We are grateful for technical support from Dr. Tz-Ling Chen. We thank the National RNAi Core Facility (Academia Sinica, Taiwan) for providing shRNA lentivirus (http://rnai.genmed.sinica.edu.tw). This work was supported by the Ministry of Science and Technology, Taiwan (MOST 108-2320-B-002-037-MY3 and MOST 109-2320-B-002-054-MY3).

Handling of lentivirus is performed as per the regulation of the Department of Environmental Health and Safety of National Taiwan University College of Medicine.
1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)
<ol>
	<li>Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 &#181;M &#946;-estradiol.</li>
	<li>Passage the cells at a ratio of 1:10 every 3 days. 
	&#8203;NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x 10-5 M &#946;-mercaptoethanol, and 10 &#181;g/mL gentamicin. Recombinant murine FL is also commercially available.</li>
</ol>
2. Lentiviral transduction
<ol>
	<li>Plate iHSPCs at a density of 1 x 105 cells/well in 12-well plates in 1 mL of complete medium containing 100 ng/mL FL, 1 &#181;M &#946;-estradiol, and 8 &#181;g/mL polybrene. 
	NOTE: The concentration of polybrene depends on the cell types and is usually in the range of 4-8 &#181;g/mL.</li>
	<li>Add shRNA-carrying lentivirus in each well at a multiplicity of infection (MOI) of 100. 
	NOTE: The lentiviral vector is pLKO.1-Puro with a puromycin selection marker (Figure 1).The target sequences of shRNAs against LacZ, Tcf4, and Id2, respectively, are listed in the Table of Materials. The MOI is defined by the number of virions that are added per cell during infection. 
	<img alt="Equation 1" src="/files/ftp_upload/62730/62730eq01.jpg" /></li>
	<li>Spin the plates at 1,100 x g for 90 min at 37 &#176;C. 
	NOTE: Spin infection is carried out using a swing bucket rotor.</li>
	<li>Incubate the plate containing infected cells for overnight at 37 &#176;C in an incubator. 
	NOTE: If the cells are sensitive to polybrene, then refresh the cells with the complete medium without polybrene after the spin infection.</li>
	<li>Refresh cells with complete medium containing 100 ng/mL FL and 1 &#181;M &#946;-estradiol 24 h after the infection.</li>
	<li>Add 6 &#181;g/mL of puromycin to the medium to select the infected cells after an additional 24 h. 
	NOTE: Transduced lentiviral vector usually takes 48 h for expressing genes, including puromycin resistant gene. Ensure that the concentration of puromycin is optimized for each cell line.</li>
	<li>Refresh the selection medium containing 100 ng/mL FL, 1 &#181;M &#946;-estradiol, and 6 &#181;g/mL puromycin every 3 days and maintain the cells for at least one week to expand the stably transduced iHSPC cells. 
	&#8203;NOTE: Puromycin selection usually takes effect 48 h later, and the period of selection depends on cell types.</li>
</ol>
3. Measurement of knockdown efficiency by reverse transcription and real-time PCR (RT-PCR)
<ol>
	<li>Extract total RNA from 1 x 107 shLacZ, shTcf4, and shId2 stable knockdown iHSPC cells using commercial RNA extraction reagent and precipitate RNA from the aqueous layer with isopropanol, followed by washing the RNA precipitate with 75% ethanol.</li>
	<li>Dissolve the RNA (~ 5 &#181;g) with 5 &#181;L of DEPC-treated H2O and adjust the concentration to 1 &#181;g/&#181;L.</li>
	<li>Take 1-3 &#181;g of RNA, mix with DEPC-treated H2O to a final volume of 17.4 &#181;L, add 1 &#181;L of 1 unit/&#181;L RNase-free DNase I and incubate for 20 min at 37 &#176;C. 
	NOTE: This step is to digest the genomic DNA in the RNA samples.</li>
	<li>Add 1 &#181;L of 20 mM EDTA to the RNA samples, incubate at 65 &#176;C for 10 min to inactivate DNase I, and put the RNA samples immediately at 4 &#176;C.</li>
	<li>Add 11.6 &#181;L of the reaction mix containing 1 &#181;L of oligo (dT) primers (45 &#181;M), 6 &#181;L of 5x 1st strand buffer, 3 &#181;L of dNTP (2 mM), 0.6 &#181;L of RNase inhibitor (50 Unit/&#181;L) and 1 &#181;L of reverse transcriptase (200 Unit/&#181;L) to the RNA samples and incubate at 40 &#176;C for 1 h.</li>
	<li>Stop the reaction by heating at 70 &#176;C for 10 min and dilute the reaction mix with 30 &#181;L of H2O.</li>
	<li>Take 2 &#181;L of the diluted RT reaction mix as a DNA template and PCR amplify it using primers against Tcf4 or Id2 (see Table 1 for thermocycler conditions). 
	&#8203;NOTE: The primer sequences are included in the Table of Materials.</li>
</ol>
4. In vitro differentiation of the stable knockdown iHSPC cell lines
<ol>
	<li>Maintain the stable single knockdown of LacZ (shLacZ), Tcf4 (shTcf4), or Id2 (shId2) in iHSPCs in complete medium containing 100 ng/mL of FL and 1 &#181;M &#946;-estradiol.</li>
	<li>Collect shLacZ, shTcf4, and shId2 un-differentiated iHSPCs into a 15 mL tube and centrifuge for 5 min at 500 x g to pellet the cells.</li>
	<li>Discard the supernatant and add 10 mL of PBS to wash the cells. Repeat this step twice.</li>
	<li>Resuspend and seed the iHSPC cells at a density of 2 x 105 cells/mL into a 12-well plate in 1 mL of complete medium containing 100 ng/mL FL only.</li>
	<li>Add 1 mL of fresh complete medium containing 100 ng/mL FL three days later.</li>
	<li>Analyze the differentiated cells (shLacZ, shTcf4, and shId2 iHSPCs) by flow cytometry two days later.</li>
</ol>
5. Flow cytometric analysis of the differentiated DCs
<ol>
	<li>Collect the cells into 1.5 mL tubes by pipetting the cells up and down 2-3 times in the plate, and centrifuge for 5 min at 500 x g at room temperature (RT). 
	NOTE: In vitro differentiated DCs will slightly attach to the plates. Gentle pipetting will help recover DCs from the plates.</li>
	<li>Discard the supernatant and resuspend the cells in 50 &#181;L of FACS buffer. Next, add 50 &#181;L of anti-CD16/32 hybridoma supernatant and incubate for 5-10 min on ice. 
	NOTE: The Fc blocking antibody prevents nonspecific binding of antibodies to Fc receptors expressing on some myeloid cells and B cells and is commercially available through various vendors.</li>
	<li>Add fluorescent dye-conjugated antibodies (0.04 &#181;g for each antibody) directly to the cells and incubate for 15 min on ice in the dark. The antibodies used are APC/cy7 anti-mouse CD11c, FITC anti-mouse CD11b, and PE anti-mouse B220. 
	NOTE: pDCs are defined as CD11c+CD11b-B220+, and cDCs are defined as CD11c+CD11b+B220-.</li>
	<li>Wash cells with 1 mL of FACS buffer and centrifuge for 5 min at 500 x g at RT.</li>
	<li>Resuspend the cells in 100 &#181;L of FACS buffer and analyze by flow cytometry.</li>
</ol>

<ol>
	<li>Steinman, R. M., Witmer, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymphoid+dendritic+cells+are+potent+stimulators+of+the+primary+mixed+leukocyte+reaction+in+mice.">Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice.</a> Proceedings of the National Academy of Sciences. 75 (10), 5132-5136 (1978).</li><li>Guilliams, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cells,+monocytes+and+macrophages:+a+unified+nomenclature+based+on+ontogeny.">Dendritic cells, monocytes and macrophages: a unified nomenclature based on ontogeny.</a> Nature Reviews Immunology. 14 (8), 571-578 (2014).</li><li>Blasius, A. L., Cella, M., Maldonado, J., Takai, T., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Siglec-H+is+an+IPC-specific+receptor+that+modulates+type+I+IFN+secretion+through+DAP12.">Siglec-H is an IPC-specific receptor that modulates type I IFN secretion through DAP12.</a> Blood. 107 (6), 2474-2476 (2006).</li><li>Swiecki, M., Colonna, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unraveling+the+functions+of+plasmacytoid+dendritic+cells+during+viral+infections,+autoimmunity,+and+tolerance.">Unraveling the functions of plasmacytoid dendritic cells during viral infections, autoimmunity, and tolerance.</a> Immunology Reviews. 234 (1), 142-162 (2010).</li><li>Liu, Y. -. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IPC:+Professional+Type+1+interferon-producing+cells+and+plasmacytoid+dendritic+cell+precursors.">IPC: Professional Type 1 interferon-producing cells and plasmacytoid dendritic cell precursors.</a> Annual Review of Immunology. 23 (1), 275-306 (2005).</li><li>Panda, S. K., Kolbeck, R., Sanjuan, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmacytoid+dendritic+cells+in+autoimmunity.">Plasmacytoid dendritic cells in autoimmunity.</a> Current Opinion in Immunology. 44, 20-25 (2017).</li><li>Durai, V., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+murine+dendritic+cells.">Functions of murine dendritic cells.</a> Immunity. 45 (4), 719-736 (2016).</li><li>Mashayekhi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD8&#945;(+)+dendritic+cells+are+the+critical+source+of+interleukin-12+that+controls+acute+infection+by+Toxoplasma+gondii+tachyzoites.">CD8&#945;(+) dendritic cells are the critical source of interleukin-12 that controls acute infection by Toxoplasma gondii tachyzoites.</a> Immunity. 35 (2), 249-259 (2011).</li><li>Anderson, D. A., Dutertre, C. -. A., Ginhoux, F., Murphy, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+models+of+human+and+mouse+dendritic+cell+development+and+function.">Genetic models of human and mouse dendritic cell development and function.</a> Nature Reviews Immunology. 21 (2), 101-115 (2021).</li><li>Plantinga, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conventional+and+monocyte-derived+CD11b(+)+dendritic+cells+initiate+and+maintain+T+helper+2+cell-mediated+immunity+to+house+dust+mite+allergen.">Conventional and monocyte-derived CD11b(+) dendritic cells initiate and maintain T helper 2 cell-mediated immunity to house dust mite allergen.</a> Immunity. 38 (2), 322-335 (2013).</li><li>Persson, E. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRF4+transcription-factor-dependent+CD103(+)CD11b(+)+dendritic+cells+drive+mucosal+T+helper+17+cell+differentiation.">IRF4 transcription-factor-dependent CD103(+)CD11b(+) dendritic cells drive mucosal T helper 17 cell differentiation.</a> Immunity. 38 (5), 958-969 (2013).</li><li>Kumamoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CD301b++dermal+dendritic+cells+drive+T+helper+2+cell-mediated+immunity.">CD301b+ dermal dendritic cells drive T helper 2 cell-mediated immunity.</a> Immunity. 39 (4), 733-743 (2013).</li><li>Cisse, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+factor+E2-2+is+an+essential+and+specific+regulator+of+plasmacytoid+dendritic+cell+development.">Transcription factor E2-2 is an essential and specific regulator of plasmacytoid dendritic cell development.</a> Cell. 135 (1), 37-48 (2008).</li><li>Grajkowska, L. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isoform-specific+expression+and+feedback+regulation+of+E+protein+TCF4+control+dendritic+cell+lineage+specification.">Isoform-specific expression and feedback regulation of E protein TCF4 control dendritic cell lineage specification.</a> Immunity. 46 (1), 65-77 (2017).</li><li>Jackson, J. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Id2+expression+delineates+differential+checkpoints+in+the+genetic+program+of+CD8&#945;++and+CD103++dendritic+cell+lineages.">Id2 expression delineates differential checkpoints in the genetic program of CD8&#945;+ and CD103+ dendritic cell lineages.</a> The EMBO Journal. 30 (13), 2690-2704 (2011).</li><li>Suzuki, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+roles+of+interferon+regulatory+factor+4+in+CD11bhighCD8alpha-+dendritic+cell+development.">Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha- dendritic cell development.</a> Proceedings of the National Academy of Science U. S. A. 101 (24), 8981-8986 (2004).</li><li>Rodrigues, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+progenitor+lineages+contribute+to+the+heterogeneity+of+plasmacytoid+dendritic+cells.">Distinct progenitor lineages contribute to the heterogeneity of plasmacytoid dendritic cells.</a> Nature Immunology. 19 (7), 711-722 (2018).</li><li>Brown, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+basis+of+mouse+and+human+dendritic+cell+heterogeneity.">Transcriptional basis of mouse and human dendritic cell heterogeneity.</a> Cell. 179 (4), 846-863 (2019).</li><li>Redecke, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hematopoietic+progenitor+cell+lines+with+myeloid+and+lymphoid+potential.">Hematopoietic progenitor cell lines with myeloid and lymphoid potential.</a> Nature Methods. 10 (8), 795-803 (2013).</li><li>Abe, A., Miyanohara, A., Friedmann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polybrene+increases+the+efficiency+of+gene+transfer+by+lipofection.">Polybrene increases the efficiency of gene transfer by lipofection.</a> Gene Therapy. 5 (5), 708-711 (1998).</li><li>Sorgi, F. L., Bhattacharya, S., Huang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protamine+sulfate+enhances+lipid-mediated+gene+transfer.">Protamine sulfate enhances lipid-mediated gene transfer.</a> Gene Therapy. 4 (9), 961-968 (1997).</li><li>Kirkling, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling+facilitates+in+vitro+generation+of+cross-presenting+classical+dendritic+cells.">Notch signaling facilitates in vitro generation of cross-presenting classical dendritic cells.</a> Cell Reports. 23 (12), 3658-3672 (2018).</li><li>Pearce, E. J., Everts, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dendritic+cell+metabolism.">Dendritic cell metabolism.</a> Nature Reviews. Immunology. 15 (1), 18-29 (2015).</li><li>Wculek, S. K., Khouili, S. C., Priego, E., Heras-Murillo, I., Sancho, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+Control+of+Dendritic+Cell+Functions:+Digesting+Information.">Metabolic Control of Dendritic Cell Functions: Digesting Information.</a> Frontiers in Immunology. 10 (775), (2019).</li><li>Saxton, R. A., Sabatini, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mTOR+signaling+in+growth,+metabolism,+and+disease.">mTOR signaling in growth, metabolism, and disease.</a> Cell. 168 (6), 960-976 (2017).</li></ol>

The authors have nothing to disclose.

Lentivirus-based shRNA vectors are often used for gene silencing by viral transduction into cells and permit stable integration into the host genome. However, various transduction efficiency in different cell types needs to be considered, and a number of approaches have been taken to overcome this problem. 
Polybrene is a polycationic polymer that can neutralize the charges on the cell membrane, thereby enhancing the binding of the virion to the cells during transduction20. Although it is an effective way to increase the transduction rate, it is also toxic to some cell types when adding excessive amounts. In this case, it is required to test the toxicity of polybrene and optimize the concentration in different cells. Protamine sulfate, a cationic compound, maybe an alternative approach to increase cell viability21. Moreover, refresh complete media on the same day of infection can improve the represent survival rate after transduction.
Most shRNA delivery systems have a selective marker for eliminating cells that have not been successfully infected. The lentiviral system we used contains a puromycin-resistant gene so that the infected cells could be selected after transduction. Moreover, lentivirus expressing GFP is also another option for the selection. However, there are both advantages and disadvantages to both methods. Using puromycin as a selection method is hard to directly measure the transduction efficiency unless the expression of target genes was confirmed by qPCR. But puromycin provides stress for selection to keep the foreign DNA inside the cells and maintain the knockdown phenotype. In contrast, GFP is also a selection method that does not provide stress to the cells even though the transduction efficiency can be immediately evaluated by flow cytometry. 
One of the limitations of this method is the relatively small number of cDC1 cells generated by iHSPCs in vitro19. Although iHSPCs have pDCs and cDCs potential driven by FL in vitro, most of cDC subtypes generated is cDC2s, but not cDC1s. This is likely due to the requirement of Notch signaling during in vitro cDC1 differentiation22. Therefore, co-culture with OP9-DL1 stromal cells which express the Notch ligand Delta-like 1 may restore cDC1 potential of iHSPCs, thereby improving the mechanistic studies on cDC1s. 
The application of this protocol not only for investigating the role of TFs but also for other genes, like metabolic genes likely to participate in the development of DCs or other cell types. An emerging concept highlights that DC developmental pathway is associated with different cellular metabolism23,24. Therefore, gene knockdown in DC progenitors is a powerful strategy to study metabolic regulation in response to environmental cues and determine how different metabolic pathways regulate DC differentiation by knocking down critical genes in metabolism25. On the other hand, iHSPCs have the capacity to differentiate into myeloid cells beyond DC lineages by utilizing specific differentiation factors. The use of macrophage colony-stimulating factor (M-CSF) and granulocyte-colony stimulating factor (G-CSF) results in the development of macrophages and granulocytes, respectively, from iHSPCs19. Based on the same strategy, this method could also apply to the research of myeloid cell development.
Collectively, the described protocol from gene knockdown to in vitro differentiation of iHSPCs provides a rapid and effective way to facilitate the study of DC development and answers fundamental questions of immune cell development in the future.

DCs are key regulators of innate and adaptive immunity1. DCs are mainly classified into two functionally distinct populations, namely pDCs and cDCs. Moreover, cDCs comprise two subsets, namely, type I and type II cDCs or cDC1s and cDC2s, respectively2. pDCs, expressing BST2, Siglec-H, and intermediate levels of CD11c in mice3,4, are the cells that can secrete large amounts of IFN-I during inflammation and viral infection5. Due to their robust IFN-I-producing ability, they are also suspected to play a key role in the progression of autoimmune diseases, including systemic lupus erythematosus (SLE)6. cDC1s, defined by the surface expression of XCR1, CD8a, CLEC9A, and CD103 in mice7, are specialized in the activation and polarization of cytotoxic CD8+ T cells (CTLs) through the antigen cross-presentation, thereby initiating type I immunity in response to intracellular pathogens and cancer8,9. On the other hand, cDC2s, expressing CD11b and CD172&#945; (also known as Sirp&#945;) in both humans and mice, can activate CD4+ T cells and promote type II immune response against allergen and parasites10, as well as modulate type III immunity following extracellular bacteria and microbiota recognition11,12.
Diversification of DCs is determined by a group of TFs from hematopoietic stem and progenitor cells (HSPCs) in the BM. E2-2 (encoded by Tcf4) is a master regulator for differentiation and function of pDCs13,14. In contrast, the inhibitor of DNA binding 2 (ID2) drives cDC specification and inhibits pDC development through blocking E protein activity15. Moreover, the development of cDC1s requires IRF8 and BATF3, while differentiation of cDC2s highly depends on IRF416. Recent works have explored the heterogeneity of pDCs17 and cDCs and their transcriptional regulation18. Because of the complexity of DC network, there is an unmet need to establish a platform to identify other TFs controlling the development and functionality of DCs.
Here, we used an iHSPC that was generated by expressing estrogen-regulated nuclear translocation of Hoxb8 in BM cells (also referred to as Hoxb8-FL cells)19. iHSPCs can proliferate and remain in an undifferentiated stage in the presence of &#946;-estradiol and Flt3 ligand (FL), whereas they start to differentiate into different DC types in the presence of FL upon withdrawal of &#946;-estradiol19. Based on this feature, we can knock down genes of interest at the progenitor stage, followed by examining the effect on in vitro differentiation of pDCs and cDCs. Therefore, this method is a powerful tool to discover the genes that regulate the development and function of DCs.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Antibodies</td>
		</tr>
		<tr>
			<td>APC/Cy7 anti-mouse CD11c Antibody</td>
			<td>Biolegend</td>
			<td>117324</td>
			<td>(Clone: N418)</td>
		</tr>
		<tr>
			<td>FITC anti-mouse/human CD11b Antibody</td>
			<td>Biolegend</td>
			<td>101206</td>
			<td>(Clone: M1/70)</td>
		</tr>
		<tr>
			<td>PE anti-mouse/human B220 Antibody</td>
			<td>Biolegend</td>
			<td>103208</td>
			<td>(Clone: RA3-6B2)</td>
		</tr>
		<tr>
			<td colspan="4">Cell culture</td>
		</tr>
		<tr>
			<td>1.5 mL Micro tube</td>
			<td>&#160;ExtraGene</td>
			<td>TUBE-170-C</td>
			<td></td>
		</tr>
		<tr>
			<td>12-well tissue culture-treated plate</td>
			<td>Falcon</td>
			<td>353043</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>Corning</td>
			<td>35-010-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 medium</td>
			<td>gibco</td>
			<td>11875-085</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Reagent</td>
		</tr>
		<tr>
			<td>&#946;-estradiol</td>
			<td>Sigma-Aldrich</td>
			<td>E2758-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol (&#946;-ME)</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS buffer</td>
			<td>home-made</td>
			<td></td>
			<td>Formula: 1xPBS+0.5 %FBS+0.1%NaN3</td>
		</tr>
		<tr>
			<td>Flt3 ligand (FL)</td>
			<td>home-made</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene</td>
			<td>Sigma-Aldrich</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Invivogen</td>
			<td>ant-pr-1</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIsure</td>
			<td>BIOLINE</td>
			<td>BIO-38032</td>
			<td></td>
		</tr>
		<tr>
			<td>shRNA (Taregt sequence/clone ID)</td>
			<td>Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shId2&#160; (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

study of dendritic cell development by short hairpin rna-mediated gene knockdown in a hematopoietic stem and progenitor cell line in vitro

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided into conventional DCs (cDCs) and plasmacytoid DCs (pDCs). cDCs specializes in presenting antigens to and activate na&#239;ve T cells. On the other hand, pDCs can produce large quantities of type I interferons (IFN-I) during viral infection. The specification of DCs occurs at an early stage of DC progenitors in the bone marrow (BM) and is defined by a network of transcription factors (TFs). For example, cDCs highly express ID2, while pDCs highly express E2-2. Since more and more subsets of DCs are being identified, there is a growing interest in understanding specific TFs controlling DC development. Here, we establish a method to screen TFs critical for DCs differentiation in vitro by delivering lentivirus carrying short hairpin RNA (shRNA) into an immortalized hematopoietic stem and progenitor cell (iHSPCs) line. After the selection and in vitro differentiation, cDC and pDC potential of the stable knockdown cell lines are analyzed by flow cytometry. This approach provides a platform to identify genes potentially governing DC fates from progenitors in vitro.

The map of lentiviral vector pLKO.1-Puro is shown (Figure 1). After the delivery of lentivirus expressing shRNA against LacZ (a non-targeting control), Tcf4, and Id2 in iHSPCs, the knockdown efficiency confirmed by RT-qPCR revealed that the expression of Tcf4 was reduced in shTcf4 iHSPCs, compared to shLacZ iHSPCs (Figure 2A). On the other hand, the decreased expression of Id2 was also observed in shId2 iHSPCs, compared to shLacZ iHSPCs control (Figure 2B). The shLacZ,shTcf4, and shId2 iHSPCs cell lines were differentiated into pDCs and cDCs in vitro with FL. After five-day culture of shLacZ iHSPCs, the frequency of CD11c+ cells, which represent DC population7, was around 95% (Figure 3A,&#160;left panel). However, knockdown of Tcf4 or Id2 slightly decreased the generation of CD11c+ DCs (Figure 3A,&#160;middle and right panel). Moreover, further analysis of CD11c+ DCs revealed that shLacZ iHSPCs differentiated into 70% of cDCs (CD11c+CD11b+B220+) and 22% of pDCs (CD11c+CD11b-B220+) (Figure 3B,&#160;left panel). However, shTcf4 iHSPCs generated a significantly lower percentage of pDCs (4 %) than did shLacZ control (Figure 3B, middle panel). On the other hand, shId2 iHSPCs generated a significantly lower percentage of cDCs (54%) but a higher percentage of pDCs (39%) than did shLacZ control (Figure 3B,&#160;right panel). Therefore, these results suggest iHSPCs faithfully reflect the same requirement of transcription factors for controlling DC development.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62730/62730fig01.jpg" /> 
Figure 1: The construct of lentiviral vector pLKO.1-Puro. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62730/62730fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62730/62730fig02.jpg" /> 
Figure 2: The knockdown efficiency of shTcf4 and shId2. After stable gene knockdown, RNAs were isolated from shLacZ, shTcf4, and shId2 iHSPCs and reversely transcribed into cDNA, and the expression of Tcf4 and Id2 was measured by RT-qPCR. Relative gene expression was normalized to Rpl7. A. The expression of Tcf4 in shLacZ and shTcf4 iHSPCs. B. The expression of Id2 in shLacZ and shId2 iHSPCs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62730/62730fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62730/62730fig03.jpg" /> 
Figure 3: Knockdown of Tcf4 impairs pDC development, whereas knockdown of Id2 reduces cDC generation from iHSPCs in vitro. iHSPCs were stably transduced with shLacZ, shTcf4, and shId2-carrying lentiviruses, then in vitro differentiated into DCs with FL (100 ng/mL). After culture for 5 days, the cells were stained and analyzed by flow cytometry. A. The percentage of CD11c+ cells is shown. B. The analysis for pDCs (CD11c+B220+CD11b-), and cDCs (CD11c+B220-CD11b+) are shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/62730/62730fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR reaction</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Steps</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>95&#176;C</td>
			<td>3 minutes</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95&#176;C</td>
			<td>15 seconds</td>
			<td rowspan="3">35-40</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>60&#176;C</td>
			<td>20 seconds</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72&#176;C</td>
			<td>20 seconds</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>80&#176;C</td>
			<td>20 seconds</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4&#176;C</td>
			<td>&#8734;</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 1: Thermocycler conditions for PCR.

Watch this Scientific Journal Video about Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro at JoVE.com

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Here we provide a protocol for screening potential transcription factors involved in the development of dendritic cell (DC) using lentiviral transduction of shRNA to obtain stable knockdown cell lines for in vitro DC differentiation.

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided ...

study-dendritic-cell-development-short-hairpin-rna-mediated-gene

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

3.4K Views.  National Taiwan University College of Medicine. Here we provide a protocol for screening potential transcription factors involved in the development of dendritic cell (DC) using lentiviral transduction of shRNA to obtain stable knockdown cell lines for in vitro DC differentiation.

Video: Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully generated and infused T-cells specific for Epstein Barr virus (EBV), cytomegalovirus (CMV) and Adenovirus (Adv) using monocytes and EBV-transformed lymphoblastoid cell (EBV-LCL) gene-modified with an adenovirus vector as antigen presenting cells (APCs). As few as 2x105/kg trivirus-specific cytotoxic T lymphocytes (CTL) proliferated by several logs after infusion and appeared to prevent and treat even severe viral disease resistant to other available therapies. The broader implementation of this encouraging approach is limited by high production costs, complexity of manufacture and the prolonged time (4-6 weeks for EBV-LCL generation, and 4-8 weeks for CTL manufacture &#x2013; total 10-14 weeks) for preparation. To overcome these limitations we have developed a new, GMP-compliant CTL production protocol. First, in place of adenovectors to stimulate T-cells we use dendritic cells (DCs) nucleofected with DNA plasmids encoding LMP2, EBNA1 and BZLF1 (EBV), Hexon and Penton (Adv), and pp65 and IE1 (CMV) as antigen-presenting cells. These APCs reactivate T cells specific for all the stimulating antigens. Second, culture of activated T-cells in the presence of IL-4 (1,000U/ml) and IL-7 (10ng/ml) increases and sustains the repertoire and frequency of specific T cells in our lines. Third, we have used a new, gas permeable culture device (G-Rex) that promotes the expansion and survival of large cell numbers after a single stimulation, thus removing the requirement for EBV-LCLs and reducing technician intervention. By implementing these changes we can now produce multispecific CTL targeting EBV, CMV, and Adv at a cost per 106 cells that is reduced by &gt;90%, and in just 10 days rather than 10 weeks using an approach that may be extended to additional protective viral antigens. Our FDA-approved approach should be of value for prophylactic and treatment applications for high risk allogeneic HSCT recipients.

A rapid, simple and cost-effective protocol for the generation of donor-derived multivirus-specific CTLs (rCTL) for infusion to allogeneic hematopoietic stem cell transplant (HSCT) recipients at risk of developing CMV, Adv or EBV infections. This manufacturing process is GMP-compliant and should ensure the broader implementation of T-cell immunotherapy beyond specialized centers.

Viral infections cause morbidity and mortality in allogeneic hematopoietic stem cell transplant (HSCT) recipients. We and others have successfully ...

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in peripheral tissues in steady state; however in response to antigen stimulation, DCs take up the antigen and rapidly migrate to the draining lymph nodes where they initiate T cell response against the antigen1,2. Additionally, DCs also play a key role in initiating autoimmune as well as allergic immune response3.
DCs play an essential role in both initiation of immune response and induction of tolerance in the setting of lung environment4. Lung environment is largely tolerogenic, owing to the exposure to vast array of environmental antigens5. However, in some individuals there is a break in tolerance, which leads to induction of allergy and asthma. In this study, we describe a strategy, which can be used to monitor airway DC maturation and migration in response to the antigen used for sensitization. The measurement of airway DC maturation and migration allows for assessment of the kinetics of immune response during airway allergic inflammation and also assists in understanding the magnitude of the subsequent immune response along with the underlying mechanisms.
Our strategy is based on the use of ovalbumin as a sensitizing agent. Ovalbumin-induced allergic asthma is a widely used model to reproduce the airway eosinophilia, pulmonary inflammation and elevated IgE levels found during asthma6,7. After sensitization, mice are challenged by intranasal delivery of FITC labeled ovalbumin, which allows for specific labeling of airway DCs which uptake ovalbumin. Next, using several DC specific markers, we can assess the maturation of these DCs and can also assess their migration to the draining lymph nodes by employing flow cytometry.

We describe a strategy to monitor maturation and migration of pulmonary dendritic cells in response to ovalbumin in the setting of ovalbumin induced allergic airway inflammation. This strategy can be modified to assess migration of pulmonary dendritic cells in settings of infection.

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in ...

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

Implant-associated infection is becoming more and more challenging to the healthcare industry worldwide due to increasing antibiotic resistance, transmission of antibiotic resistant bacteria between animals and humans, and the high cost of treating infections.
In this study, we disclose a new strategy that may be effective in preventing implant-associated infection based on the potential antimicrobial properties of platelet-rich plasma (PRP). Due to its well-studied properties for promoting healing, PRP (a biological product) has been increasingly used for clinical applications including orthopaedic surgeries, periodontal and oral surgeries, maxillofacial surgeries, plastic surgeries, sports medicine, etc.
PRP could be an advanced alternative to conventional antibiotic treatments in preventing implant-associated infections. The use of PRP may be advantageous compared to conventional antibiotic treatments since PRP is less likely to induce antibiotic resistance and PRP's antimicrobial and healing-promoting properties may have a synergistic effect on infection prevention. It is well known that pathogens and human cells are racing for implant surfaces, and PRP's properties of promoting healing could improve human cell attachment thereby reducing the odds for infection. In addition, PRP is inherently biocompatible, and safe and free from the risk of transmissible diseases.
For our study, we have selected several clinical bacterial strains that are commonly found in orthopaedic infections and examined whether PRP has in vitro antimicrobial properties against these bacteria. We have prepared PRP using a twice centrifugation approach which allows the same platelet concentration to be obtained for all samples. We have achieved consistent antimicrobial findings and found that PRP has strong in vitro antimicrobial properties against bacteria like methicillin-sensitive and methicillin-resistant Staphylococcus aureus, Group A Streptococcus, and Neisseria gonorrhoeae. Therefore, the use of PRP may have the potential to prevent infection and to reduce the need for costly post-operative treatment of implant-associated infections.

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

Implant-associated infection is a significant clinical complication. This study describes an approach using platelet-rich plasma (PRP) to prevent implant-associated infections, presents the protocol for preparing PRP with constant platelet concentration, and reports the newly identified antimicrobial properties of PRP and related protocols for examining such antimicrobial properties in vitro.

Implant-associated infection is becoming more and more challenging to the healthcare industry worldwide due to increasing antibiotic resistance, ...

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

Lentiviral vectors (LVs) are a powerful means of delivering genetic material to many types of cells. Because of safety concerns associated with these HIV-1 derived vectors, producing large quantities of LVs is challenging. In this paper, we report a method for producing high titers of self-inactivating LVs. We retrovirally transduce the tet-off stable producer cell line GPR to generate a cell line, GPRS, which can express all the viral components, including a dendritic cell-specific glycoprotein, SVGmu. Then, we use concatemeric DNA transfection to transfect the LV transfer plasmid encoding a reporter gene GFP in combination with a selectable marker. Several of the resulting clones can produce LV at a titer 10-fold greater than what we achieve with transient transfection. Plus, these viruses efficiently transduce dendritic cells in vitro and generate a strong T cell immune response to our reporter antigen. This method may be a good option for producing strong LV-based vaccines for clinical studies of cancer or infectious diseases.

Here, we use retroviral transduction and concatemeric transfection to create a cell line that can express the components of a lentiviral vector (LV) in the absence of tetracycline. This LV encodes GFP and is pseudotyped with a glycoprotein, SVGmu, which is specific for a receptor on dendritic cells.

Lentiviral  vectors (LVs) are a powerful means of delivering genetic material to many types  of cells. Because of safety concerns associated with these ...

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem cells are responsible for ensuring tissue homeostasis and repair throughout life, it is reasonable to hypothesize that the stem cell population is critical for preserving genomic integrity of tissues. Therefore, significant interest has arisen in assessing the impact of endogenous and environmental factors on genomic integrity in stem cells and their progeny, aiming to understand the etiology of stem-cell based diseases.
LacI transgenic mice carry a recoverable &#955;&#160;phage vector encoding the LacI reporter system, in which the LacI gene serves as the mutation reporter. The result of a mutated LacI gene is the production of &#946;-galactosidase that cleaves a chromogenic substrate, turning it blue. The LacI reporter system is carried in all cells, including stem/progenitor cells and can easily be recovered and used to subsequently infect E. coli. After incubating infected E. coli on agarose that contains the correct substrate, plaques can be scored; blue plaques indicate a mutant LacI gene, while clear plaques harbor wild-type. The frequency of blue (among clear) plaques indicates the mutant frequency in the original cell population the DNA was extracted from. Sequencing the mutant LacI gene will show the location of the mutations in the gene and the type of mutation.
The LacI transgenic mouse model is well-established as an in vivo mutagenesis assay. Moreover, the mice and the reagents for the assay are commercially available. Here we describe in detail how this model can be adapted to measure the frequency of spontaneously occurring DNA mutants in stem cell-enriched Lin-IL7R-Sca-1+cKit++(LSK) cells and other subpopulations of the hematopoietic system.

Here we describe an in vivo mutagenesis assay for small numbers of purified hematopoietic cells using the LacI transgenic mouse model.&#160;The LacI gene can be isolated to determine the frequency, location, and type of DNA mutants&#160;spontaneously arisen or after exposure to genotoxins.

In recent years, it has become apparent that genomic instability is tightly related to many developmental disorders, cancers, and aging. Given that stem ...

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal Peyer&#39;s patch (PP). Common dendritic cell progenitors (CDPs, lin- c-kitlo CD115+ Flt3+) were purified from the bone marrow of C57BL6 mice by FACS and transferred to recipient mice that lack a significant pDC population in PP; in this case, Ifnar-/- mice were used as the transfer recipients. In some mice, overexpression of the dendritic cell growth factor Flt3 ligand (Flt3L) was enforced prior to adoptive transfer of CDPs, using hydrodynamic gene transfer (HGT) of Flt3L-encoding plasmid. Flt3L overexpression expands DC populations originating from transferred (or endogenous) hematopoietic progenitors. At 7-10 days after progenitor transfer, pDCs that arise from the adoptively transferred progenitors were distinguished from recipient cells on the basis of CD45 marker expression, with pDCs from transferred CDPs being CD45.1+ and recipients being CD45.2+. The ability of transferred CDPs to contribute to the pDC population in PP and to respond to Flt3L was evaluated by flow cytometry of PP single cell suspensions from recipient mice. This method may be used to test whether other progenitor populations are capable of generating PP pDCs. In addition, this approach could be used to examine the role of factors that are predicted to affect pDC development in PP, by transferring progenitor subsets with an appropriate knockdown, knockout or overexpression of the putative developmental factor and/or by manipulating circulating cytokines via HGT. This method may also allow analysis of how PP pDCs affect the frequency or function of other immune subsets in PPs. A unique feature of this method is the use of Ifnar-/- mice, which show severely depleted PP pDCs relative to wild type animals, thus allowing reconstitution of PP pDCs in the absence of confounding effects from lethal irradiation.

This protocol describes experimental procedures to assess the differentiation of plasmacytoid dendritic cells in Peyer&#8217;s patch from common dendritic cell progenitors, using techniques involving FACS-mediated cell isolation, hydrodynamic gene transfer, and flow analysis of immune subsets in Peyer&#8217;s patch.

This protocol details a method to analyze the ability of purified hematopoietic progenitors to generate plasmacytoid dendritic cells (pDC) in intestinal ...

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

Neutrophils (PMN) are best known for their phagocytic functions against invading pathogens and microorganisms. They have the shortest half-life amongst leukocytes and in their non-activated state are constitutively committed to apoptosis. When recruited to inflammatory sites to resolve inflammation, they produce an array of cytotoxic molecules with potent antimicrobial killing. Yet, when these powerful cytotoxic molecules are released in an uncontrolled manner they can damage surrounding tissues. In recent years however, neutrophil versatility is increasingly evidenced, by demonstrating plasticity and immunoregulatory functions. We have recently identified a new neutrophil-derived subpopulation, which develops spontaneously in standard culture conditions without the addition of cytokines/growth factors such as granulocyte colony-stimulating factor (GM-CSF)/interleukin (IL)-4. Their phagocytic abilities of neutrophil remnants largely contribute to increase their size immensely; therefore they were termed giant phagocytes (G&#981;). Unlike neutrophils, G&#981; are long lived in culture. They express the cluster of differentiation (CD) neutrophil markers CD66b/CD63/CD15/CD11b/myeloperoxidase (MPO)/neutrophil elastase (NE), and are devoid of the monocytic lineage markers CD14/CD16/CD163 and the dendritic CD1c/CD141 markers. They also take-up latex and zymosan, and respond by oxidative burst to stimulation with opsonized-zymosan and PMA. G&#981; also express the scavenger receptors CD68/CD36, and unlike neutrophils, internalize oxidized-low density lipoprotein (oxLDL). Moreover, unlike fresh neutrophils, or cultured monocytes, they respond to oxLDL uptake by increased reactive oxygen species (ROS) production. Additionally, these phagocytes contain microtubule-associated protein-1 light chain 3B (LC3B) coated vacuoles, indicating the activation of autophagy. Using specific inhibitors it is evident that both phagocytosis and autophagy are prerequisites for their development and likely NADPH oxidase dependent ROS. We describe here a method for the preparation of this new subpopulation of long-lived, neutrophil-derived phagocytic cells in culture, their identification and their currently known characteristics. This protocol is essential for obtaining and characterizing G&#981; in order to further investigate their significance and functions.

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

We describe here a method for obtaining and identifying a newly characterized subpopulation of neutrophil-derived giant phagocytes. These cells develop in culture from fresh human blood neutrophils, and are characterized by phagocytosis, autophagy, immensely large size, and extended lifespan. This method is essential to further investigate this unique neutrophil-derived subpopulation.

Neutrophils (PMN) are best known for their phagocytic functions against invading pathogens and microorganisms. They have the shortest half-life amongst ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model offers accessibility to rare populations of antigen-specific T-cells representative of the cellular memory response as well as the cytokine microenvironment in situ.
This report describes the practical procedure of a cutaneous recall, an SB induction, and a harvest of antigen-specific T-cells. To exemplify the method, the tuberculin skin test is used for antigenic recall in individuals who, prior to this study, underwent a Bacillus Calmette-Gu&#233;rin vaccination against an infection with Mycobacterium tuberculosis. Finally, examples of multiplex and flow cytometric analyses of SB specimens are provided, illustrating high fractions of antigen-specific polyfunctional CD4+ T-cells available by this sampling method compared with cells isolated from the blood.
The method described here is safe and minimally invasive, provides a unique opportunity to study both innate and adaptive immune responses in vivo, and may be beneficial to a broad community of researchers working with cell-mediated immunity and human memory responses, in the context of vaccine development.

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Here, we provide a demonstration of the suction blister cutaneous recall model. The model allows a simple access to study human in vivo adaptive immune responses, for instance in the context of vaccine development.

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...

Simultaneous Study of the Recruitment of Monocyte Subpopulations Under Flow In Vitro

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development and autoimmune diseases. This is facilitated through a process of capture from free flow onto the luminal surface of activated endothelial cells, followed by their adhesion and transendothelial migration (transmigration) into the underlying affected tissue. However, the mechanisms that support the preferential and context-dependent recruitment of monocyte subpopulations are still not fully understood. Therefore, we have developed a method that allows the recruitment of different monocyte subpopulations to be simultaneously visualized and measured under flow. This method, based on time-lapse confocal imaging, allows for the unambiguous distinction between adherent and transmigrated monocytes. Here, we describe how this method can be used to simultaneously study the recruitment cascade of pro-angiogenic and non-angiogenic monocytes in vitro. Furthermore, this method can be extended to study the different steps of recruitment of up to three monocyte populations.

Here, we present an integrated protocol that measures monocyte subpopulation trafficking under flow in vitro by use of specific surface markers and confocal fluorescence microscopy. This protocol can be used to explore sequential recruitment steps as well as to profile other leukocyte subtypes using other specific surface markers.

The recruitment of monocytes from the blood to targeted peripheral tissues is critical to the inflammatory process during tissue injury, tumor development ...

Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro

Summary

Explore More Videos

Chapters in this video

Generation of Multivirus-specific T Cells to Prevent/treat Viral Infections after Allogeneic Hematopoietic Stem Cell Transplant

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

piggyBac Transposon System Modification of Primary Human T Cells

PRP as a New Approach to Prevent Infection: Preparation and In vitro Antimicrobial Properties of PRP

A Tetracycline-regulated Cell Line Produces High-titer Lentiviral Vectors that Specifically Target Dendritic Cells

Identifying DNA Mutations in Purified Hematopoietic Stem/Progenitor Cells

Assessing the Development of Murine Plasmacytoid Dendritic Cells in Peyer's Patches Using Adoptive Transfer of Hematopoietic Progenitors

Development and Identification of a Novel Subpopulation of Human Neutrophil-derived Giant Phagocytes In Vitro

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Simultaneous Study of the Recruitment of Monocyte Subpopulations Under Flow In Vitro