The project was funded by the National Institutes of Health (AI128406 www.nih.gov) to ZY and in part by Johnson Cancer Research Center (http://cancer.k-state.edu) in the form of Graduate Student Summer Stipend to PD.

1. Preparation of DNA Template by PCR for In Vitro Transcription
<ol>
	<li>To prepare the DNA template by PCR, design primers. When designing primers consider crucial characteristics like primer length, annealing temperature (Tm), GC content, 3&#8217; end with G or C etc. 
	NOTE: Discussed in detail in these literature25,26,27.</li>
	<li>Design primers to generate PCR amplicon containing the following elements in 5&#8217; to 3&#8217; direction: T7-Promoter, poly(A) leader, firefly luciferase ORF and a poly(A) tail referred hereafter to as T7_12A-Fluc. Design primers (Forward and Reverse) to encompass all the additional elements not present in the template DNA (Figure 2A). 
	NOTE: The sequence of all elements can be found in Table 1.</li>
	<li>Include several extra nucleotides in forward primer (5&#8217;-3&#8217;)28, followed by T7-promoter, poly(A) leader or desired 5&#8217;-UTR sequence and approximately 20 nucleotides, adjust based on Tm, corresponding to the 5&#8217; end of the reporter gene&#8217;s ORF. Ensure the corresponding region in the primer is identical to the sense strand (+ strand) of the gene. 
	NOTE: For long 5&#8217;-UTR, synthesize two DNA fragments: one with T7 promoter followed by long 5&#8217;-UTR and second with reporter gene&#8217;s ORF. Join these two fragments using overlap extension PCR29.</li>
	<li>Design reverse primer (5&#8217;-3&#8217;) to include poly(A) tail and approximately 20 nucleotides, adjust based on Tm, corresponding to the 3&#8217; end of the reporter gene&#8217;s ORF. Ensure the corresponding region in the primer is identical to the anti-sense strand (- strand) of the gene and an in-frame stop codon is present before the poly(A) tail. 
	NOTE: The desired length of A&#8217;s in a poly(A) leader or poly(A) tail can be customized in the primers. For example, to add 50 A&#8217;s in the poly(A) tail, the reverse primer should entail 50 T&#8217;s. Similarly, to add 20 A&#8217;s in the poly(A) leader, the forward primer should entail 20 A&#8217;s.</li>
	<li>For internal control, design another set of primers containing the following elements in 5&#8217; to 3&#8217; direction: T7 Promoter, a random 5&#8217;-UTR coding sequence containing Kozak sequence, Renilla luciferase ORF and poly(A) tail referred hereafter to as T7_Kozak-Rluc.</li>
	<li>In a PCR tube, add the reagents in the following order: DNase free water, 2x high-fidelity DNA polymerase, primers, and sequence confirmed luciferase template DNA (Table 2). 
	NOTE: Amounts of individual components in the mixture should be adjusted according to the reaction volume.</li>
	<li>Use a standard 3-step (Denaturation, Annealing, Extension) PCR cycle to generate a DNA template as shown in Table 3. 
	NOTE: Annealing temperature X &#176;C depends on the primer set being used and extension time T min depend on the PCR amplicon size and DNA polymerase used.</li>
	<li>Detect the PCR product by running 5-10% of PCR reaction in 1% agarose Tris-acetate-EDTA (TAE) gel electrophoresis (containing 0.1&#181;g/ml ethidium bromide) along with commercially available molecular weight standard. Visualize the gel under a UV illuminator to determine the size of the PCR product.</li>
	<li>After determining the correct size of the PCR product, ~1.7 kb for T7_12A-Fluc and ~1.0 kb for T7_Kozak-Rluc, purify it using a commercially available PCR purification kit. Elute the DNA using 100 &#181;L nuclease free water (Figure 2B).</li>
	<li>Once purified, check the concentration of the DNA using a spectrophotometer and determine the A260/A280 ratio (~1.8-2.0 is acceptable).</li>
	<li>Store purified DNA at -20 &#176;C or use for in vitro transcription immediately.</li>
</ol>
2. Generate mRNA by In Vitro Transcription
<ol>
	<li>Synthesize RNA from the PCR product in vitro, using an in vitro transcription kit (Figure 3A). 
	NOTE: T7_12A-Fluc and T7_Kozak-Rluc DNA templates are used to synthesize 12A-Fluc and Kozak-Rluc mRNAs, respectively.
	<ol>
		<li>To do this, take a microcentrifuge tube and add the reagents in the following order: DNase-RNase free water, NTP Buffer Mix, Cap Analog, Template PCR Product, T7-RNA polymerase Mix (Table 4). 
		NOTE: Other capping systems can also be used to cap RNA sequentially after in vitro transcription following the manufacturer&#8217;s instruction.</li>
		<li>Mix thoroughly and incubate at 37 &#176;C for 2 h.</li>
		<li>Proceed to the purification of the synthesized RNA using an RNA purification kit.</li>
	</ol>
	</li>
	<li>Run purified RNA in 1.5% agarose Tris-borate-EDTA (TBE) gel (containing 0.5 &#181;g/mL ethidium bromide) to check the RNA. Visualize the gel under a UV illuminator (Figure 3B).</li>
	<li>Check the concentration of the RNA using a spectrophotometer and determine the A260/A280 ratio (~1.8-2.0 is acceptable).</li>
	<li>Aliquot the purified RNA and store at -80 &#176;C.</li>
</ol>
3. Transfect mRNA to Cells
<ol>
	<li>Seed HeLa cells in a 24-well plate (to be approx. ~80-90% confluent next day) and incubate overnight in an incubator at 37 &#176;C with 5% CO2.</li>
	<li>Infect HeLa cells with vaccinia virus (VACV) at a Multiplicity of Infection (MOI) of 5 or keep uninfected HeLa cells for comparison. 
	NOTE: MOI is the number of infectious viral particles per cell.</li>
	<li>MOI of X= {[(Number of cells * X) / Virus Titer] * 1000} &#181;l of virus per 1 mL medium.</li>
	<li>After desired h post infection (hpi) (in this experiment at 10-12 hpi), transfect mRNA (500 ng of total mRNA per well of 24-well plates) using a cationic lipid transfection reagent as shown in Figure 3C.
	<ol>
		<li>For one well of a 24-well plate, mix 480 ng of 12A sequence bearing firefly luciferase (12A-Fluc) mRNA and 20 ng of Kozak sequence bearing Renilla luciferase (Kozak-Rluc) mRNA in one microcentrifuge tube. In another microcentrifuge tube add 1.1 &#181;L of cationic lipid transfection reagent.</li>
		<li>Add 55 &#181;L of reduced serum medium in both tubes. Mix and incubate at room temperature for 5 min.</li>
		<li>After 5 min of incubation, add 55 &#181;L cationic lipid transfection reagent containing reduced serum medium in mRNA containing tube.</li>
		<li>Mix gently but thoroughly, and incubate at room temperature for 15 min.</li>
		<li>During the incubation, remove the cell culture medium and add 400 &#181;L of reduced serum medium per well of 24-well plates.</li>
		<li>After incubation, add 100 &#181;L of the mixture dropwise and evenly to one well of 24-well plates.</li>
	</ol>
	</li>
</ol>
4. Measure Luciferase Activities
<ol>
	<li>Five-hours post-co-transfection of 12A-Fluc and Kozak-Rluc mRNA, measure luciferase activity using a luciferase assay system capable of performing two reporter assays (e.g., Dual Luciferase Reporter assay kit).</li>
	<li>Remove the reduced serum medium and lyse the cells by adding 150 &#181;L 1x lysis buffer, a component of the luciferase assay kit.</li>
	<li>After 10 min incubation at room temperature, collect the lysate by scrapping the cells and transfer to a microcentrifuge tube.</li>
	<li>Centrifuge the lysate at 12,000 x g for 10 min at 4 &#176;C to pellet cell debris.</li>
	<li>Add 30 &#181;L of supernatant in opaque-walled 96 well white assay plate with a solid bottom.</li>
	<li>Measure the dual luminescence using the luciferase assay kit and a multimode plate reader luminometer.</li>
	<li>Perform the measurement using kinetics function (on a per-well basis) using the settings described in Table 5. 
	NOTE: The reading can also be taken using manual luminometer. Add an equal volume of lysate and substrate for Fluc in a cuvette. Wait for 2 s and measure for 10 s using luminometer. Following Fluc measurement, quickly take out cuvette from luminometer and add an equal volume of the substrate for Rluc manually. Again, wait for 2 s and measure for 10 s using luminometer.</li>
	<li>Export the luminescence reading data into a desirable file format.</li>
	<li>Determine relative translation rate from 12A-Fluc mRNA in uninfected and VACV infected HeLa cells by dividing Fluc value by internal control Rluc value. 
	NOTE: Supplementary Figure 1 shows the step-by-step analysis of raw data to get relative Fluc activity.</li>
</ol>

<ol>
	<li>Crick, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+protein+synthesis.">On protein synthesis.</a> Symposia of the Society for Experimental Biology. 12, 138-163 (1958).</li><li>Crick, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+Dogma+of+Molecular+Biology.">Central Dogma of Molecular Biology.</a> Nature. 227, 561-563 (1970).</li><li>Sonenberg, N., Hinnebusch, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+Translation+Initiation+in+Eukaryotes:+Mechanisms+and+Biological+Targets.">Regulation of Translation Initiation in Eukaryotes: Mechanisms and Biological Targets.</a> Cell. 136, 731-745 (2009).</li><li>Spriggs, K. A., Bushell, M., Willis, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+Regulation+of+Gene+Expression+during+Conditions+of+Cell+Stress.">Translational Regulation of Gene Expression during Conditions of Cell Stress.</a> Molecular Cell. 40, 228-237 (2010).</li><li>Shchelkunov, S. N., Marennikova, S. S., Moyer, R. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthopoxviruses Pathogenic for Humans. , (2005).</li><li>Gale, M., Tan, S. L., Katze, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+Control+of+Viral+Gene+Expression+in+Eukaryotes.">Translational Control of Viral Gene Expression in Eukaryotes.</a> Microbiology and Molecular Biology Reviews. 64, 239-280 (2000).</li><li>Walsh, D., Mathews, M. B., Mohr, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tinkering+with+Translation:+Protein+Synthesis+in+Virus-Infected+Cells.">Tinkering with Translation: Protein Synthesis in Virus-Infected Cells.</a> Cold Spring Harbor Perspectives in Biology. 5, a012351 (2013).</li><li>Cao, S., Dhungel, P., Yang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Going+against+the+Tide:+Selective+Cellular+Protein+Synthesis+during+Virally+Induced+Host+Shutoff.">Going against the Tide: Selective Cellular Protein Synthesis during Virally Induced Host Shutoff.</a> Journal of Virology. 91, e00071-e00017 (2017).</li><li>Pelletier, J., Kaplan, G., Racaniello, V. R., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-independent+translation+of+poliovirus+mRNA+is+conferred+by+sequence+elements+within+the+5&#8217;+noncoding+region.">Cap-independent translation of poliovirus mRNA is conferred by sequence elements within the 5&#8217; noncoding region.</a> Molecular and Cellular Biology. 8, 1103-1112 (1988).</li><li>Pelletier, J., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Internal+initiation+of+translation+of+eukaryotic+mRNA+directed+by+a+sequence+derived+from+poliovirus+RNA.">Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA.</a> Nature. 334, 320-325 (1988).</li><li>Guo, L., Allen, E., Miller, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure+and+function+of+a+cap-independent+translation+element+that+functions+in+either+the+3&#8242;+or+the+5&#8242;+untranslated+region.">Structure and function of a cap-independent translation element that functions in either the 3&#8242; or the 5&#8242; untranslated region.</a> RNA. 6, 1808-1820 (2000).</li><li>Simon, A. E., Miller, W. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3&#8242;+Cap-Independent+Translation+Enhancers+of+Plant+Viruses.">3&#8242; Cap-Independent Translation Enhancers of Plant Viruses.</a> Annual Review of Microbiology. 67, 21-42 (2013).</li><li>Marom, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+poly(A)+binding+proteins+mediate+internal+translational+initiation+by+a+plant+viral+IRES.">Diverse poly(A) binding proteins mediate internal translational initiation by a plant viral IRES.</a> RNA Biology. 6, 446-454 (2009).</li><li>Liu, B., Qian, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+reprogramming+in+cellular+stress+response.">Translational reprogramming in cellular stress response.</a> Wiley Interdisciplinary Review. RNA. 5, 301-305 (2014).</li><li>Ahn, B. Y., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capped+poly(A)+leaders+of+variable+lengths+at+the+5&#8217;+ends+of+vaccinia+virus+late+mRNAs.">Capped poly(A) leaders of variable lengths at the 5&#8217; ends of vaccinia virus late mRNAs.</a> Journal of Virology. 63, 226-232 (1989).</li><li>Ahn, B. Y., Jones, E. V., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+the+vaccinia+virus+gene+encoding+an+18-kilodalton+subunit+of+RNA+polymerase+and+demonstration+of+a+5&#8217;+poly(A)+leader+on+its+early+transcript.">Identification of the vaccinia virus gene encoding an 18-kilodalton subunit of RNA polymerase and demonstration of a 5&#8217; poly(A) leader on its early transcript.</a> Journal of Virology. 64, 3019-3024 (1990).</li><li>Schwer, B., Visca, P., Vos, J. C., Stunnenberg, H. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discontinuous+transcription+or+RNA+processing+of+vaccinia+virus+late+messengers+results+in+a+5&#8242;+poly(A)+leader.">Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5&#8242; poly(A) leader.</a> Cell. 50, 163-169 (1987).</li><li>Yang, Z., Martens, C. A., Bruno, D. P., Porcella, S. F., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+initiation+and+3&#8242;+end+formation+of+poxvirus+post-replicative+RNAs.">Pervasive initiation and 3&#8242; end formation of poxvirus post-replicative RNAs.</a> Journal of Biological Chemistry. 287, 31050-31060 (2012).</li><li>Dhungel, P., Cao, S., Yang, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+5&#8217;-poly(A)+leader+of+poxvirus+mRNA+confers+a+translational+advantage+that+can+be+achieved+in+cells+with+impaired+cap-dependent+translation.">The 5&#8217;-poly(A) leader of poxvirus mRNA confers a translational advantage that can be achieved in cells with impaired cap-dependent translation.</a> PLOS Pathogens. 13, e1006602 (2017).</li><li>Jha, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trans-kingdom+mimicry+underlies+ribosome+customization+by+a+poxvirus+kinase.">Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase.</a> Nature. 546, 651-655 (2017).</li><li>Dai, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosome+Profiling+Reveals+Translational+Upregulation+of+Cellular+Oxidative+Phosphorylation+mRNAs+during+Vaccinia+Virus-Induced+Host+Shutoff.">Ribosome Profiling Reveals Translational Upregulation of Cellular Oxidative Phosphorylation mRNAs during Vaccinia Virus-Induced Host Shutoff.</a> Journal of Virology. 91, e01858-e01816 (2017).</li><li>De Silva, F. S., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Origin-independent+plasmid+replication+occurs+in+vaccinia+virus+cytoplasmic+factories+and+requires+all+five+known+poxvirus+replication+factors.">Origin-independent plasmid replication occurs in vaccinia virus cytoplasmic factories and requires all five known poxvirus replication factors.</a> Journal of Virology. 2, 23 (2005).</li><li>Yang, Z., Bruno, D. P., Martens, C. A., Porcella, S. F., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+high-resolution+analysis+of+vaccinia+virus+and+host+cell+transcriptomes+by+deep+RNA+sequencing.">Simultaneous high-resolution analysis of vaccinia virus and host cell transcriptomes by deep RNA sequencing.</a> Proceedings of the National Academy of Sciences. 107, 11513-11518 (2010).</li><li>Yang, Z., Bruno, D. P., Martens, C. A., Porcella, S. F., Moss, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-Wide+Analysis+of+the+5&#8242;+and+3&#8242;+Ends+of+Vaccinia+Virus+Early+mRNAs+Delineates+Regulatory+Sequences+of+Annotated+and+Anomalous+Transcripts.">Genome-Wide Analysis of the 5&#8242; and 3&#8242; Ends of Vaccinia Virus Early mRNAs Delineates Regulatory Sequences of Annotated and Anomalous Transcripts.</a> Journal of Virology. 85, 5897-5909 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+Chain+Reaction:+Basic+Protocol+Plus+Troubleshooting+and+Optimization+Strategies.">Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies.</a> Journal of Visualized Experiments. , (2012).</li><li>Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+concepts+for+PCR+primer+design.">General concepts for PCR primer design.</a> PCR Methods and Applications. 3, S30-S37 (1993).</li><li>Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> PCR Protocols: A Guide to Methods and Applications. , (2012).</li><li>Baklanov, M. M., Golikova, L. N., Malygin, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+on+DNA+Transcription+of+Nucleotide+Sequences+Upstream+to+T7+Promoter.">Effect on DNA Transcription of Nucleotide Sequences Upstream to T7 Promoter.</a> Nucleic Acids Research. 24, 3659-3660 (1996).</li><li>Thornton, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Splicing+by+Overlap+Extension+PCR+to+Obtain+Hybrid+DNA+Products.">Splicing by Overlap Extension PCR to Obtain Hybrid DNA Products.</a> The Genetic Manipulation of Staphylococci: Methods and Protocols. , 43-49 (2017).</li><li>Akichika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-specific+terminal+N6-methylation+of+RNA+by+an+RNA+polymerase+II&#8211;associated+methyltransferase.">Cap-specific terminal N6-methylation of RNA by an RNA polymerase II&#8211;associated methyltransferase.</a> Science. , (2018).</li><li>Sun, H., Zhang, M., Li, K., Bai, D., Yi, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-specific,+terminal+N6-methylation+by+a+mammalian+m6Am+methyltransferase.">Cap-specific, terminal N6-methylation by a mammalian m6Am methyltransferase.</a> Cell Research. 1, (2018).</li><li>Boulias, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+the+m6Am+methyltransferase+PCIF1+reveals+the+location+and+functions+of+m6Am+in+the+transcriptome.">Identification of the m6Am methyltransferase PCIF1 reveals the location and functions of m6Am in the transcriptome.</a> bioRxiv. , 485862 (2018).</li><li>Dominissini, D., Rechavi, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N4-acetylation+of+Cytidine+in+mRNA+by+NAT10+Regulates+Stability+and+Translation.">N4-acetylation of Cytidine in mRNA by NAT10 Regulates Stability and Translation.</a> Cell. 175, 1725-1727 (2018).</li><li>Wei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+m6A,+m6Am,+and+m1A+Demethylation+Mediated+by+FTO+in+the+Cell+Nucleus+and+Cytoplasm.">Differential m6A, m6Am, and m1A Demethylation Mediated by FTO in the Cell Nucleus and Cytoplasm.</a> Molecular Cell. 71, 973-985 (2018).</li><li>Fu, Y., Dominissini, D., Rechavi, G., He, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+regulation+mediated+through+reversible+m6A+RNA+methylation.">Gene expression regulation mediated through reversible m6A RNA methylation.</a> Nature Reviews Genetics. 15, 293-306 (2014).</li></ol>

The authors would like to declare no competing financial interest.

All four-core steps are critical to the success of the in vitro transcribed RNA-based luciferase reporter assay. Special attention should be given to primer design, especially for the T7 promoter sequence. T7 RNA polymerase starts transcription from the underlined first G (GGG-5&#39;-UTR-AUG-) in T7 promoter added before the 5&#39;-UTR sequence. Although the transcription start site (TSS) starts from the first G at the 5&#39; end, decreasing the number of G&#39;s less than three in T7 promoter region decreased the RNA yield/output from in vitro transcription. During the experiment, we observed that gel purified DNA product was not the best for in vitro transcription as both yield and quality of RNA were lower. We only ran 5-10% of the PCR reaction in 1% agarose gel electrophoresis to determine the size and purified the rest 90-95%, using a PCR purification kit, to be used for in vitro transcription. In the case of non-specific amplification from PCR, cutting the desired sized band from gel and using gel-purified DNA fragment is recommended. As the yield might be low, we suggest increasing the reaction volume for the in vitro transcription reaction. Similar to other transfection-based methods, DNA/RNA may stimulate DNA/RNA sensing pathways that may globally or selectively suppress translation. Therefore, data should be interpreted with cautions, although we did not experience problems potentially caused by this issue in our experiments.
The proposed method is suitable for use in different model systems with some modifications like the method of mRNA delivery, internal control to be used, a suitable time for translation, sample preparation and analysis of data. The main limitation of this method is that it is a reporter assay to quickly test translation regulation by cis elements that do not completely reflect physiological conditions. Therefore, this method should be corroborated by other complementary experiments, if possible.
Compared to DNA modification, the roles of RNA modifications are less well understood. However, with the discovery of enzymes that write, read and erase RNA modifications30,31,32,33,34,35, it is now possible to study the influence of RNA modification in gene expression30,31,32,33,34,35. The in vitro transcribed RNA-based luciferase reporter assay may be modified to incorporate different RNA modifications and used to test their effects on RNA translation. For example, this method can incorporate different cap analogs that have various modifications30,31. Additionally, supplementing an internal RNA modifying enzyme during or after in vitro transcription can possibly incorporate internal RNA modification. Addition of a modification to cap 0, cap 1, and an internal RNA modification will provide a tool to study the roles of these RNA modifications in translation.
The in vitro transcribed RNA-based luciferase reporter assay has great potential and broad application in understanding basic biology about RNA translation. Different mechanisms for the initiation of translation, including cap-dependent initiation, cap-independent initiation, re-initiation and internal initiation such as IRES can be studied using this method. On top of these advantages, this assay can be employed to test translation regulation by cis-elements at 5&#39;-UTR and 3&#39;-UTR in an mRNA. The described protocol uses the PCR product, which provides the advantage to avoid lengthy cloning and quickly examine the effects of RNA elements on translation. To minimize potential errors during PCR, high fidelity polymerase and low PCR cycle number should be used. Alternatively, if a template is used frequently, the desired 5-&#39;UTR and luciferase ORF can be cloned into a plasmid as the template of in vitro transcription. Together, the protocol consolidates transcription and mRNA capping in a single reaction and utilizes conventional transfection and analysis that make in vitro transcribed RNA-based luciferase reporter assay a user-friendly, quick, and straightforward method to study mechanisms of mRNA translation.

According to the central dogma, genetic information flows from DNA to RNA and then finally to protein1,2. This flow of genetic information is highly regulated at many levels including mRNA translation3,4. Development of reporter assays to measure regulation of gene expression will facilitate understanding of regulatory mechanisms involved in this process. Here we describe a protocol to study mRNA translation using an in vitro transcribed RNA-based luciferase reporter assay in poxvirus-infected cells.
Poxviruses comprise many highly dangerous human and animal pathogens5. Like all other viruses, poxviruses exclusively rely on host cell machinery for protein synthesis6,7,8. To efficiently synthesize viral proteins, viruses evolved many strategies to hijack cellular translational machinery to redirect it for translation of viral mRNAs7,8. One commonly employed mechanism by viruses is to use cis-acting elements in their transcripts. Notable examples include the Internal Ribosome Entry Site (IRES) and cap-independent translation enhancer (CITE)9,10,11. These cis-elements render the viral transcripts a translational advantage by attracting translational machinery via diverse mechanisms12,13,14. Over 100 poxvirus mRNAs have an evolutionarily conserved cis-acting element in the 5&#8217;-untranslated region (5&#8217;-UTR): a 5&#8217;-poly(A) leader at the very 5&#8217; ends of these mRNAs15,16. The lengths of these 5&#8217;-poly(A) leaders are heterogeneous and are generated by slippage of the poxvirus-encoded RNA polymerase during transcription17,18. We, and others, recently discovered that the 5&#8217;-poly(A) leader confers a translation advantage to an mRNA in cells infected with vaccinia virus (VACV), the prototypic member of poxviruses19,20.
The in vitro transcribed RNA-based luciferase reporter assay was initially developed to understand the role of 5&#8217;-poly(A) leader in mRNA translation during poxvirus infection19,21. Although plasmid DNA-based luciferase reporter assays have been widely used, there are several drawbacks that will complicate the result interpretation in poxvirus-infected cells. First, plasmids are able to replicate in VACV-infected cells22. Second, cryptic transcription often occurs from plasmid DNA18,23,24. Third, VACV promoter-driven transcription generates poly(A)-leader of heterogeneous lengths consequently making it difficult to control the poly(A)-leader length in some experiments18. An in vitro transcribed RNA-based luciferase reporter assay circumvents these issues and the data interpretation is straightforward.
There are four key steps in this method: (1) polymerase chain reaction (PCR) to generate the DNA template for in vitro transcription; (2) in vitro transcription to generate mRNA; (3) transfection to deliver mRNA into cells; and (4) detection of luciferase activity as indicator of translation (Figure 1). The resulting PCR amplicon contains the following elements in 5&#8217; to 3&#8217; direction: T7-Promoter, poly(A) leader or desired 5&#8217;-UTR sequence, firefly luciferase open reading frame (ORF) followed by a poly(A) tail. PCR amplicon is used as the template to synthesize mRNA by in vitro transcription using T7 polymerase. During in vitro transcription, m7G cap or other cap analog is incorporated in newly synthesized mRNA. The capped transcripts are transfected into uninfected or VACV-infected cells. The cell lysate is collected at the desired time after transfection to measure luciferase activities that indicate protein production from transfected mRNA. This reporter assay can be used to study translation regulation by cis-element present in 5&#8217;-UTR, 3&#8217;-UTR or other regions of an mRNA. Furthermore, the in vitro transcribed RNA-based assay can be used to study different mechanisms of translation initiation including cap-dependent initiation, cap-independent initiation, re-initiation and internal initiation like IRES.

<table>
	<tbody>
		<tr>
			<td>2X-Q5 Master mix</td>
			<td>New England Biolabs</td>
			<td>M0492</td>
			<td>High-Fidelity DNA Polymerase used in PCR</td>
		</tr>
		<tr>
			<td>3&#180;-O-Me-m7G(5&#39;)ppp(5&#39;)G RNA Cap Structure Analog</td>
			<td>New England Biolabs</td>
			<td>S1411L</td>
			<td>Anti reverse Cap analog or ARCA</td>
		</tr>
		<tr>
			<td>Corning 96 Well Half-Area white flat bottom polystyrene microplate</td>
			<td>Corning</td>
			<td>3693</td>
			<td>Opaque walled 96 well white plate with solid bottom</td>
		</tr>
		<tr>
			<td>Dual-Luciferase Reporter Assay System</td>
			<td>Promega</td>
			<td>E1960</td>
			<td>Dual-Luciferase Assay Kit (DLAK)</td>
		</tr>
		<tr>
			<td>E.Z.N.A. Cycle Pure Kit</td>
			<td>OMEGA BIO-TEK</td>
			<td>D6492</td>
			<td>PCR purification kit</td>
		</tr>
		<tr>
			<td>GloMax Navigator Microplate Luminometer</td>
			<td>Promega</td>
			<td>GM2010</td>
			<td>Referred as multimode plate reader luminometer</td>
		</tr>
		<tr>
			<td>HiScribe T7 Quick High Yield RNA synthesis Kit</td>
			<td>New England Biolabs</td>
			<td>E2050S</td>
			<td>In-Vitro transcription kit</td>
		</tr>
		<tr>
			<td>Lipofectamine 2000</td>
			<td>Thermo Fisher Scientific</td>
			<td>11668019</td>
			<td>Cationic lipid transfection reagent</td>
		</tr>
		<tr>
			<td>NanoDrop2000</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-2000</td>
			<td>Used to measure DNA and RNA concentration</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Thermo Fisher Scientific</td>
			<td>31985070</td>
			<td>Reduced serum media</td>
		</tr>
		<tr>
			<td>Purelink RNA Mini Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>12183018A</td>
			<td>RNA purification kit</td>
		</tr>
		<tr>
			<td>Vaccinia Capping System</td>
			<td>New England Biolabs</td>
			<td>M2080</td>
			<td>Capping system</td>
		</tr>
	</tbody>
</table>

in vitro transcribed rna-based luciferase reporter assay to study translation regulation in poxvirus-infected cells

Every poxvirus mRNA transcribed after viral DNA replication has an evolutionarily conserved, non-templated 5&#39;-poly(A) leader in the 5&#39;-UTR. To dissect the role of 5&#39;-poly(A) leader in mRNA translation during poxvirus infection we developed an in vitro transcribed RNA-based luciferase reporter assay. This reporter assay comprises of four core steps: (1) PCR to amplify the DNA template for in vitro transcription; (2) in vitro transcription to generate mRNA using T7 RNA polymerase; (3) Transfection to introduce in vitro transcribed mRNA into cells; (4) Detection of luciferase activity as the indicator of translation. The RNA-based luciferase reporter assay described here circumvents issues of plasmid replication in poxvirus-infected cells and cryptic transcription from the plasmid. This protocol can be used to determine translation regulation by cis-elements in an mRNA including 5&#39;-UTR and 3&#39;-UTR in systems other than poxvirus-infected cells. Moreover, different modes of translation initiation like cap-dependent, cap-independent, re-initiation, and internal initiation can be investigated using this method.

The four steps of in vitro transcribed RNA-based luciferase reporter assay: PCR to generate DNA template for In vitro transcription, in vitro transcription to generate mRNA, mRNA transfection, and luciferase measurement, can be seen in the schematic diagram (Figure 1). Designing of primers for both DNA templates (Fluc and Rluc) and the general scheme of overhang extension PCR is illustrated in the schematic (Figure 2A). After PCR, the correct sized PCR product was detected by TAE agarose gel electrophoresis (Figure 2B). Subsequently, the PCR product is used as the template to synthesize RNA in vitro (Figure 3A), which is purified and run in TBE gel electrophoresis to verify the size (Figure 3B). The purified and verified mRNA is transfected into cells using cationic lipid transfection reagent (Figure 3C). Primers used in this protocol are listed in Table 6.
The in vitro transcribed RNA-based luciferase reporter assay was developed to understand the role of 5&#39;-poly(A) leader in mRNA translation during poxvirus infection. Using this assay, we tested the translation efficiency of a Fluc mRNA that contains a 5&#39;-poly(A) leader (12 nt) in uninfected and VACV-infected cells. The Fluc value was normalized using Rluc value in both uninfected and VACV-infected cells to determine the relative Fluc activity (i.e. Fluc activity/Rluc activity) (Figure 4A). The division of Fluc by Rluc normalized the transfection efficiency and RNA stability in a particular well. Using this analysis approach, we determined that a 5&#39;-poly(A) leader containing mRNA has a translational advantage during VACV infection (Figure 4B). The advantage in infected cells was not due to differential transfection efficiency or mRNA stability as the RNA level was similar in uninfected and VACV infected cells 5 h post mRNA transfection19.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59626/59626fig1.jpg" /> 
Figure 1: Schematic of the experimental procedure. PCR is used to generate a DNA template with the desired elements. mRNA encoding a luciferase reporter gene is synthesized in vitro using a T7 RNA polymerase-based system. A Firefly luciferase (Fluc) mRNA is co-transfected with a Renilla luciferase (Rluc) mRNA into uninfected or VACV-infected cells. Luciferase activities are measured using a luminometer with dual luciferase capability. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59626/59626fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59626/59626fig2.jpg" /> 
Figure 2: Primer design and PCR-based DNA amplification. (A) The forward primer is synthesized to include an 8nt random sequence, T7 promoter followed by a desired 5&#39;-UTR and part of the 5&#39; end of the luciferase reporter gene, while the reverse primer includes a T-tract to generate poly(A) tail and the 3&#39; end of the luciferase reporter gene. By overhang extension PCR using a plasmid template containing a luciferase gene, a DNA template is generated. (B) DNA band of the desired size from PCR reaction was detected using 1% agarose TAE gel electrophoresis. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59626/59626fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59626/59626fig3.jpg" /> 
Figure 3: mRNA synthesis and transfection. (A) Schematic of in vitro transcription. DNA amplified by PCR containing the luciferase gene downstream from the 5&#39;-UTR of interest and the T7 promoter is used as the template. The T7 RNA polymerase is recruited to the promoter and adds ribonucleotides, shown in white, from 5&#39; to 3&#39; direction. Once mRNA is 25-30 nt long, m7G cap is added using an anti-reverse cap analog, ARCA. (B) RNA bands from in vitro transcription ware detected using 1.5% agarose TBE gel electrophoresis. (C) Schematic demonstrating the transfection of reporter mRNA into cells. Medium containing either the reporter mRNA or cationic lipid transfection reagent in separate tubes is allowed to equilibrate at room temperature for 5 min. The solutions are then mixed followed by incubation at room temperature for 15 min after which the RNA/transfection reagent mixture is added into cells in culture plates. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59626/59626fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59626/59626fig4.jpg" /> 
Figure 4: Increased translational efficiency of mRNA containing a 5&#39;-poly(A) leader. (A) Fluc mRNA containing a poly(A) leader in the 5&#39;-UTR and Rluc mRNA with the Kozak consensus sequence in the 5&#39;-UTR are co-transfected into cells. (B) Fluc mRNA with 5&#39;-poly(A) leader was transfected in uninfected and VACV-infected cells along with Rluc mRNA. 5 hpi, luciferase activity was measured using a luminometer. Rluc normalized Fluc activity is represented in uninfected and VACV-infected cells. Error bars indicate the standard deviations (SD) of at least three repeats. Student&#39;s t-test was used to determine P-values; ***P-value &#60; 0.001. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59626/59626fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Elements</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>T7 Promoter</td>
			<td>TAATACGACTCACTATAGGG</td>
		</tr>
		<tr>
			<td>Poly(A) leader</td>
			<td>AAAAAAAAAAAA, ranging from 3 to 51 As</td>
		</tr>
		<tr>
			<td>Kozak sequence</td>
			<td>GCCACC</td>
		</tr>
		<tr>
			<td>Poly(A) tail</td>
			<td>AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA&#8230;&#8230;</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences used in the method&#160;&#8211;&#160;the table contains the sequences of the T7 promoter, poly(A) leader, Kozak sequence, poly(A) tail.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components</td>
			<td>Volume</td>
		</tr>
		<tr>
			<td>DNase free water:</td>
			<td>38 &#181;L</td>
		</tr>
		<tr>
			<td>2X High-fidelity DNA polymerase Master mix:</td>
			<td>50 &#181;L</td>
		</tr>
		<tr>
			<td>Forward Primer (10 &#181;M):</td>
			<td>4 &#181;l</td>
		</tr>
		<tr>
			<td>Reverse Primer (10 &#181;M):</td>
			<td>4 &#181;l</td>
		</tr>
		<tr>
			<td>Luciferase DNA Template (1-10 ng/&#181;L):</td>
			<td>4 &#181;l</td>
		</tr>
		<tr>
			<td>Total: </td>
			<td>100 &#181;L</td>
		</tr>
		<tr>
			<td>Source for Fluc DNA template is pGL3-Fluc plasmid</td>
			<td></td>
		</tr>
		<tr>
			<td>Source for Rluc DNA template is pRL-Rluc plasmid</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: PCR reaction &#8211;&#160;the order and the volume of components added in the PCR reaction.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Time </td>
			<td>Cycle</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>95 &#176;C</td>
			<td>2 min</td>
			<td>(1x Cycle)</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95 &#176;C:</td>
			<td>15 s</td>
			<td></td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>X &#176;C:</td>
			<td>30 s</td>
			<td>(25x Cycle)</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C:</td>
			<td>T min</td>
			<td></td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>72 &#176;C:</td>
			<td>7 min</td>
			<td>(1x Cycle)</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4 &#176;C:</td>
			<td>&#8734;</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 3: PCR Program&#160;&#8211; the steps for PCR program along with temperature, time and cycle.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Components</td>
			<td>Volume</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase-RNase free water:</td>
			<td>up to 20 &#181;L</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP Buffer Mix (20 mM of each rNTP):</td>
			<td>2 &#181;L</td>
			<td></td>
		</tr>
		<tr>
			<td>Cap Analog (40 mM):</td>
			<td>4 &#181;L</td>
			<td></td>
		</tr>
		<tr>
			<td>Template PCR Product (400 ng)*:</td>
			<td>X &#181;L</td>
			<td>(PCR Product Concentration dependent)</td>
		</tr>
		<tr>
			<td>T7-RNA polymerase Mix:</td>
			<td>2 &#181;L</td>
			<td></td>
		</tr>
		<tr>
			<td>Total: </td>
			<td>20 &#181;L</td>
			<td></td>
		</tr>
		<tr>
			<td>*T7_12A-Fluc and T7_Kozak-Rluc template used to synthesize 12A-Fluc and Kozak-Rluc mRNA, respectively.</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4: In vitro transcription reaction&#160;&#8211; the order and the volume of components added for in vitro transcription reaction.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Volume/Time</td>
		</tr>
		<tr>
			<td>Inject Luciferase Assay Substrate (Fluc):</td>
			<td>30 &#181;L</td>
		</tr>
		<tr>
			<td>Wait / Incubation time:</td>
			<td>2 s</td>
		</tr>
		<tr>
			<td>Luminescence Measurement (Fluc):</td>
			<td>10 s</td>
		</tr>
		<tr>
			<td>Stop &#38; Glo Substrate (Rluc):</td>
			<td>30 &#181;L</td>
		</tr>
		<tr>
			<td>Wait / Incubation time:</td>
			<td>2 s</td>
		</tr>
		<tr>
			<td>Luminescence Measurement (Rluc):</td>
			<td>10 s</td>
		</tr>
	</tbody>
</table>
Table 5: Luciferase Measurement Settings&#160;&#8211; the steps for luciferase measurement with the recommended volume or time.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>T7-12A-Fluc Forward</td>
			<td>ATCGACGATAATACGACTCACTATAGGGaaaaaaaaaaaa 
			ATGGAAGACGCCAAAAACATAAAG</td>
		</tr>
		<tr>
			<td>T7-12A-Fluc Reverse</td>
			<td>TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACACGGCGATCTTTCCGC</td>
		</tr>
		<tr>
			<td>T7-Kozak-Rluc Forward</td>
			<td>ATCGACGATAATACGACTCACTATAGGGatcgtagccacc 
			ATGACTTCGAAAGTTTATGATC</td>
		</tr>
		<tr>
			<td>T7-Kozak-Rluc Reverse</td>
			<td>TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATTGTTCATTTTT 
			GAGAACTCGCTC</td>
		</tr>
	</tbody>
</table>
Table 6: Primers&#160;&#8211;&#160;the primers used in this method with complete sequences.
Supplementary Figure 1: Analysis of raw data&#160;&#8211; steps for analyzing raw data to get normalized data. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59626/Supplementary_Figure_1.pdf">Please click here to download this file.</a>

Watch this Scientific Journal Video about In Vitro Transcribed RNA-based Luciferase Reporter Assay to Study Translation Regulation in Poxvirus-infected Cells at JoVE.com

In Vitro Transcribed RNA-based Luciferase Reporter Assay to Study Translation Regulation in Poxvirus-infected Cells

We present a protocol to study mRNA translation regulation in poxvirus-infected cells using in vitro Transcribed RNA-based luciferase reporter assay. The assay can be used for studying translation regulation by cis-elements of an mRNA, including 5&#8217;-untranslated region (UTR) and 3&#8217;-UTR. Different translation initiation modes can also be examined using this method.

Every poxvirus mRNA transcribed after viral DNA replication has an evolutionarily conserved, non-templated 5&#39;-poly(A) leader in the 5&#39;-UTR. To ...

in-vitro-transcribed-rna-based-luciferase-reporter-assay-to-study

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Cell Biology

Immunology and Infection

Unit 1

Translation: RNA to Protein

SCIENTISTS IN ACTION

14.7K Views.  Kansas State University. We present a protocol to study mRNA translation regulation in poxvirus-infected cells using in vitro Transcribed RNA-based luciferase reporter assay. The assay can be used for studying translation regulation by cis-elements of an mRNA, including 5’-untranslated region (UTR) and 3’-UTR. Different translation initiation modes can also be examined using this method.

Video: In Vitro Transcribed RNA-based Luciferase Reporter Assay to Study Translation Regulation in Poxvirus-infected Cells

Using Luciferase to Image Bacterial Infections in Mice

Imaging is a valuable technique that can be used to monitor biological processes. In particular, the presence of cancer cells, stem cells, specific immune cell types, viral pathogens, parasites and bacteria can be followed in real-time within living animals 1-2. Application of bioluminescence imaging to the study of pathogens has advantages as compared to conventional strategies for analysis of infections in animal models3-4. Infections can be visualized within individual animals over time, without requiring euthanasia to determine the location and quantity of the pathogen. Optical imaging allows comprehensive examination of all tissues and organs, rather than sampling of sites previously known to be infected. In addition, the accuracy of inoculation into specific tissues can be directly determined prior to carrying forward animals that were unsuccessfully inoculated throughout the entire experiment. Variability between animals can be controlled for, since imaging allows each animal to be followed individually. Imaging has the potential to greatly reduce animal numbers needed because of the ability to obtain data from numerous time points without having to sample tissues to determine pathogen load3-4.
This protocol describes methods to visualize infections in live animals using bioluminescence imaging for recombinant strains of bacteria expressing luciferase. The click beetle (CBRLuc) and firefly luciferases (FFluc) utilize luciferin as a substrate5-6. The light produced by both CBRluc and FFluc has a broad wavelength from 500 nm to 700 nm, making these luciferases excellent reporters for the optical imaging in living animal models7-9. This is primarily because wavelengths of light greater than 600 nm are required to avoid absorption by hemoglobin and, thus, travel through mammalian tissue efficiently. Luciferase is genetically introduced into the bacteria to produce light signal10. Mice are pulmonary inoculated with bioluminescent bacteria intratracheally to allow monitoring of infections in real time. After luciferin injection, images are acquired using the IVIS Imaging System. During imaging, mice are anesthetized with isoflurane using an XGI-8 Gas Anethesia System. Images can be analyzed to localize and quantify the signal source, which represents the bacterial infection site(s) and number, respectively. After imaging, CFU determination is carried out on homogenized tissue to confirm the presence of bacteria. Several doses of bacteria are used to correlate bacterial numbers with luminescence. Imaging can be applied to study of pathogenesis and evaluation of the efficacy of antibacterial compounds and vaccines.

Methods for bioluminescence imaging of bacterial infections in living animals are decribed. Pathogens are modified to express luciferase allowing optical whole body imaging of infections in live animals. Animal models can be infected with luciferase expressing pathogens and the resulting course of disease visualized in real-time by bioluminescence imaging.

Imaging is a valuable technique that can be used to monitor biological processes.  In particular, the presence of cancer cells, stem cells, specific ...

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

In Vitro Assay of Bacterial Adhesion onto Mammalian Epithelial Cells

To cause infections, bacteria must colonize their host. Bacterial pathogens express various molecules or structures able to promote attachment to host cells1. These adhesins rely on interactions with host cell surface receptors or soluble proteins acting as a bridge between bacteria and host. Adhesion is a critical first step prior to invasion and/or secretion of toxins, thus it is a key event to be studied in bacterial pathogenesis. Furthermore, adhered bacteria often induce exquisitely fine-tuned cellular responses, the studies of which have given birth to the field of 'cellular microbiology'2. Robust assays for bacterial adhesion on host cells and their invasion therefore play key roles in bacterial pathogenesis studies and have long been used in many pioneer laboratories3,4. These assays are now practiced by most laboratories working on bacterial pathogenesis.
Here, we describe a standard adherence assay illustrating the contribution of a specific adhesin. We use the Escherichia coli strain 27875, a human pathogenic strain expressing the autotransporter Adhesin Involved in Diffuse Adherence (AIDA). As a control, we use a mutant strain lacking the aidA gene, 2787&Delta;aidA (F. Berthiaume and M. Mourez, unpublished), and a commercial laboratory strain of E. coli, C600 (New England Biolabs). The bacteria are left to adhere to the cells from the commonly used HEp-2 human epithelial cell line. This assay has been less extensively described before6.

In Vitro Assay of Bacterial Adhesion onto Mammalian Epithelial Cells

This protocol is a simple bacterial adhesion assay consisting in counting the numbers of bacterial colony forming units that are adhered onto cultured cells. The assay is robust, independent of the adhesin studied, and numerous variations are used in most laboratories working on bacterial pathogenesis.

To cause infections, bacteria must colonize their host. Bacterial pathogens express various molecules or structures able to promote attachment to host ...

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Plasmodium falciparum, the causative agent of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important health problems worldwide, being responsible for a total of 4 million deaths annually1. Due to their extensive overlap in developing regions, especially Sub-Saharan Africa, co-infections with malaria and HIV-1 are common, but the interplay between the two diseases is poorly understood. Epidemiological reports have suggested that malarial infection transiently enhances HIV-1 replication and increases HIV-1 viral load in co-infected individuals2,3. Because this viremia stays high for several weeks after treatment with antimalarials, this phenomenon could have an impact on disease progression and transmission.
The cellular immunological mechanisms behind these observations have been studied only scarcely. The few in vitro studies investigating the impact of malaria on HIV-1 have demonstrated that exposure to soluble malarial antigens can increase HIV-1 infection and reactivation in immune cells. However, these studies used whole cell extracts of P. falciparum schizont stage parasites and peripheral blood mononuclear cells (PBMC), making it hard to decipher which malarial component(s) was responsible for the observed effects and what the target host cells were4,5. Recent work has demonstrated that exposure of immature monocyte-derived dendritic cells to the malarial pigment hemozoin increased their ability to transfer HIV-1 to CD4+ T cells6,7, but that it decreased HIV-1 infection of macrophages8. To shed light on this complex process, a systematic analysis of the interactions between the malaria parasite and HIV-1 in different relevant human primary cell populations is critically needed.
Several techniques for investigating the impact of HIV-1 on the phagocytosis of micro-organisms and the effect of such pathogens on HIV-1 replication have been described. We here present a method to investigate the effects of P. falciparum-infected erythrocytes on the replication of HIV-1 in human primary monocyte-derived macrophages. The impact of parasite exposure on HIV-1 transcriptional/translational events is monitored by using single cycle pseudotyped viruses in which a luciferase reporter gene has replaced the Env gene while the effect on the quantity of virus released by the infected macrophages is determined by measuring the HIV-1 capsid protein p24 by ELISA in cell supernatants.

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

We have developed an in vitro malaria-HIV-1 co-infection model to study the impact of Plasmodium falciparum on the HIV-1 replicative cycle in human primary monocyte-derived macrophages. This versatile system can easily be adapted to other primary cell types susceptible to HIV-1 infection.

Plasmodium falciparum, the causative agent  of the deadliest form of malaria, and human immunodeficiency virus type-1 (HIV-1) are among the most important ...

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

The vascular endothelium plays an integral part in the inflammatory response. During the acute phase of inflammation, endothelial cells (ECs) are activated by host mediators or directly by conserved microbial components or host-derived danger molecules. Activated ECs express cytokines, chemokines and adhesion molecules that mobilize, activate and retain leukocytes at the site of infection or injury. Neutrophils are the first leukocytes to arrive, and adhere to the endothelium through a variety of adhesion molecules present on the surfaces of both cells. The main functions of neutrophils are to directly eliminate microbial threats, promote the recruitment of other leukocytes through the release of additional factors, and initiate wound repair. Therefore, their recruitment and attachment to the endothelium is a critical step in the initiation of the inflammatory response. In this report, we describe an in vitro neutrophil adhesion assay using calcein AM-labeled primary human neutrophils to quantitate the extent of microvascular endothelial cell activation under static conditions. This method has the additional advantage that the same samples quantitated by fluorescence spectrophotometry can also be visualized directly using fluorescence microscopy for a more qualitative assessment of neutrophil binding.

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

Neutrophil adherence to the activated endothelium at sites of infection is an integral component of the host's inflammatory response. Described in this report is a neutrophil binding assay that allows for the in vitro quantitation of primary human neutrophil binding to endothelial cells activated by inflammatory mediators under static conditions.

The vascular  endothelium plays an integral part in the inflammatory response. During the  acute phase of inflammation, endothelial cells (ECs) are ...

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial virus (HRSV) infections present a broad spectrum of disease severity, ranging from mild infections to life-threatening bronchiolitis. An important part of the pathogenesis of severe disease is an enhanced immune response leading to immunopathology.	Here, we describe a protocol used to investigate the immune response of human immune cells to an HRSV infection. First, we describe methods used for culturing, purification and quantification of HRSV. Subsequently, we describe a human in vitro model in which peripheral blood mononuclear cells (PBMCs) are stimulated with live HRSV. This model system can be used to study multiple parameters that may contribute to disease severity, including the innate and adaptive immune response. These responses can be measured at the transcriptional and translational level. Moreover, viral infection of cells can easily be measured using flow cytometry. Taken together, stimulation of PBMC with live HRSV provides a fast and reproducible model system to examine mechanisms involved in HRSV-induced disease.

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial virus (HRSV) can cause severe bronchiolitis in young infants. Part of the pathogenesis of severe HRSV disease is caused by the host immune response. Stimulation of primary human immune cells with HRSV provides a fast and reproducible model system to study activation of inflammatory pathways and infection.

Human respiratory syncytial  virus (HRSV) infections present a broad spectrum of disease severity, ranging  from mild infections to life-threatening ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

A Novel Feeder-free System for Mass Production of Murine Natural Killer Cells In Vitro

Natural killer (NK) cells belong to the innate immune system and are a first-line anti-cancer immune defense; however, they are suppressed in the tumor microenvironment and the underlying mechanism is still largely unknown. The lack of a consistent and reliable source of NK cells limits the research progress of NK cell immunity. Here, we report an in vitro system that can provide high quality and quantity of bone marrow-derived murine NK cells under a feeder-free condition. More importantly, we also demonstrate that siRNA-mediated gene silencing successfully inhibits the E4bp4-dependent NK cell maturation by using this system. Thus, this novel in vitro NK cell differentiating system is a biomaterial solution for immunity research.

A Novel Feeder-free System for Mass Production of Murine Natural Killer Cells In Vitro

Here, we present a protocol to mass-produce gene-silencing murine NK cells by using a feeder-free differentiation system for mechanistic study in vitro and in vivo.

Natural killer (NK) cells belong to the innate immune system and are a first-line anti-cancer immune defense; however, they are suppressed in the tumor ...

A Novel In Vitro Wound Healing Assay to Evaluate Cell Migration

The aim of this work is to show a novel method to evaluate the ability of some immunomodulatory molecules, such as antimicrobial peptides (AMPs), to stimulate cell migration. Importantly, cell migration is a rate-limiting event during the wound-healing process to re-establish the integrity and normal function of tissue layers after injury. The advantage of this method over the classical assay, which is based on a manually made scratch in a cell monolayer, is the usage of special silicone culture inserts providing two compartments to create a cell-free pseudo-wound field with a well-defined width (500 &#956;m). In addition, due to an automated image analysis platform, it is possible to rapidly obtain quantitative data on the speed of wound closure and cell migration. More precisely, the effect of two frog-skin AMPs on the migration of bronchial epithelial cells will be shown. Furthermore, pretreatment of these cells with specific inhibitors will provide information on the molecular mechanisms underlying such events.

A Novel In Vitro Wound Healing Assay to Evaluate Cell Migration

Here, we present a protocol to evaluate the effect of peptides on the migration of bronchial epithelial cells. This method allows for the rapid and highly reproducible obtainment of quantitative data on the speed of cell migration and wound closure.

The aim of this work is to show a novel method to evaluate the ability of some immunomodulatory molecules, such as antimicrobial peptides (AMPs), to ...

Human Colonoid Monolayers to Study Interactions Between Pathogens, Commensals, and Host Intestinal Epithelium

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal epithelium. Due to their closed structures and significant supporting extracellular matrix, 3D cultures are not ideal for host-pathogen studies. Enteroids or colonoids can be grown as epithelial monolayers on permeable tissue culture membranes to allow manipulation of both luminal and basolateral cell surfaces and accompanying fluids. This enhanced luminal surface accessibility facilitates modeling bacterial-host epithelial interactions such as the mucus-degrading ability of enterohemorrhagic E. coli (EHEC) on colonic epithelium. A method for 3D culture fragmentation, monolayer seeding, and transepithelial electrical resistance (TER) measurements to monitor the progress towards confluency and differentiation are described. Colonoid monolayer differentiation yields secreted mucus that can be studied by the immunofluorescence or immunoblotting techniques. More generally, enteroid or colonoid monolayers enable a physiologically-relevant platform to evaluate specific cell populations that may be targeted by pathogenic or commensal microbiota.

Here, we present a protocol to culture human enteroid or colonoid monolayers that have intact barrier function to study host epithelial-microbiota interactions at the cellular and biochemical level.

Human 3-dimensional (3D) enteroid or colonoid cultures derived from crypt base stem cells are currently the most advanced ex vivo model of the intestinal ...

In Vitro Transcribed RNA-based Luciferase Reporter Assay to Study Translation Regulation in Poxvirus-infected Cells

Summary

Explore More Videos

Chapters in this video

Using Luciferase to Image Bacterial Infections in Mice

Seven Steps to Stellate Cells

In Vitro Assay of Bacterial Adhesion onto Mammalian Epithelial Cells

An In vitro Co-infection Model to Study Plasmodium falciparum-HIV-1 Interactions in Human Primary Monocyte-derived Immune Cells

Quantitative In vitro Assay to Measure Neutrophil Adhesion to Activated Primary Human Microvascular Endothelial Cells under Static Conditions

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

A Novel Feeder-free System for Mass Production of Murine Natural Killer Cells In Vitro

A Novel In Vitro Wound Healing Assay to Evaluate Cell Migration

Human Colonoid Monolayers to Study Interactions Between Pathogens, Commensals, and Host Intestinal Epithelium