STAT3 splice variants' levels in eosinophils treated with cytokines. The protocol also provided evidence of a co-splicing interdependence between the two STAT3 splicing events. The strategy based on a combination of the two qPCR techniques should be readily adaptable to investigation of co-splicing at other tandem splicing sites.

Tandem splicing events occur at sites less than 12 nucleotides apart. Quantifying ratios of such splice variants is feasible using an absolute quantitative PCR approach. This manuscript describes how splice variants of the gene STAT3, in which two splicing events results in Serine-701 inclusion/exclusion and &#945;/&#946; C-termini, can be quantified.

Human signal transducer and activator of transcription 3 (STAT3) is one of many genes containing a tandem splicing site. Alternative donor splice sites 3 ...

Genetics

Using RNA-sequencing to Detect Novel Splice Variants Related to Drug Resistance in In Vitro Cancer Models

Drug resistance remains a major problem in the treatment of cancer for both hematological malignancies and solid tumors. Intrinsic or acquired resistance can be caused by a range of mechanisms, including increased drug elimination, decreased drug uptake, drug inactivation and alterations of drug targets. Recent data showed that other than by well-known genetic (mutation, amplification) and epigenetic (DNA hypermethylation, histone post-translational modification) modifications, drug resistance mechanisms might also be regulated by splicing aberrations. This is a rapidly growing field of investigation that deserves future attention in order to plan more effective therapeutic approaches. The protocol described in this paper is aimed at investigating the impact of aberrant splicing on drug resistance in solid tumors and hematological malignancies. To this goal, we analyzed the transcriptomic profiles of several in vitro models through RNA-seq and established a qRT-PCR based method to validate candidate genes. In particular, we evaluated the differential splicing of DDX5 and PKM transcripts. The aberrant splicing detected by the computational tool MATS was validated in leukemic cells, showing that different DDX5 splice variants are expressed in the parental vs. resistant cells. In these cells, we also observed a higher PKM2/PKM1 ratio, which was not detected in the Panc-1 gemcitabine-resistant counterpart compared to parental Panc-1 cells, suggesting a different mechanism of drug-resistance induced by gemcitabine exposure.

Using RNA-sequencing to Detect Novel Splice Variants Related to Drug Resistance in In Vitro Cancer Models

Here we describe a protocol aimed at investigating the impact of aberrant splicing on drug resistance in solid tumors and hematological malignancies. To this goal, we analyzed the transcriptomic profiles of parental and resistant in vitro models through RNA-seq and established a qRT-PCR based method to validate candidate genes.

Drug resistance remains a major problem in the treatment of cancer for both hematological malignancies and solid tumors. Intrinsic or acquired resistance ...

Cancer Research

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell type-specific fashion. AS expression patterns are typically analyzed by RT-PCR and RNA-seq using RNA samples isolated from a population of cells. In situ examination of AS expression patterns for a particular biological structure can be carried out by RNA in situ hybridization (ISH) using exon-specific probes. However, this particular use of ISH has been limited because alternative exons are generally too short to design exon-specific probes. In this report, the use of BaseScope, a recently developed technology that employs short antisense oligonucleotides in RNA ISH, is described to analyze AS expression patterns in mouse brain sections. Exon 23a of neurofibromatosis type 1 (Nf1) is used as an example to illustrate that short exon-exon junction probes exhibit robust hybridization signals with high specificity in RNA ISH analysis on mouse brain sections. More importantly, signals detected with exon inclusion- and skipping-specific probes can be used to reliably calculate the percent spliced in values of Nf1 exon 23a expression in different anatomical areas of a mouse brain. The experimental protocol and calculation method for AS analysis are presented. The results indicate that BaseScope provides a powerful new tool to assess AS expression patterns in situ.

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

An in situ hybridization (ISH) protocol that uses short antisense oligonucleotides to detect alternative pre-mRNA splicing patterns in mouse brain sections is described.

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell ...

Using the E1A Minigene Tool to Study mRNA Splicing Changes

mRNA processing involves multiple simultaneous steps to prepare mRNA for translation, such as 5&#180;capping, poly-A addition and splicing. Besides constitutive splicing, alternative mRNA splicing allows the expression of multifunctional proteins from one gene. As interactome studies are generally the first analysis for new or unknown proteins, the association of the bait protein with splicing factors is an indication that it can participate in mRNA splicing process, but to determine in what context or what genes are regulated is an empirical process. A good starting point to evaluate this function is using the classical minigene tool. Here we present the adenoviral E1A minigene usage for evaluating the alternative splicing changes after different cellular stress stimuli. We evaluated the splicing of E1A minigene in HEK293 stably overexpressing Nek4 protein after different stressing treatments. The protocol includes E1A minigene transfection, cell treatment, RNA extraction and cDNA synthesis, followed by PCR and gel analysis and quantification of the E1A spliced variants. The use of this simple and well-established method combined with specific treatments is a reliable starting point to shed light on cellular processes or what genes can be regulated by mRNA splicing.

This protocol presents a rapid and useful tool for evaluating the role of a protein with uncharacterized function in alternative splicing regulation after chemotherapeutic treatment.

mRNA processing involves multiple simultaneous steps to prepare mRNA for translation, such as 5&#180;capping, poly-A addition and splicing. Besides ...

ACT1-CUP1 Assays Determine the Substrate-Specific Sensitivities of Spliceosomal Mutants in Budding Yeast

Mutations introduced in the spliceosome or its substrate have significantly contributed to our understanding of the intricacies of spliceosomal function. Whether disease-related or functionally selected, many of these mutations have been studied using growth assays in the model organism Saccharomyces cerevisiae (yeast). The splicing-specific copper growth assay, or ACT1-CUP1 assay, provides a comprehensive analysis of mutation at the phenotypic level. The ACT1-CUP1 assay utilizes reporters that confer copper tolerance when correctly spliced. Thus, in the presence of copper, changes in yeast viability correlate to changes in mRNA production through splicing. In a typical experiment, the yeast spliceosome is challenged with different non-consensus splicing reporters and the splicing factor mutation of interest to detect any synergetic or antithetical impact on splicing. Here a full description of copper plate preparation, plating of yeast cells, and data evaluation are given. A selection of complimentary experiments is described, highlighting the versatility of the ACT1-CUP1 reporters. The ACT1-CUP1 assay is a handy tool in the splicing toolbox thanks to the direct read-out of mutational effect(s) and the comparative possibilities from the continuing use in the field.

The ACT1-CUP1 assay, a copper growth assay, provides a quick readout of precursor messenger RNA (pre-mRNA) splicing and the impact mutant splicing factors have on spliceosomal function. This study provides a protocol and highlights the customization possible to address the splicing question of interest.

Mutations introduced in the spliceosome or its substrate have significantly contributed to our understanding of the intricacies of spliceosomal function. ...

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Quantifying DNA Double Strand Break Repair with Nanoluciferase Reporter Assays

Assessment of DNA Double Strand Break Repair Activity Using High-throughput and Quantitative Luminescence-Based Reporter Assays

The repair of DNA double strand breaks (DSBs) is crucial for the maintenance of genome stability and cell viability. DSB repair (DSBR) in cells is mediated through several mechanisms: homologous recombination (HR), non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and single strand annealing (SSA). Cellular assays are essential to measure the proficiency and modulation of these pathways in response to various stimuli.
Here, we present a suite of extrachromosomal reporter assays that each measure the reconstitution of a nanoluciferase reporter gene by one of the four major DSBR pathways in cells. Upon transient transfection into cells of interest, repair of pathway-specific reporter substrates can be measured in under 24 h by the detection of Nanoluciferase (NanoLuc) luminescence.
These robust assays are quantitative, sensitive, titratable, and amenable to a high-throughput screening format. These properties provide broad applications in DNA repair research and drug discovery, complementing the currently available toolkit of cellular DSBR assays.

Author Spotlight: Developing Novel Anticancer Therapeutics Targeting the DNA Damage Response

We present protocols for the assessment of double strand break repair pathway proficiency in cells using a suite of luminescence-based extrachromosomal reporter substrates.

The repair of DNA double strand breaks (DSBs) is crucial for the maintenance of genome stability and cell viability. DSB repair (DSBR) in cells is ...

Small-scale Nuclear Extracts for Functional Assays of Gene-expression Machineries

A great deal of progress in understanding gene expression has been made using in vitro systems. For most studies, functional assays are carried out using extracts that are prepared in bulk from 10-50 or more liters of cells grown in suspension. However, these large-scale preparations are not amenable to rapidly testing in vitro effects that result from a variety of in vivo cellular treatments or conditions. This journal video article shows a method for preparing functional small-scale nuclear extracts, using HeLa cells as an example. This method is carried out using as few as three 150 mm plates of cells grown as adherent monolayers. To illustrate the efficiency of the small-scale extracts, we show that they are as active as bulk nuclear extracts for coupled RNA Polymerase II transcription/splicing reactions. To demonstrate the utility of the extract protocol, we show that splicing is abolished in extracts prepared from HeLa cells treated with the splicing inhibitor drug E7107. The small-scale protocol should be generally applicable to any process or cell type that can be investigated in vitro using cellular extracts. These include patient cells that are only available in limited quantities or cells exposed to numerous agents such as drugs, DNA damaging agents, RNAi, or transfection, which require the use of small cell populations. In addition, small amounts of freshly grown cells are convenient and/or required for some applications.

A protocol for preparation of robust, small-scale HeLa nuclear extracts is described. This protocol is valuable for assays that require use of small populations of cells, such as cells treated with drugs or RNAi. The method should be applicable to a wide variety of gene expression assays and other cell types, including patient cells.

A great deal of progress in understanding gene expression has been made using in vitro systems.  For most studies, functional assays are carried out using ...

Biology

Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment called the Cajal body. However, sequences that direct snRNA localization into this subnuclear structure have not been known until recently. To determine sequences important for accumulation of snRNAs in Cajal bodies, we employed microinjection of fluorescently labelled snRNAs followed by their localization inside cells. First, we prepared snRNA deletion mutants, synthesized DNA templates for in vitro transcription and transcribed snRNAs in the presence of UTP coupled with Alexa488. Labelled snRNAs were mixed with 70 kDa-Dextran conjugated with TRITC, and microinjected to the nucleus or the cytoplasm of human HeLa cells. Cells were incubated for 1 h and fixed and the Cajal body marker coilin was visualized by indirect immunofluorescence, while snRNAs and dextran, which serves as a marker of nuclear or cytoplasmic injection, were observed directly using a fluorescence microscope. This method allows for efficient and rapid testing of how various sequences influence RNA localization inside cells. Here, we show the importance of the Sm-binding sequence for efficient localization of snRNAs into the Cajal body.

Biogenesis of spliceosomal snRNAs is a complex process involving various cellular compartments. Here, we employed microinjection of fluorescently labelled snRNAs in order to monitor their transport inside the cell.

Biogenesis of spliceosomal snRNAs is a complex process involving both nuclear and cytoplasmic phases and the last step occurs in a nuclear compartment ...

Neuroscience

Detection of Alternative Splicing During Epithelial-Mesenchymal Transition

Alternative splicing plays a critical role in the epithelial-mesenchymal transition (EMT), an essential cellular program that occurs in various physiological and pathological processes. Here we describe a strategy to detect alternative splicing during EMT using an inducible EMT model by expressing the transcription repressor Twist. EMT is monitored by changes in cell morphology, loss of E-cadherin localization at cell-cell junctions, and the switched expression of EMT markers, such as loss of epithelial markers E-cadherin and &#947;-catenin and gain of mesenchymal markers N-cadherin and vimentin. Using isoform-specific primer sets, the alternative splicing of interested mRNAs are analyzed by quantitative RT-PCR. The production of corresponding protein isoforms is validated by immunoblotting assays. The method of detecting splice isoforms described here is also suitable for the study of alternative splicing in other biological processes.

Alternative splicing regulation has been shown to contribute to the epithelial-mesenchymal transition (EMT), an essential cellular program in various physiological and pathological processes. Here we describe a method utilizing an inducible EMT model for the detection of alternative splicing during EMT.

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

Summary

Explore More Videos

Merging Absolute and Relative Quantitative PCR Data to Quantify STAT3 Splice Variant Transcripts

Using RNA-sequencing to Detect Novel Splice Variants Related to Drug Resistance in In Vitro Cancer Models

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Using the E1A Minigene Tool to Study mRNA Splicing Changes

ACT1-CUP1 Assays Determine the Substrate-Specific Sensitivities of Spliceosomal Mutants in Budding Yeast

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

Assessment of DNA Double Strand Break Repair Activity Using High-throughput and Quantitative Luminescence-Based Reporter Assays

Small-scale Nuclear Extracts for Functional Assays of Gene-expression Machineries

Analysis of Spliceosomal snRNA Localization in Human Hela Cells Using Microinjection

Detection of Alternative Splicing During Epithelial-Mesenchymal Transition