This work was generously supported by 1R21AI129881-01 (to T.M.C.), start-up funds from the National Emerging Infectious Diseases Laboratories, and the Boston University School of Medicine.

Serum samples used in this study were obtained from human participants of a cohort from Columbia. Sample collection was approved by the internal review board (IRB) at Universidad de Pamplona (Columbia, South America) and Los Potios Hospital8. The samples were anonymously provided and investigators had no access to patient information. The serum samples were checked for the DENV serotype. The samples were further confirmed to neutralize DENV infection in vitro. For control, serum samples from healthy individuals (HC) from the USA were used.
NOTE: This protocol can be used to examine the ADE of ZIKV replication in any human cell type expressing the Fc&#947; receptor. The protocol consists of three parts (Figure 1).
1. Cell Seeding and Infection Setup
NOTE: For this particular study, human primary macrophages or U937 myelomonocytic cell line (ATCC-CRL-1593.2) were used. The cells were maintained in RPMI growth medium supplemented with 10% fetal bovine serum (FBS) at a 37 &#176;C incubator with 5% carbon dioxide (CO2). All the steps were carried out in a biosafety level 2 (BSL-2) biosafety cabinet in sterile conditions.
<ol>
	<li>Seed 3 x 104 cells per well in a sterile flat-bottom 96-well plate along with 100 &#181;L of medium and place them in the 37 &#176;C incubator with 5% CO2.</li>
	<li>After seeding the cells, thaw serum samples at room temperature and make 10-fold serial dilutions (i.e., 1/10, 1/100, 1/1,000, 1/10,000) by mixing the samples in serum-free medium. Aliquot the dilutions into a sterile 96-well plate. Use the virus without serum as an additional control.</li>
	<li>Thaw the ZIKV stock at 37 &#176;C in a water bath for 1 - 2 min and quickly transfer them to ice for future use.</li>
	<li>Add a 0.1 multiplicity of infection (MOI) equivalent amount of ZIKV strain MR766 to the serum aliquots. 
	NOTE: Make sure that the dilution factor remains constant and the total volume is ~200 &#181;L; that is enough for triplicates of each treatment. Keep three wells uninfected to use as negative control for downstream analysis.</li>
	<li>Incubate the serum dilutions with the added virus in the 37 &#176;C incubator with 5% CO2 for 1 h in order to allow the DENV antibodies to form complexes with the Zika virions (for convenience, hereafter referred to as &#34;immune complexes&#34;).</li>
	<li>Aspirate the media from the cells that were seeded in the flat-bottom 96-well plate. Wash the cells with sterile 1x phosphate-buffered saline (1x PBS).</li>
	<li>Add 50 &#181;L of the immune complexes to each well and incubate them in the 37 &#176;C incubator with 5% CO2 for 2 h.</li>
	<li>After 2 h of incubation, aspirate the media containing the immune complexes from the cells, using a multichannel pipette, and wash the cells 2x with 1x PBS to completely remove the immune complexes and any unattached virions.</li>
	<li>Add 100 &#181;L of fresh complete media supplemented with 10% FBS to each well and incubate the cells in the 37 &#176;C incubator with 5% CO2 for 48 h.</li>
</ol>
2. RNA Extraction
<ol>
	<li>Remove the 96-well plate from the incubator and transfer it to the biosafety cabinet.</li>
	<li>Aspirate the media, wash the cells 2x with 1x PBS, and proceed to RNA extraction. 
	NOTE: RNA can be extracted by any method of choice (refer to the Table of Materials).</li>
	<li>Add 250 &#181;L of cell lysis buffer with 10% &#946;-mercaptoethanol per well. Pipette the buffer up and down at least 5x along with scratching the cells with the pipette tip to speed up the lysis procedure.</li>
	<li>Transfer the cell lysates to new, labeled, sterile 1.5 mL tubes.</li>
	<li>Add an equal amount of 70% ethanol (250 &#181;L). Pipette up and down 4x - 5x until the mixture is clear.</li>
	<li>Transfer the mixture (~500 &#181;L) to labeled silica-based columns in 2 mL collection tubes and centrifuge at 15,000 x g for 30 s. Discard the flow through and keep the columns in the same collection tubes.</li>
	<li>Add 700 &#181;L of wash buffer 1 to each column and centrifuge at 15,000 x g for 30 s. Discard the flow through and keep the columns in the same collection tubes.</li>
	<li>Add 500 &#181;L of wash buffer 2 to each column and centrifuge at 15,000 x g for 30 s. Discard the supernatant. Repeat this step 2x.</li>
	<li>Transfer the columns to new 2 mL collection tubes and centrifuge at 15,000 x g for 2 min. Ensure that silica-based columns get completely dry and there is no ethanol left from wash buffer 2.</li>
	<li>Discard the 2 mL tubes and place the columns in new, sterile, labeled, 1.5 mL recovery tubes.</li>
	<li>Add prewarmed (42 &#176;C) 30 &#181;L of RNase-free water at the center of each column and centrifuge at 15,000 x g for 1 min.</li>
	<li>Recover the eluted RNA and quantify the samples, using a spectrophotometer at a 260 nm wavelength. 
	NOTE: Ideally, determine the purity of the RNA by calculating the ratio between the absorbance values at 260 nm and 280 nm. Purified RNA&#39;s 260/280 ratio is ideally between 1.8 - 2.0.</li>
</ol>
3. Quantitative Real-time Polymerase Chain Reaction
NOTE: Quantitative real-time polymerase chain reaction (qRT-PCR) can be carried out by using any SYBR green mix which usually is composed of SYBR Green I dye, Taq DNA polymerase, deoxynucleotide triphosphates (dNTPs), and a passive dye. Any qPCR machine capable of the detection of SYBR green can be used to perform the reaction and acquire the data. For this experiment, a one-step RT-PCR kit was used which had a cocktail of SYBR Green I, ROX dye, Taq DNA polymerase, dNTPs, and an additional mixture of reverse transcriptase (refer to Table of Materials). The primers designed against the envelope region and used in this study to quantify ZIKV genomic levels are CCGCTGCCCAACACAAG for ZIKV-qF and CCACTAACGTTCTTTTGCAGACAT for ZIKV-qR. As a control, human &#946;-2-microglobulin (B2M) was measured and used to normalize the expression of ZIKV (housekeeping gene). The primer sequences to quantify the B2M gene expression used in this study are CTCCGTGGCCTTAGCTGTG for B2M-qF and TTTGGAGTACGCTGGATAGCCT for B2M-qR. Ensure to put three technical replicates for each sample for both the ZIKV and the B2M genes. The setup of the RT-PCR is briefly described below.
<ol>
	<li>RT-PCR setup
	<ol>
		<li>Use 100 ng of RNA per sample.</li>
		<li>Add 1 &#181;L from 10 &#181;M stocks of both forward and reverse primers of a particular gene for each reaction.</li>
		<li>Add 0.25 &#181;L of reverse transcriptase mix per sample.</li>
		<li>For each individual reaction, add 12.5 &#181;L of SYBR Green mix.</li>
		<li>Add up to 25 &#181;L of water. Make a master mix of all the above-mentioned reagents except RNA, aliquot it in the 96-well PCR plate, and add RNA last.</li>
		<li>Seal the plate with transparent adhesive tape.</li>
		<li>Centrifuge the plate at 1,000 x g for 1 min to mix the reagents.</li>
		<li>Put the plate in the qPCR machine.</li>
	</ol>
	</li>
	<li>RT-PCR profile 
	NOTE: Use the RT-PCR profile shown in Table 1.
	<ol>
		<li>Incubate the samples at 50 &#176;C for 10 min in order to ensure the synthesis of complementary DNA (cDNA).</li>
		<li>After the cDNA synthesis, activate the Taq DNA polymerase at 95 &#176;C for 5 min.</li>
		<li>Perform 40 cycles of denaturation at 95 &#176;C for 10 s and primer annealing and extension at 60 &#176;C for 30 s.</li>
		<li>Put the additional melt curve step (65&#176;C) in the end.</li>
	</ol>
	</li>
	<li>Data analysis
	<ol>
		<li>Monitor the melt curve by clicking the melt curve tab in the program used to run the qPCR machine, which, ideally, shows a single peak in all the samples for a particular gene to confirm the presence of only one amplicon and an amplification value more than 1.6 if the algorithm considers 2 as the 100% amplification value (the amplification value varies according to the algorithm used by the qPCR machine). Make sure to use 0.5 &#176;C temperature increments between steps and a minimum holding time of 10 s in the melt curve protocol, for optimal results.</li>
		<li>After making sure there are a single amplicon and good amplification value, first click on the quantification data tab to get a quantitative cycle (Ct/Cq value) of each sample and export to Microsoft Excel.</li>
		<li>Using a spreadsheet, calculate the average of each sample using the Ct value. Next, click in the formulas and select the average. The average CT values of each sample (replicate) are used for further analysis.</li>
		<li>Next, calculate the &#916;Ct using the formula &#916;Ct = average Ct of the target gene - average Ct of the control gene (in this case, &#916;Ct = average Ct of the ZIKV gene - average Ct of the B2M gene).</li>
		<li>Calculate &#916;&#916;Ct to normalize the data (in this case, &#916;&#916;Ct = &#916;Ct ZIKV samples - B2M samples).</li>
		<li>Calculate the fold increase gene expression by typing the formula 2^-(&#916;&#916;Ct) for every single &#916;&#916;Ct normalized value. The results of the fold increase to perform statistical tests can be obtained as described in earlier studies9,10.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Hayes, E. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+outside+Africa.">Zika virus outside Africa.</a> Emerging Infectious Diseases. 15, 1347-1350 (2009).</li><li>Grard, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+in+Gabon+(Central+Africa)+-+2007:+a+new+threat+from+Aedes+albopictus.">Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus.</a> PLoS Neglected Tropical Diseases. 8 (2), 2681 (2014).</li><li>Fauci, A. S., Morens, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus+in+the+Americas--Yet+Another+Arbovirus+Threat.">Zika Virus in the Americas--Yet Another Arbovirus Threat.</a> New England Journal of Medicine. 374 (7), 601-604 (2016).</li><li>Hawkes, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+the+Infectivity+of+Arboviruses+by+Specific+Antisera+Produced+in+Domestic+Fowls.">Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls.</a> Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).</li><li>Musso, D., Gubler, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> Clinical Microbiology Reviews. 29 (3), 487-524 (2016).</li><li>Vaughn, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+viremia+titer,+antibody+response+pattern,+and+virus+serotype+correlate+with+disease+severity.">Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity.</a> The Journal of Infectious Diseases. 181 (1), 2-9 (2000).</li><li>Khandia, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+Dengue/Zika+Virus+Pathogenicity+by+Antibody-Dependent+Enhancement+and+Strategies+to+Protect+Against+Enhancement+in+Zika+Virus+Infection.">Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection.</a> Frontiers of Immunology. 9, 597 (2018).</li><li>Londono-Renteria, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+relevant+in+vitro+human+model+for+the+study+of+Zika+virus+antibody-dependent+enhancement.">A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement.</a> Journal of General Virology. 98 (7), 1702-1712 (2017).</li><li>Ganger, M. T., Dietz, G. D., Ewing, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+common+base+method+for+analysis+of+qPCR+data+and+the+application+of+simple+blocking+in+qPCR+experiments.">A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.</a> BMC Bioinformatics. 18 (1), 534 (2017).</li><li>Renn, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+quantitative+real-time+RT-PCR+assay+for+determining+expression+profiles+of+types+I+and+III+interferon+subtypes.">High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes.</a> Journal of Visualized Experiments. (97), e52650 (2015).</li><li>McArthur, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+vaccines:+recent+developments,+ongoing+challenges+and+current+candidates.">Dengue vaccines: recent developments, ongoing challenges and current candidates.</a> Expert Review of Vaccines. 12 (8), 933-953 (2013).</li><li>Priyamvada, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humoral+cross-reactivity+between+Zika+and+dengue+viruses:+implications+for+protection+and+pathology.">Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology.</a> Emerging Microbes and Infections. 6 (5), 33 (2017).</li><li>Dai, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+basis+of+antibody-mediated+neutralization+and+protection+against+flavivirus.">Molecular basis of antibody-mediated neutralization and protection against flavivirus.</a> IUBMB Life. 68 (10), 783-791 (2016).</li><li>Dai, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structures+of+the+Zika+Virus+Envelope+Protein+and+Its+Complex+with+a+Flavivirus+Broadly+Protective+Antibody.">Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody.</a> Cell Host &amp; Microbe. 19 (5), 696-704 (2016).</li><li>Sirohi, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+3.8+A+resolution+cryo-EM+structure+of+Zika+virus.">The 3.8 A resolution cryo-EM structure of Zika virus.</a> Science. 352 (6284), 467-470 (2016).</li><li>George, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prior+Exposure+to+Zika+Virus+Significantly+Enhances+Peak+Dengue-2+Viremia+in+Rhesus+Macaques.">Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques.</a> Scientific Reports. 7 (1), 10498 (2017).</li><li>Morens, D. M., Halstead, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+antibody-dependent+infection+enhancement+of+four+dengue+virus+serotypes+by+monoclonal+and+polyclonal+antibodies.">Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies.</a> Journal of General Virology. 71, 2909-2914 (1990).</li><li>Dejnirattisai, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-reacting+antibodies+enhance+dengue+virus+infection+in+humans.">Cross-reacting antibodies enhance dengue virus infection in humans.</a> Science. 328 (5979), 745-748 (2010).</li><li>Priyamvada, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antibody+responses+after+dengue+virus+infection+are+highly+cross-reactive+to+Zika+virus.">Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (28), 7852-7857 (2016).</li><li>Charles, A. S., Christofferson, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Utility+of+a+Dengue-Derived+Monoclonal+Antibody+to+Enhance+Zika+Infection+In+Vitro.">Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro.</a> PLoS Currents. 8, (2016).</li><li>Swanstrom, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dengue+Virus+Envelope+Dimer+Epitope+Monoclonal+Antibodies+Isolated+from+Dengue+Patients+Are+Protective+against+Zika+Virus.">Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus.</a> MBio. 7 (4), (2016).</li></ol>

The authors have nothing to declare.

Cross-reactivity of DENV antibodies leading to the ADE of other DENV serotypes has hindered the development of an effective vaccine11. ZIKV belongs to the same family, Flaviviridae, and has a considerable homology with other flaviviruses, especially DENV12. The main target of neutralizing antibodies for both ZIKV and DENV is the envelope protein, which shares a very high structural and quaternary sequence homology between the two viruses13,14,15. It has been demonstrated that pre-immunity to either DENV or ZIKV can enhance the infection of the other virus8,16.
There are a number of different methods employed to quantify the viral infectivity in ADE experiments, ranging from plaque assays17, intracellular viral antigen staining using antibodies conjugated with fluorescent dyes, and flow cytometry18,19. These assays are time-consuming and not easily adaptable for the high-throughput of multiple samples at the same time. Importantly, most of the studies used DENV-specific monoclonal antibodies to check their effect on ZIKV and examined the ADE in cell lines only20,21. In this protocol, we describe a simple yet effective method in which we used human pre-immune serum samples that have a neutralizing ability against DENV, along with primary human immune cells, to examine the effect of patient serum on ZIKV replication by employing qRT-PCR. This method is robust, relevant, and can be completed in three days. Although the representative results in this manuscript show its application for ZIKV, this protocol can be easily modified and used for other flaviviruses, like yellow fever virus, dengue virus, and West Nile virus. One important factor to consider is that this protocol has a limitation in distinguishing between mature and immature viral RNA.
During the protocol, it is critical to give careful consideration when performing the RNA extractions, ensuring that the environment is RNase-free during all the RNA handling steps. Furthermore, viral stocks should be thawed at 37 &#176;C in a water bath for 1 - 2 min and immediately put on ice. However, the virus should not be kept on ice for long as, then, it can lose its infectivity.
Previous results have demonstrated that this protocol is highly convenient and adaptable to handle a large number of samples and can be completed in relatively less time than other methods. This protocol has the potential to be used as a useful assay for future ADE studies.

Among the mosquitoes-borne viral diseases, Zika infection is one of the most clinically important1. The infection is caused by the flavivirus ZIKV which, in most cases, uses Aedes aegypti as its primary vector1,2. However, there are studies that have reported Aedes albopictus as a primary vector in some ZIKV outbreaks3. Although the infection is asymptomatic in many cases, the most common symptoms are fever, headache, and muscle pain2. There is no cure or vaccine available for ZIKV infection and the treatment available is mostly supportive. Recent outbreaks of ZIKV in South America led to severe cases of the disease and an approximately 20-fold increase in the neurodevelopmental disorder in fetuses named microcephaly2. As South America is an area endemic to several arboviruses such as DENV and West Nile virus, it is crucial to investigate whether prior immunity to other flavivirus(es) plays a role in the severity of ZIKV infections and disease.
Throughout the ages, viruses have evolved different strategies to increase their chance of infectivity in order to take over the host cell machinery and suppress the antiviral response. One of the most fascinating of all is the use of host pre-immune antibodies by viruses to enhance their replication with the phenomenon ADE4. ADE across all four serotypes of DENV has been well studied and demonstrated to increase viral titers and disease outcome5,6,7. In a previous in vitro study, we have shown significant enhancement of ZIKV replication due to pre-existing DENV immunity in primary human immune cells8. We also demonstrated a relevant in vitro method to quantify the capability of DENV pre-existing antibodies to enhance ZIKV replication in primary cells.
The protocol that we have developed uses human serum samples that are tested for DENV neutralization in TCID-50 or plaque reduction neutralization test (PRNT) assays, along with ZIKV in biologically relevant cells or cells derived from tissues that ZIKV can infect.

<table border="0" cellpadding="0" cellspacing="0" style="width:773px;" width="773">
	<colgroup>
		<col />
		<col span="2" />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">Fetal Bovine Serum&#160;</td>
			<td style="width:119px;">GEMINI</td>
			<td style="width:119px;">100-106</td>
			<td style="width:277px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">iCycler&#160;</td>
			<td style="width:119px;">BioRad</td>
			<td style="width:119px;">785BR02188</td>
			<td>Model No. CFX96 Optics Module</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">Microfuge 18 Centrifuge</td>
			<td style="width:119px;">Beckman Coulter&#160;</td>
			<td style="width:119px;">367160</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">Nanodrop-1000</td>
			<td style="width:119px;">Thermoscientific&#160;</td>
			<td style="width:119px;">1072</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">Quantifast SYBR-One step RT-PCR kit&#160;</td>
			<td style="width:119px;">Qiagen&#160;</td>
			<td style="width:119px;">204154</td>
			<td>Used for 1 step RT-qPCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">RNeasy RNA Isolation Kit&#160;</td>
			<td style="width:119px;">Qiagen&#160;</td>
			<td style="width:119px;">74106</td>
			<td>Used for RNA extraction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:259px;">RPMI-medium&#160;</td>
			<td style="width:119px;">Gibco</td>
			<td style="width:119px;">11875093</td>
			<td></td>
		</tr>
	</tbody>
</table>

quantification of antibody-dependent enhancement of the zika virus in primary human cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

In Figure 1, there is a step-by-step diagrammatic illustration of all the steps involved to carry out the ADE protocol. It is a schematic diagram showing the whole procedure of ADE of ZIKV due to pre-existing immunity to DENV. Figure 2 shows how human serum samples were categorized into three different groups: DENV infection-confirmed samples are referred to as the DENV-infected group, DENV antibody-confirmed samples are referred to as the DENV-exposed group, and healthy individuals&#39; sera with no DENV-neutralizing antibodies or RNA are called the healthy control (HC) group. (Figure 2).
All the serum samples were allowed to make complexes with ZIKV and were then used to infect macrophage cells. After 48 h postinfection, RNA was extracted and subjected to qRT-PCR. The representative experiment in Figure 3 demonstrates that most of the sera containing DENV serotype 1 to 4 antibodies were able to enhance ZIKV replication at different levels. The highest increase in ZIKV titers was found in the macrophages treated with sera containing DENV serotype 2 and 4 antibodies as compared to serotype 1 and 3, which showed a relatively less induction of ZIKV.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58691/58691fig1.jpg" /> 
Figure 1: Diagrammatic illustration of the ADE protocol. A step-by-step illustration shows all the steps involved in the whole protocol. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58691/58691fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58691/58691fig2.jpg" /> 
Figure 2: Schematic of the experimental procedure. Three types of sera were incubated with Zika virus. Group I consisted of DENV-RNA positive (DENV-infected) samples. Group II consisted of DENV-antibody positive (DENV-exposed) samples. Group III consisted of samples with no DENV RNA or antibody (healthy controls). The virus-sera mixture was added to human macrophages and the infection quantified. This figure has been modified from Londono-Renteria et al.8. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58691/58691fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58691/58691fig3.jpg" /> 
Figure 3: DENV immune sera enhances ZIKV infection in primary human macrophages. Human sera containing DENV antibodies (DENV1-4 are serotype confirmed, Col are serotype unknown) or from healthy controls were diluted 1:10 to 1:10,000 and incubated with ZIKV. The sera are described in Table 1. Primary isolated human macrophages were infected either with ZIKV alone or with the ZIKV-sera mixtures. (a) DENV1 antibody-containing sera. (b) DENV2 antibody-containing sera. (c) DENV3 antibody-containing sera. (d) DENV4 antibody-containing sera. (e) DENV-antibody sera from Colombian individual 1. (f) DENV-antibody sera from Colombian individual 2. The infection was measured by qRT-PCR analysis at 48 h postinfection. Technical and biological replicates were done in triplicate. The data are pooled, and the error bars indicate standard deviation. Student&#39;s t-test and ANOVA were used for the statistical analysis. * P &#60; 0.001. This figure has been modified from Londono-Renteria et al.8. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58691/58691fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Table 1" src="/files/ftp_upload/58691/58691table1.jpg" /> 
Table 1: Thermal profile of qRT-PCR.

Watch this Scientific Journal Video about Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells at JoVE.com

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...

quantification-antibody-dependent-enhancement-zika-virus-primary

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Boston University School of Medicine. We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

Video: Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

piggyBac Transposon System Modification of Primary Human T Cells

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most commonly utilizing two plasmids with one expressing the piggyBac transposase enzyme and a transposon plasmid harboring the gene(s) of interest between inverted repeat elements which are required for gene transfer activity. PiggyBac mediates gene transfer through a "cut and paste" mechanism whereby the transposase integrates the transposon segment into the genome of the target cell(s) of interest. PiggyBac has demonstrated efficient gene delivery activity in a wide variety of insect1,2, mammalian3-5, and human cells6 including primary human T cells7,8. Recently, a hyperactive piggyBac transposase was generated improving gene transfer efficiency9,10.
Human T lymphocytes are of clinical interest for adoptive immunotherapy of cancer11. Of note, the first clinical trial involving transposon modification of human T cells using the Sleeping beauty transposon system has been approved12. We have previously evaluated the utility of piggyBac as a non-viral methodology for genetic modification of human T cells. We found piggyBac to be efficient in genetic modification of human T cells with a reporter gene and a non-immunogenic inducible suicide gene7. Analysis of genomic integration sites revealed a lack of preference for integration into or near known proto-oncogenes13. We used piggyBac to gene-modify cytotoxic T lymphocytes to carry a chimeric antigen receptor directed against the tumor antigen HER2, and found that gene-modified T cells mediated targeted killing of HER2-positive tumor cells in vitro and in vivo in an orthotopic mouse model14. We have also used piggyBac to generate human T cells resistant to rapamycin, which should be useful in cancer therapies where rapamycin is utilized15.
Herein, we describe a method for using piggyBac to genetically modify primary human T cells. This includes isolation of peripheral blood mononuclear cells (PBMCs) from human blood followed by culture, gene modification, and activation of T cells. For the purpose of this report, T cells were modified with a reporter gene (eGFP) for analysis and quantification of gene expression by flow cytometry.
PiggyBac can be used to modify human T cells with a variety of genes of interest. Although we have used piggyBac to direct T cells to tumor antigens14, we have also used piggyBac to add an inducible safety switch in order to eliminate gene modified cells if needed7. The large cargo capacity of piggyBac has also enabled gene transfer of a large rapamycin resistant mTOR molecule (15 kb)15. Therefore, we present a non-viral methodology for stable gene-modification of primary human T cells for a wide variety of purposes.

piggyBac Transposon System Modification of Primary Human T Cells

We describe a method to genetically modify primary human T cells with a transgene using the non-viral piggyBac transposon system. T cells modified to using the piggyBac transposon system exhibit stable transgene expression.

The piggyBac transposon system is naturally active, originally derived from the cabbage looper moth1,2. This non-viral system is plasmid based, most ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining the role of the gene of interest in the development, differentiation, and function of NK cells. Recent advances related to chimeric antigen receptors (CARs) in cancer immunotherapy accentuate the need for an efficient method to deliver exogenous genes to effector lymphocytes. The efficiencies of lentiviral-mediated gene transductions into primary human or mouse NK cells remain significantly low, which is a major limiting factor. Recent advances using cationic polymers, such as polybrene, show an improved gene transduction efficiency in T cells. However, these products failed to improve the transduction efficiencies of NK cells. This work shows that dextran, a branched glucan polysaccharide, significantly improves the transduction efficiency of human and mouse primary NK cells. This highly reproducible transduction methodology provides a competent tool for transducing human primary NK cells, which can vastly improve clinical gene delivery applications and thus NK cell-based cancer immunotherapy.

The goal of this study was to formulate technologies that allow for successful gene transduction in primary natural killer (NK) cells. The dextran-mediated lentiviral transduction of human or mouse primary NK cells results in higher gene expression efficiencies. This method of gene transduction will vastly improve NK cell genetic manipulation.

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

Antibody dependent enhancement of infection has been shown to play a major role in Dengue viral pathogenesis. Traditional assays that measure the capacity of antibodies or serum to enhance infection in impermissible cell lines have relied on using viral output in the media followed by plaque assays to quantify infection. More recently, these assays have examined Dengue virus (DENV) infection in the cell lines using fluorescently labeled antibodies. Both these approaches have limitations that restrict the widespread use of these techniques. Here, we describe a simple in vitro assay using Dengue virus reporter viral particles (RVPs) that express green fluorescent protein and K562 cells to examine antibody dependent enhancement (ADE) of DENV infection using serum that was obtained from rhesus macaques 16 weeks after infection with Zika virus (ZIKV). This technique is reliable, involves minimal manipulation of cells, does not involve the use of live replication competent virus, and can be performed in a high throughput format to get a quantitative readout using flow cytometry. Additionally, this assay can be easily adapted to examine antibody dependent enhancement (ADE) of other flavivirus infections such as Yellow Fever virus (YFV), Japanese Equine Encephalitis virus (JEEV), West Nile virus (WNV) etc. where RVPs are available. The ease of setting up the assay, analyzing the data, and interpreting results makes it highly amenable to most laboratory settings.

A Simple Flow Cytometry Based Assay to Determine In Vitro Antibody Dependent Enhancement of Dengue Virus Using Zika Virus Convalescent Serum

We describe a simple and easy protocol for measuring antibody dependent enhancement of infection by Zika virus convalescent serum using Dengue virus Reporter Viral Particles.

Antibody dependent enhancement of infection has been shown to play a major role in Dengue viral pathogenesis. Traditional assays that measure the capacity ...

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

Quantification of Efferocytosis by Single-cell Fluorescence Microscopy

Studying the regulation of efferocytosis requires methods that are able to accurately quantify the uptake of apoptotic cells and to probe the signaling and cellular processes that control efferocytosis. This quantification can be difficult to perform as apoptotic cells are often efferocytosed piecemeal, thus necessitating methods which can accurately delineate between the efferocytosed portion of an apoptotic target versus residual unengulfed cellular fragments. The approach outlined herein utilizes dual-labeling approaches to accurately quantify the dynamics of efferocytosis and efferocytic capacity of efferocytes such as macrophages. The cytosol of the apoptotic cell is labeled with a cell-tracking dye to enable monitoring of all apoptotic cell-derived materials, while surface biotinylation of the apoptotic cell allows for differentiation between internalized and non-internalized apoptotic cell fractions. The efferocytic capacity of efferocytes is determined by taking fluorescent images of live or fixed cells and quantifying the amount of bound versus internalized targets, as differentiated by streptavidin staining. This approach offers several advantages over methods such as flow cytometry, namely the accurate delineation of non-efferocytosed versus efferocytosed apoptotic cell fractions, the ability to measure efferocytic dynamics by live-cell microscopy, and the capacity to perform studies of cellular signaling in cells expressing fluorescently-labeled transgenes. Combined, the methods outlined in this protocol serve as the basis for a flexible experimental approach that can be used to accurately quantify efferocytic activity and interrogate cellular signaling pathways active during efferocytosis.

Efferocytosis, the phagocytic removal of apoptotic cells, is required to maintain homeostasis and is facilitated by receptors and signaling pathways that allow for the recognition, engulfment, and internalization of apoptotic cells. Herein, we present a fluorescence microscopy protocol for the quantification of efferocytosis and the activity of efferocytic signaling pathways.

Studying the regulation of efferocytosis requires methods that are able to accurately quantify the uptake of apoptotic cells and to probe the signaling ...

Isolation and Quantification of Zika Virus from Multiple Organs in a Mouse

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral load. The purpose of the procedure is to quantify viral titers in peripheral and CNS areas of the mouse at different time points post infection or under different experimental conditions to identify virologic and immunological factors that regulate Zika virus infection. The organ isolation procedures demonstrated allow for both focus forming assay quantification and quantitative PCR assessment of viral titers. The rapid organ isolation techniques are designed for the preservation of virus titer. Viral titer quantification by focus forming assay allows for the rapid throughput assessment of Zika virus. The benefit of the focus forming assay is the assessment of infectious virus, the limitation of this assay is the potential for organ toxicity reducing the limit of detection. Viral titer assessment is combined with quantitative PCR, and using a recombinant RNA copy control viral genome copy number within the organ is assessed with low limit of detection. Overall these techniques provide an accurate rapid high throughput method for the analysis of Zika viral titers in the periphery and CNS of Zika virus infected animals and can be applied to the assessment of viral titers in the organs of animals infected with most pathogens, including Dengue virus.

The goal of the protocol is to demonstrate the techniques used to investigate viral disease by isolating and quantifying Zika virus, from multiple organs in a mouse following infection.

The methods being presented demonstrate laboratory procedures for the isolation of organs from Zika virus infected animals and the quantification of viral ...