The authors would like to thank Kristen Bullard-Feibelman, Milena Veselinovic and Claudia R&#252;ckert for their assistance in characterizing the clone-derived virus. This work was supported in part by grants from the National Institute of Allergy and Infectious Diseases, NIH under grants AI114675 (BJG) and AI067380 (GDE).

1. Transform and Recovery of Infectious Clone Plasmids
<ol>
	<li>Transform both plasmids (separately) using a commercial transformation protocol (e.g., NEB 5 Minute Transformation Protocol) with some modifications. Both plasmids contain a gene encoding for ampicillin resistance, therefore use ampicillin or carbenicillin for selection. Carbenicillin is preferred, as it is more stable.
	<ol>
		<li>Remove cells (See Materials Table) from -80 &#176;C freezer and thaw on ice for 5-10 min. Prewarm lysogeny broth (LB) (containing 10 g/L NaCl and 25 &#181;g/mL carbenicillin; called LB-carb) plates and the broth with catabolite repression (SOC (without antibiotics) - coming with the cells) at 37 &#176;C.</li>
		<li>Add between 100 pg-10 ng in 1 &#181;L of plasmid DNA to a tube containing 50 &#181;L of competent cells; mix gently by flicking the tube.</li>
		<li>Incubate tubes on ice for 5 min.</li>
		<li>Heat shock tubes at 42 &#176;C for 30 s in a water bath. Return to ice for 2 min immediately following heat shock.</li>
		<li>Pipette 950 &#181;L of room temperature SOC into each tube and mix by pipetting. Spread 100 &#181;L of the bacterial mixture onto a LB-carb plate and incubate overnight at 37 &#176;C (roughly 12-14 h).</li>
	</ol>
	</li>
	<li>Remove plates from 37 &#176;C incubator after 12-14 h incubation. Place plates in a dark drawer at room temperature to allow colonies to continue to grow (roughly 8-9 h).</li>
	<li>Using 5 mL of Terrific broth (TB, containing 25 &#181;g/mL carbenicillin, called TB-carb), grow 5-10 small colonies for each plasmid overnight at 30 &#176;C in a bacterial shaker (roughly 14-16 h). 
	NOTE: Small colonies are an indicator that the plasmid is intact; colonies with plasmids containing deletions, rearrangements or mutations (herein called instability events) will grow faster, and thus be bigger. Therefore, one should attempt to pick the smallest colonies on the plate, specifically not selecting the largest colonies present. Some medium size colonies may also be selected for completeness. The lower temperature used reduces the probability that the cells will overgrow (OD600 of greater than 0.6-0.8). As most researchers perform overnight growth, it allows for more control and reduced chance of overgrowth.</li>
	<li>Check liquid cultures for turbidity (roughly OD600 of 0.6-0.8). Place any turbid tubes at 4 &#176;C and allow other tubes to become turbid by growing for longer. 
	NOTE: Do not grow bacteria to OD600 values greater than recommended, as plasmid instability events may occur.</li>
	<li>Extract plasmid DNA from bacteria with a commercial plasmid miniprep kit (See Materials Table). Elute in 15 &#181;L of pre-heated (to 70 &#176;C in a heating block) elution buffer. Allow the elution buffer to incubate on the column for 5 min before centrifugation. 
	NOTE: Preserve at least 1 mL of this starter culture at 4 &#176;C for further use in the next step.</li>
	<li>Digest 10 &#181;L of the recovered plasmids to assess whether plasmid instability events occurred during culture. 
	NOTE: Digest p1 with SalI/NheI and p2 with BamHI/HindIII at 37 &#176;C for 1 h. Confirm the presence of the correct bands following digestion (Figure 2a) by gel electrophoresis and proceed to step 2. If preparing plasmid DNA by rolling circle amplification (RCA), reserve some of the miniprep eluate to serve as a template.</li>
</ol>
2. Preparation of Sufficient Plasmid DNA for Ligation
NOTE: Ligation and subsequent electroporation requires a sufficient amount of plasmid DNA that must be generated via either maxiprep or RCA. While maxiprep is the traditionally used approach, RCA offers the advantage of not requiring bacteria, thus removing the potential for plasmid-induced toxicity in bacteria that can result in instability events.
<ol>
	<li>Perform the following maxiprep procedure.
	<ol>
		<li>For each plasmid that demonstrated the correct restriction enzyme digestion pattern in the previous section, add 500 &#181;L of starter culture to 1 L of TB-Carb (25 &#181;g/mL carbenicillin) broth and shake overnight at 30 &#176;C (roughly 14-16 h, roughly OD600 of 0.6-0.8). 
		NOTE: Do not allow the culture to grow over this OD600 value. This will potentially result in instability events within the plasmids.</li>
		<li>Harvest the bacteria and perform maxipreps per manufacturer&#39;s protocol (See Materials Table).</li>
	</ol>
	</li>
	<li>Using the saved miniprep from step 1.6, perform the following for the RCA procedure.
	<ol>
		<li>Transfer 1 &#181;L of plasmid DNA to a tube containing 50 &#181;L of sample buffer.</li>
		<li>Heat-denature the sample at 95 &#176;C for 3 min, and then incubate at 4 &#176;C until ready to use.</li>
		<li>Prepare the commercial amplification premix (See Materials Table). Combine 50 &#181;L of reaction buffer with 2 &#181;L of enzyme mix in a tube set on ice. 
		NOTE: The amplification premix should be kept on ice until ready for use. It is convenient to prepare a master mix by combining sufficient reagents for the required number of amplification reactions. Any unused premix must be discarded.</li>
		<li>Transfer 50 &#181;L of prepared amplification premix to the denatured sample.</li>
		<li>Incubate the reaction tubes at 30 &#176;C for 18 h.</li>
		<li>Incubate the tubes at 65 &#176;C for 10 min to inactivate the &#248;29 DNA polymerase.</li>
		<li>Store the reaction tubes at 4 &#176;C or -20 &#176;C until ready for use. 
		NOTE: At this point, plasmid DNA prepared via both methods should be quantified (using absorbance at 260 nm) and the ZIKV genome should be Sanger sequenced entirely to confirm no instability events (deletions and rearrangements) occurred during preparation.</li>
	</ol>
	</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer Name</td>
			<td>Sequence (5&#39; - 3&#39;)</td>
		</tr>
		<tr>
			<td>ZIKV PRVABC59 1For.</td>
			<td>AGTTGTTGATCTGTGTGAATCAGAC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 632For.</td>
			<td>GCCCTATGCTGGATGAGG</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 692Rev.</td>
			<td>GGTTCCGTACACAACCCAAGTTG</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 1313Rev.</td>
			<td>CTCCCTTTGCCAAAAAGTCCACA</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 1201For.</td>
			<td>CCAACACAAGGTGAAGCCTAC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 1663For.</td>
			<td>GCAGACACCGGAACTCCACACT</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 2008For.</td>
			<td>CAGATGGCGGTGGACATGC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 2350Rev.</td>
			<td>GTGAGAACCAGGACATTCCTCC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 2605For.</td>
			<td>TACAAGTACCATCCTGACTCCC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 3499Rev.</td>
			<td>GCCTTATCTCCATTCCATACCA</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 3961Rev.</td>
			<td>TTGCCAACCAGGCCAAAG</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 4132For.</td>
			<td>CATTTGTCATGGCCCTGG</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 4561Rev.</td>
			<td>CTATTGGGTTCATGCCACAGAT</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 4665For.</td>
			<td>GACCACAGATGGAGTGTACAGAGT</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 5189Rev.</td>
			<td>AAGACAGTTAGCTGCTTCTTCTTCAG</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 5219For.</td>
			<td>GAGAGTTCTTCCTGAAATAGTCCGTGA</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 6086Rev.</td>
			<td>CTTGCTTCAAGCCAGTGTGC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 6119For.</td>
			<td>GCCTCATAGCCTCGCTCTATCG</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 6721Rev.</td>
			<td>CCATTCCAAAGCCCATCTTCCC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 6769For.</td>
			<td>CCAGCCAGAATTGCATGTGTCC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 7209Rev.</td>
			<td>ATCATTAGCAGCGGGACTCCAA</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 7343For.</td>
			<td>GTTGTGGATGGAATAGTGGT</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 8243For.</td>
			<td>TGCCCATACACCAGCACTATGA</td>
		</tr>
		<tr>
			<td>ZIKV PRVABC59 8893Rev.</td>
			<td>TGCATTGCTACGAACCTTGTTG</td>
		</tr>
		<tr>
			<td>ZIKV conserved 9133For.</td>
			<td>AGCCCTTGGATTCTTGAACGAGGA</td>
		</tr>
		<tr>
			<td>ZIKV PRVABC59 9673Rev.</td>
			<td>AACGCAATCATCTCCACTGACT</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 9686For.</td>
			<td>GATGATAGGTTTGCACATGCC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 10321Rev.</td>
			<td>GTCCATGTACTTTTCTTCATCACCTAT</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 10455For.</td>
			<td>CAGGAGAAGCTGGGAAACC</td>
		</tr>
		<tr>
			<td>ZIKV Conserved 10621Rev.</td>
			<td>CAGATTGAAGGGTGGGGAAGGTC</td>
		</tr>
	</tbody>
</table>
Table 1: Primers for sequencing cDNA clones. Plasmids can be sequenced entirely with the primers listed. Primers marked as &#34;conserved&#34; indicate that they are likely able to sequence/amplify all genotypes of ZIKV. Primers labelled as &#34;PRVABC59&#34; are specific to this strain but may also work for other Asian genotype strains and possibly other genotypes.
3. Preparation of In Vitro Transcribed RNA
<ol>
	<li>Set up digestion reaction of either maxiprep or RCA prepared DNA.
	<ol>
		<li>For p1 digestion, mix 10 &#181;L of 10x reaction buffer, 3 &#181;L of ApaLI, 3 &#181;L of BamHI-HF, 3 &#181;L of rSAP or CIP, and 3.3 &#181;g of p1 DNA. Add ddH2O to 100 &#181;L.</li>
		<li>For p2 digestion, mix 10 &#181;L of 10x reaction buffer, 3 &#181;L of ApaLI, 3 &#181;L of EcoRI-HF, and 13.3 &#181;g of p2 DNA. Add ddH2O to 100 &#181;L.</li>
		<li>Incubate at 37 &#176;C for 1-2 h.</li>
		<li>Purify using a commercial gel and PCR clean-up kit (See Materials Table). Elute in 30 &#181;L of elution buffer pre-heated to 70 &#176;C in a heating block (incubate the column for 5 min before spinning). 
		NOTE: Keep 1 &#181;L to run on a gel later.</li>
	</ol>
	</li>
	<li>Prepare ligation reaction.
	<ol>
		<li>Combine 10 &#181;L of 10x T4 DNA ligation reaction buffer, 3 &#181;L of T4 DNA ligase (400 U/&#181;L), 29 &#181;L of purified p1, and 29 &#181;L purified p2. Add ddH2O to 100 &#181;L.</li>
		<li>Incubate at room temperature for 2 h or 16 &#176;C overnight.</li>
		<li>Purify using a commercial gel and PCR clean-up kit (See Materials Table). Elute in 10 &#181;L of elution buffer pre-heated to 70 &#176;C in a heating block (incubate column for 5 minutes before spinning). 
		NOTE: Keep 1 &#181;L to run on a gel later.</li>
	</ol>
	</li>
	<li>Run undigested plasmids, digested plasmids, and ligation on an agarose gel. The ligation product should have a higher molecular weight band (around 11 kb) than either digested plasmid alone, indicating the ligation was successful (Figure 2b).</li>
	<li>Set up T7 in vitro transcription reaction.
	<ol>
		<li>Combine 10 &#181;L 2x ARCA/NTP Mix, 2 &#181;L of T7 RNA polymerase mix, and 8 &#181;L of purified ligation reaction for a final volume of 20 &#181;L. 
		NOTE: The ARCA included in the mix is a cap analog that is exclusively incorporated in the correct orientation. Standard cap analogs can result in only ~50% of the transcripts having a cap in the correct orientation.</li>
		<li>Incubate for 4 h at 37 &#176;C.</li>
		<li>Measure RNA concentration via a UV spectrophotometer. Optionally, run a denaturing agarose gel to confirm the length of the RNA transcript.</li>
	</ol>
	</li>
</ol>
4. Rescue of Infectious Virus by Electroporation
<ol>
	<li>days prior to electroporation, prepare 1 T182 flask ofVero cells (between T150 and T182 is acceptable; grown in DMEM + 10% Fetal bovine serum (FBS)) per construct to be recovered. Include 1 T182 as a mock transfection control. Cells should be used at 70-80% confluency.</li>
	<li>When cells are ready, place 12 mL/reaction of DMEM + 15% FBS + 10 mM HEPES in a water bath heated to 37&#176;C.</li>
	<li>Detach cells by trypsinization with a standard protocol, and recover cells in media with 10% FBS to inactivate trypsin; centrifuge cells at 150 x g for 5 min at 4 &#176;C.</li>
	<li>Wash cells in 1x phosphate-buffered saline (PBS), pelleting cells at 150 x g for 5 min at 4 &#176;C. Repeat this step twice for a total of three washes.</li>
	<li>Resuspend cells in 200 &#181;L of RPMI 1640 + 10 mM HEPES (sterile) per # of samples. Transfer 200 &#181;L of cell suspension to a sterile tube. Cells should be ~0.5 x 107 cells/mL.</li>
	<li>Add 20 &#181;L of water (mock neg. control) or 20 &#181;L of RNA (preferably 5-10 &#181;g) produced in step 3.4 to each set of cells. Mix gently by flicking the tube and transfer the contents of the tube to a 2 mm gap electroporation cuvette.</li>
	<li>Set an electroporator to 170 V LV, omega (resistance) at 0 and 950 &#181;F (roughly to 625 V/cm and 20 ms time constant for other machines). Set resistance to the lowest available setting, either 0 or &#8734; if available.</li>
	<li>Pulse once and immediately add 600 &#181;L of DMEM +15 %FBS +10 mM HEPES that was warmed in step 4.2. Rinse inside of cuvette thoroughly to remove all cells. Add cells to a T75 tissue culture flask containing 10 mL of pre-warmed media. Remove additional media from cuvette by using the dropper that is included with the cuvette. Be careful to maintain sterility.</li>
	<li>Swirl flask to mix media and cells and place in 37 &#176;C incubator.</li>
	<li>Check the next day for cell viability, and do so every day until 50-75% cell death is observed. Cell death is observed by comparing to the mock electroporated control. 
	NOTE: ZIKV cytopathic effect (CPE) is quite pronounced in Vero cells, resulting in rounded up cells that detach and float in the culture medium. We have observed a range of 8-10 days as being ideal for harvest.</li>
	<li>Harvest supernatant in a conical tube and centrifuge to remove cellular debris at &#62;3,000 x g for 10 min at 4 &#176;C.</li>
	<li>Remove clarified supernatant to a new tube and supplement with a final concentration of 20% FBS (from 100% stock). Additionally, add sterile HEPES at a final concentration of 10 mM as a buffering agent to preserve virus infectivity while frozen (from a 1 M sterile stock).</li>
	<li>Mix virus by vortexing and aliquot into screw cap vials. Store at -80 &#176;C for future use.</li>
</ol>
5. Titration of Recovered Virus
<ol>
	<li>Seed the appropriate number of 6- or 12-well plates of Vero cells the day before titration.</li>
	<li>Remove virus from the freezer and make serial 10-fold dilutions in DMEM+ 2%FBS in tubes or 96-well plates. 
	NOTE: The expected titer from recovered clones is between 1 x 106 and 5 x 107 PFU/mL.</li>
	<li>Add 200 or 400 &#181;L of each dilution in duplicate to a well of a 12- or 6-well plate, respectively.</li>
	<li>Place plates in 37 &#176;C incubator and rock every 15 min, for a total of ~1-1.5 h adsorption period.</li>
	<li>Remove viral inoculum and add 1 mL of (12-well) or 2 mL (6-well) DMEM-Tragacanth overlay to each well. 
	NOTE: It is possible to use agarose, agar, methylcellulose or other overlay media here.</li>
	<li>Incubate cells in 37 &#176;C incubator for 5 days. The time for proper plaque formation will vary depending on the overlay used.</li>
	<li>To fix cells, remove plates from incubator and decant overlay gently into disinfectant.</li>
	<li>Add sufficient 20% ethanol/0.1% crystal violet (CV) to each well to cover and swirl to mix. 
	NOTE: Many other fixatives exist and can be used here. Additionally, if using an agarose or agar overlay, a second overlay can be used with in conjunction with neutral red to visualize plaques without fixation. 20% ethanol has shown to be effective in inactivating enveloped viruses in previous studies; do not use this amount for non-enveloped viruses as they will not be inactivated19.</li>
	<li>Incubate plates for 30-60 min at room temperature (in a class II biosafety cabinet); discard CV (per local regulations) and wash plates with tap water.</li>
	<li>Allow plates to dry, and manually count plaques. 
	NOTE: Reference 20 can be used as an additional reference for performing plaque assays.</li>
</ol>

<ol>
	<li>Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika:+the+origin+and+spread+of+a+mosquito-borne+virus.">Zika: the origin and spread of a mosquito-borne virus.</a> Bull World Health Organ. 94 (9), 675C-686C (2016).</li><li>Oehler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+virus+infection+complicated+by+Guillain-Barre+syndrome--case+report,+French+Polynesia,+December+2013.">Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013.</a> Euro Surveill. 19 (9), (2014).</li><li>Li, D., Aaskov, J., Lott, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+cryptic+prokaryotic+promoter+within+the+cDNA+encoding+the+5'+end+of+dengue+virus+RNA+genome.">Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.</a> PLoS One. 6 (3), e18197 (2011).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+approach+to+propagate+flavivirus+infectious+cDNA+clones+in+bacteria+by+introducing+tandem+repeat+sequences+upstream+of+virus+genome.">A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome.</a> J Gen Virol. 95 (Pt 7), 1493-1503 (2014).</li><li>Pu, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Successful+propagation+of+flavivirus+infectious+cDNAs+by+a+novel+method+to+reduce+the+cryptic+bacterial+promoter+activity+of+virus+genomes.">Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes.</a> J Virol. 85 (6), 2927-2941 (2011).</li><li>Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+of+infectious+yellow+fever+RNA+from+full-length+cDNA+templates+produced+by+in+vitro+ligation.">Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation.</a> New Biol. 1 (3), 285-296 (1989).</li><li>Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+application+of+a+reverse+genetics+system+for+Japanese+encephalitis+virus.">Development and application of a reverse genetics system for Japanese encephalitis virus.</a> J Virol. 77 (11), 6450-6465 (2003).</li><li>Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+major+determinant+of+mouse+neurovirulence+of+dengue+virus+type+2+using+stably+cloned+genomic-length+cDNA.">Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA.</a> J Gen Virol. 79 (Pt 3), 437-446 (1998).</li><li>Johansen, I. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intron+insertion+facilitates+amplification+of+cloned+virus+cDNA+in+Escherichia+coli+while+biological+activity+is+reestablished+after+transcription+in+vivo.">Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo.</a> Proc Natl Acad Sci U S A. 93 (22), 12400-12405 (1996).</li><li>Shan, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Infectious+cDNA+Clone+of+Zika+Virus+to+Study+Viral+Virulence,+Mosquito+Transmission,+and+Antiviral+Inhibitors.">An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors.</a> Cell Host Microbe. 19 (6), 891-900 (2016).</li><li>Schwarz, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rescue+of+the+1947+Zika+Virus+Prototype+Strain+with+a+Cytomegalovirus+Promoter-Driven+cDNA+Clone.">Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone.</a> mSphere. 1 (5), (2016).</li><li>Tsetsarkin, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Full-Length+Infectious+cDNA+Clone+of+Zika+Virus+from+the+2015+Epidemic+in+Brazil+as+a+Genetic+Platform+for+Studies+of+Virus-Host+Interactions+and+Vaccine+Development.">A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development.</a> MBio. 7 (4), (2016).</li><li>Gadea, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+method+for+the+rapid+generation+of+recombinant+Zika+virus+expressing+the+GFP+reporter+gene.">A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene.</a> Virology. 497, 157-162 (2016).</li><li>Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+characterization+of+an+infectious+dengue+virus+type-2+RNA+genome+(New+Guinea+C+strain).">Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain).</a> Gene. 162 (2), 175-180 (1995).</li><li>Messer, W. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+characterization+of+a+reverse+genetic+system+for+studying+dengue+virus+serotype+3+strain+variation+and+neutralization.">Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization.</a> PLoS Negl Trop Dis. 6 (2), e1486 (2012).</li><li>Kinney, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avian+virulence+and+thermostable+replication+of+the+North+American+strain+of+West+Nile+virus.">Avian virulence and thermostable replication of the North American strain of West Nile virus.</a> J Gen Virol. 87 (Pt 12), 3611-3622 (2006).</li><li>Chang, A. C., Cohen, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+and+characterization+of+amplifiable+multicopy+DNA+cloning+vehicles+derived+from+the+P15A+cryptic+miniplasmid.">Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid.</a> J Bacteriol. 134 (3), 1141-1156 (1978).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. 91 (1), (2017).</li><li>Roberts, P. L., Lloyd, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus+inactivation+by+protein+denaturants+used+in+affinity+chromatography.">Virus inactivation by protein denaturants used in affinity chromatography.</a> Biologicals. 35 (4), 343-347 (2007).</li><li>Baer, A., Kehn-Hall, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Viral+concentration+determination+through+plaque+assays:+using+traditional+and+novel+overlay+systems.">Viral concentration determination through plaque assays: using traditional and novel overlay systems.</a> J Vis Exp. (93), e52065 (2014).</li><li>Weger-Lucarelli, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+Characterization+of+Recombinant+Virus+Generated+from+a+New+World+Zika+Virus+Infectious+Clone.">Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone.</a> J Virol. , (2016).</li><li>Grubaugh, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+Drift+during+Systemic+Arbovirus+Infection+of+Mosquito+Vectors+Leads+to+Decreased+Relative+Fitness+during+Host+Switching.">Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching.</a> Cell Host Microbe. 19 (4), 481-492 (2016).</li></ol>

The authors have nothing to disclose.

Here we describe a method for the recovery of a bipartite infectious cDNA clone system for ZIKV. Previously described clones for ZIKV suffer from either attenuation or require the addition of introns, making plasmids larger and preventing rescue in insect cells. Infectious virus can be recovered using the two-plasmid clone system in either mammalian or insect cells (data not shown). In addition, virus recovered from this system behaves similarly to wild-type virus in several cell lines, in an immunocompromised mouse model and in mosquitoes. 
Due to the presence of cryptic bacterial promoters in flavivirus genomes3, full-length flavivirus clones are difficult to work with, commonly resulting in mutations, insertions, deletions or rearrangements in plasmids. We sought to alleviate these concerns by separating the ZIKV genome into two plasmids, disrupting the toxic sequences that are present in the viral NS1 gene. This resulted in a more stable system that is also amenable to incorporating changes. Using this clone system, we have introduced several point mutations in the ZIKV genome and inserted foreign sequences in the 3' UTR (data not shown). This system also provides an ideal starting point for studying genetic determinants of pathogenesis, construction of vaccine candidates and development of reporter viruses. Additionally, the clone-derived virus has proven to be an important tool for studying virus evolution22.
The methods described here can also be applied to new two-plasmid clone systems for other ZIKV strains or other flaviviruses, with some modifications. An important consideration for creating new virus clone systems using this approach is identifying a naturally occurring restriction enzyme site in the viral genome near the envelope-NS1 gene junction. If a suitable site cannot be found, then it is possible to generate one artificially via PCRmutagenesis. Alternatively, we have successfully rescued infectious virus by using Gibson assembly, if overlapping segments can be generated via restriction digestion (data not shown). Furthermore, it is necessary to include either a restriction enzyme cleavage site or a ribozyme sequence immediately downstream of the viral genome to ensure an authentic 3'UTR. 
By using a two-plasmid approach, we found that a stable and relatively straightforward cDNA clone system for ZIKV could be developed. The infectious virus recovered from the clone possessed wild-type characteristics in vitro and in vivo. Additionally, this approach can be adapted for any flavivirus, facilitating reverse genetics approaches for other relevant viruses.

Zika virus (ZIKV; Family Flaviviridae: Genus Flavivirus) is a mosquito-borne flavivirus that arrived in Brazil in 2013-14 and was subsequently associated with a massive outbreak of febrile illness that spread throughout the Americas1. In addition, ZIKV has been linked with severe disease outcomes, such as Guillain-Barr&#233; syndrome in adults and microcephaly in fetuses and neonates2. Little was known about ZIKV before its rapid spread in the western hemisphere. This included a lack of molecular tools, thus hindering mechanistic research. Molecular tools for viruses, such as infectious cDNA clones, facilitate vaccine and antiviral therapeutic development, and allow for the assessment of viral genetic factors related to differential viral pathogenesis, immune response and viral evolution.
Flavivirus infectious clones are known to be highly unstable in bacteria due to cryptic prokaryotic promoters present in their genomes3. Several approaches have been used to ameliorate this problem; including insertion of tandem repeats upstream of viral sequences4, mutation of putative prokaryotic promoter sequences5, splitting the genome into multiple plasmids6, low-copy number vectors (including bacterial artificial chromosomes)7,8 and insertion of introns in the viral genome9. One full-length system without modifications has been described for ZIKV; however, this clone appeared to be attenuated in cell culture and in mice10. Other groups have engineered introns into the ZIKV genome, allowing for disruption of unstable sequences in bacteria that can be spliced out in mammalian cells in vitro for the production of infectious virus11,12. Additionally, a PCR-based system entitled Infectious-Subgenomic-Amplicons has been used successfully to rescue the prototype MR766 strain of ZIKV13. The approach described here requires no foreign sequences, but rather disrupts the genome at the region of high instability by using multiple plasmids, which has previously been used successfully with yellow fever6, dengue14,15 and West Nile viruses16. Furthermore, the addition of the hepatitis D ribozyme sequence at the viral genomic termini facilitates the creation of an authentic 3&#39; end without the need for the addition of a linearization site. Additionally, both plasmids are constructed in a low-copy number vector (pACYC177, ~15 copies per cell) to mitigate any residual toxicity17. The virus recovered displays a growth profile comparable to parental virus in in vitro growth curves in 8 cell lines comprising a variety of cell-types derived from both mammals and insects, and has exhibited identical pathogenic profiles in mice and infection, dissemination and transmission rates in mosquitoes18.
Herein, we detail a protocol describing how to grow the infectious clone plasmids, generate full-length viral RNA (the viral genome) in vitro, and recover infectious virus in cell culture. First, we describe the propagation of plasmids in bacteria or bacteria-free amplification using rolling circle amplification (RCA). Next, we show how the two plasmids are digested and then subsequently ligated together to generate full-length virus. Finally, we describe the production of transcribed RNA and its subsequent electroporation into Vero cells, followed by titration of recovered virus (Figure 1). The approach described is rapid, allowing for recovery of infectious virus stocks in 1-2 weeks.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NEB Stable CompetentE. coli</td>
			<td>New England BioLabs</td>
			<td>C3040H</td>
			<td></td>
		</tr>
		<tr>
			<td>Carbenicillin, Disodium Salt</td>
			<td>various</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zyppy Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4036</td>
			<td></td>
		</tr>
		<tr>
			<td>ZymoPURE Plasmid Maxiprep Kit</td>
			<td>Zymo Research</td>
			<td>D4202</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI-HF</td>
			<td>New England BioLabs</td>
			<td>R3138S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>NheI-HF</td>
			<td>New England BioLabs</td>
			<td>R3131S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>ApaLI</td>
			<td>New England BioLabs</td>
			<td>R0507S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>EcoRI-HF</td>
			<td>New England BioLabs</td>
			<td>R3101S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>BamHI-HF</td>
			<td>New England BioLabs</td>
			<td>R3136S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>HindIII-HF</td>
			<td>New England BioLabs</td>
			<td>R3104S</td>
			<td>20,000 units/ml</td>
		</tr>
		<tr>
			<td>illustra TempliPhi 100 Amplification Kit</td>
			<td>GE Healthcare Life Sciences</td>
			<td>25640010</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoSpin Gel and PCR Clean-up</td>
			<td>Macherey-Nagel</td>
			<td>740609.5</td>
			<td></td>
		</tr>
		<tr>
			<td>Shrimp Alkaline Phosphatase (rSAP)</td>
			<td>New England BioLabs</td>
			<td>M0371S</td>
			<td>1,000 units/ml</td>
		</tr>
		<tr>
			<td>Alkaline Phosphatase, Calf Intestinal (CIP)</td>
			<td>New England BioLabs</td>
			<td>M0290S</td>
			<td>10,000 units/ml</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase</td>
			<td>New England BioLabs</td>
			<td>M0202S</td>
			<td>400,000units/mL</td>
		</tr>
		<tr>
			<td>HiScribe T7 ARCA mRNA Kit</td>
			<td>New England BioLabs</td>
			<td>E2065S</td>
			<td></td>
		</tr>
		<tr>
			<td>Vero cells</td>
			<td>ATCC</td>
			<td>CCL-81</td>
			<td></td>
		</tr>
		<tr>
			<td>ECM 630 High Throughput Electroporation System</td>
			<td>BTX</td>
			<td>45-0423</td>
			<td>Other machines are acceptable.</td>
		</tr>
		<tr>
			<td>LB Broth with agar (Miller)</td>
			<td>Sigma</td>
			<td>L3147</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Terrific Broth</td>
			<td>Sigma</td>
			<td>T0918</td>
			<td>Can be homemade as well.</td>
		</tr>
		<tr>
			<td>Petri Dish</td>
			<td>Celltreat</td>
			<td>229693</td>
			<td></td>
		</tr>
		<tr>
			<td>Culture Tubes</td>
			<td>VWR International</td>
			<td>60818-576</td>
			<td></td>
		</tr>
		<tr>
			<td>T75 flasks</td>
			<td>Celltreat</td>
			<td>229340</td>
			<td></td>
		</tr>
		<tr>
			<td>T182 flasks</td>
			<td>Celltreat</td>
			<td>229350</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS</td>
			<td>Corning</td>
			<td>21-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 with L-glutamine</td>
			<td>Corning</td>
			<td>10-040-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM with L-glutamine and 4.5 g/L glucose</td>
			<td>Corning</td>
			<td>10-017-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum (FBS)</td>
			<td>Atlas Biologicals</td>
			<td>FP-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>Tragacanth Powder</td>
			<td>MP Bio</td>
			<td>MP 104792</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Violet</td>
			<td>Amresco</td>
			<td>0528-1006</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol Denatured</td>
			<td>VWR International</td>
			<td>BDH1156-1LP</td>
			<td></td>
		</tr>
		<tr>
			<td>6 well plate</td>
			<td>Celltreat</td>
			<td>229106</td>
			<td></td>
		</tr>
		<tr>
			<td>12 well plate</td>
			<td>Celltreat</td>
			<td>229111</td>
			<td></td>
		</tr>
		<tr>
			<td>Sequencing Oligos</td>
			<td>IDT</td>
			<td>see table 1</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 3.0</td>
			<td>ThermoFisher</td>
			<td>Qubit 3.0</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit dsDNA BR Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32850</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>ThermoFisher</td>
			<td>Q32852</td>
			<td>other methods are acceptable.</td>
		</tr>
		<tr>
			<td>Class II Biosafety Cabinet</td>
			<td>Varies</td>
			<td>N/A</td>
			<td>This is necessary for live-virus work.</td>
		</tr>
	</tbody>
</table>

rescue and characterization of recombinant virus from a new world zika virus infectious clone

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral evolution. Here we describe the construction of an infectious clone for Zika virus (ZIKV), which is currently causing an explosive outbreak in the Americas. To prevent toxicity to bacteria that is commonly observed with flavivirus-derived plasmids, we generated a two-plasmid system which separates the genome at the NS1 gene and is more stable than full-length constructs that could not be successfully recovered without mutations. After digestion and ligation to join the two fragments, full-length viral RNA can be generated by in vitro transcription with T7 RNA polymerase. Following electroporation of transcribed RNA into cells, virus was recovered that exhibited similar in vitro growth kinetics and in vivo virulence and infection phenotypes in mice and mosquitoes, respectively.

The protocol described here allows for the recovery of infectious clone-derived Zika virus. Manipulating the two-plasmid infectious clone system is straightforward when performed with care, as compared to full-length versions which are highly unstable (data not shown). After digestion and ligation of the two distinct pieces, capped RNA is produced using in vitro transcription with T7 polymerase which is then electroporated into Vero cells (Figure 1). Correct plasmid sequence can be monitored using restriction digestion as a proxy following miniprep (Figure 2a) and via Sanger sequencing after large-scale DNA production with RCA or maxiprep. After confirmation of the clones by sequencing, recovery of infectious virus requires only digestion, ligation, in vitro transcription and finally electroporation. These steps can be performed in one day. Correct digestion and ligation can be monitored by agarose gel electrophoresis (Figure 2b), allowing for troubleshooting, if necessary.
As shown in Figure 3, infectious clone-derived virus replicates to similar levels as the parental isolate in vitro in several cell lines, suggesting that the recovered virus from the cDNA replicates similarly to primary isolate. Additionally, no significant differences were observed between the infectious clone-derived virus and the parental isolate in rates of survival in mice or rates of infection, dissemination and transmission in Aedes aegypti mosquitoes (Figure 4).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55857/55857fig1.jpg" /> 
Figure 1: Workflow of ZIKV rescue from a two-plasmid cDNA clone. The genome of ZIKV strain PRVABC59 was cloned in two-separate pieces into a pACYC177 plasmid backbone. The two plasmids were then digested and ligated with T4 DNA ligase. Capped-infectious RNA was then produced via in vitro transcription followed by electroporation into Vero cells. (Figure adapted from reference21). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55857/55857fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55857/55857fig2.jpg" /> 
Figure 2: Gel electrophoresis to monitor digestion and ligation of cDNA clone. (A) Initial restriction digestion of miniprep derived plasmids to assess genetic stability. (B) Examples of digestion and ligation products during recovery of infectious virus from the two-plasmid clone system. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55857/55857fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/55857/55857fig3.jpg" /> 
Figure 3: In vitro growth kinetics of clone-derived virus. Growth kinetics of wild type PRVABC59 and infectious clone derived virus on human (SH-SY5Y, Jar and NTERA2 cI.D1), mosquito (C6/36, Aag2) and non-human primate (Vero) cell lines were assessed by plaque assay. n = 3 Error bars represent standard deviation from the mean. (Figure adapted from reference21). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55857/55857fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/55857/55857fig4.jpg" /> 
Figure 4: In vivo characterization of clone-derived virus in mice and mosquitoes. (A) 4-week-old male and female interferon alpha, beta and gamma receptor knockout,AG129, mice were intraperitoneally inoculated with 1,000 PFU of PRVABC59 or the infectious clone-derived virus and monitored over time for survival (n=11). Aedes aegypti mosquitoes were given an infectious bloodmeal containing ZIKV and dissected 14 days later. (B) Plaque assays were used to assess mosquito bodies (infection), legs (dissemination) or salivary secretions (transmission) for infectious virus. Rates are presented as the percent of the total mosquitoes that were tested (Figure adapted from reference21). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55857/55857fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone at JoVE.com

Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Infectious cDNA clones allow for genetic manipulation of a virus, thus facilitating work on vaccines, pathogenesis, replication, transmission and viral ...

rescue-characterization-recombinant-virus-from-new-world-zika-virus

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

9.6K Views.  Colorado State University. This protocol describes the recovery of infectious Zika virus from a two-plasmid infectious cDNA clone.

Video: Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Detection of Infectious Virus from Field-collected Mosquitoes by Vero Cell Culture Assay

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many of these viruses have intensified in their endemic ranges and expanded to new territories, necessitating effective surveillance and control programs to respond to these threats. One strategy to monitor virus activity involves collecting large numbers of mosquitoes from endemic sites and testing them for viral infection. In this article, we describe how to handle, process, and screen field-collected mosquitoes for infectious virus by Vero cell culture assay. Mosquitoes are sorted by trap location and species, and grouped into pools containing &le;50 individuals. Pooled specimens are homogenized in buffered saline using a mixer-mill and the aqueous phase is inoculated onto confluent Vero cell cultures (Clone E6). Cell cultures are monitored for cytopathic effect from days 3-7 post-inoculation and any viruses grown in cell culture are identified by the appropriate diagnostic assays. By utilizing this approach, we have isolated 9 different viruses from mosquitoes collected in Connecticut, USA, and among these, 5 are known to cause human disease. Three of these viruses (West Nile virus, Potosi virus, and La Crosse virus) represent new records for North America or the New England region since 1999. The ability to detect a wide diversity of viruses is critical to monitoring both established and newly emerging viruses in the mosquito population.

We describe a method to process and screen field-collected mosquitoes for a diversity of viruses by Vero cell culture assay. By employing this technique, we have detected 9 different viruses from 4 taxonomic families in mosquitoes collected in Connecticut.

Mosquitoes transmit a number of distinct viruses including important human pathogens such as West Nile virus, dengue virus, and chickungunya virus. Many ...

Visualizing Dengue Virus through Alexa Fluor Labeling

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that influence this interaction could lead to improved understanding of disease pathogenesis and thus influence vaccine or therapeutic design. Hence, the development 
of methods to probe this interaction would be useful. Recent advancements in fluorophores development1-3 and imaging technology4 can be exploited to 
improve our current knowledge on dengue pathogenesis and thus pave the way to reduce the millions of dengue infections occurring annually.

The enveloped dengue virus has an external scaffold consisting of 90 envelope glycoprotein (E) dimers protecting the nucleocapsid shell, 
which contains a single positive strand RNA genome5. The identical protein subunits on the virus surface can thus be labeled with an amine reactive dye and visualized 
through immunofluorescent microscopy. Here, we present a simple method of labeling of dengue virus with Alexa Fluor succinimidyl ester dye dissolved directly in a sodium 
bicarbonate buffer that yielded highly viable virus after labeling. There is no standardized procedure for the labeling of live virus and existing manufacturer&#x2019;s protocol 
for protein labeling usually requires the reconstitution of dye in dimethyl sulfoxide. The presence of dimethyl sulfoxide, even in minute quantities, can block 
productive infection of virus and also induce cell cytotoxicity6. The exclusion of the use of dimethyl sulfoxide in this protocol thus reduced this possibility. 
Alexa Fluor dyes have superior photostability and are less pH-sensitive than the common dyes, such as fluorescein and rhodamine2, making them ideal for 
studies on cellular uptake and endosomal transport of the virus. The conjugation of Alexa Fluor dye did not affect the recognition of labeled dengue 
virus by virus-specific antibody and its putative receptors in host cells7. This method could have useful applications in virological studies.

Taking advantage of the advancements in fluorophore development and imaging technology, a simple method of Alexa Fluor labeling of dengue virus was devised to visualize the early interactions between virus and cell.

The early events in the interaction between virus and cell can have profound influence on the outcome of infection. Determining the factors 
that ...

Propagating and Detecting an Infectious Molecular Clone of Maedi-visna Virus that Expresses Green Fluorescent Protein

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in vivo are considered to be of the monocyte lineage2. Certain strains of MVV can replicate in other cell types, however3,4. The green fluorescent protein is a commonly used marker for studying lentiviruses in living cells. We have inserted the egfp gene into the gene for dUTPase of MVV. The dUTPase gene is well conserved in most lentivirus strains of sheep and goats and has been shown to be important in replication of CAEV5. However, dUTPase has been shown to be dispensable for replication of the molecular clone of MVV used in this study both in vitro and in vivo6. MVV replication is strictly confined to cells of sheep or goat origin. We use a primary cell line from the choroid plexus of sheep (SCP cells) for transfection and propagation of the virus7. The fluorescent MVV is fully infectious and EGFP expression is stable over at least 6 passages8. There is good correlation between measurements of TCID50 and EGFP. This virus should therefore be useful for rapid detection of infected cells in studies of cell tropism and pathogenicity in vitro and in vivo8.

We describe a molecular clone of maedi-visna virus that expresses GFP and is fully infectious. Replication of this virus can be detected by using fluorescence microscopy and flow cytometry.

Maedi-visna virus (MVV) is a lentivirus of sheep, causing slowly progressive interstitial pneumonia and encephalitis1. The primary target cells of MVV in ...

Rescue of Recombinant Newcastle Disease Virus from cDNA

Newcastle disease virus (NDV), the prototype member of the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented, negative-sense, single-stranded, enveloped RNA virus (Figure 1) with potential applications as a vector for vaccination and treatment of human diseases. In-depth exploration of these applications has only become possible after the establishment of reverse genetics techniques to rescue recombinant viruses from plasmids encoding their complete genomes as cDNA2-5. Viral cDNA can be conveniently modified in vitro by using standard cloning procedures to alter the genotype of the virus and/or to include new transcriptional units. Rescue of such genetically modified viruses provides a valuable tool to understand factors affecting multiple stages of infection, as well as allows for the development and improvement of vectors for the expression and delivery of antigens for vaccination and therapy. Here we describe a protocol for the rescue of recombinant NDVs.

Newcastle disease virus (NDV) has been extensively studied in the last few years in order to develop new vectors for vaccination and therapy, among others. These studies have been possible due to techniques to rescue recombinant virus from cDNA, such as those we describe here.

Newcastle disease virus (NDV), the prototype member of  the Avulavirus genus of the family Paramyxoviridae1, is a non-segmented,  negative-sense, ...

Neutrophil Isolation and Analysis to Determine their Role in Lymphoma Cell Sensitivity to Therapeutic Agents

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of inflammation. They are key players in the innate immune system and play major roles in cancer biology. Neutrophils have been proposed as key mediators of malignant transformation, tumor progression, angiogenesis and in the modulation of the antitumor immunity; through their release of soluble factors or their interaction with tumor cells. To characterize the specific functions of neutrophils, a fast and reliable method is coveted for in vitro isolation of neutrophils from human blood. Here, a density gradient separation method is demonstrated to isolate neutrophils as well as mononuclear cells from the blood. The procedure consists of layering the density gradient solution such as Ficoll carefully above the diluted blood obtained from patients diagnosed with chronic lymphocytic leukemia (CLL), followed by centrifugation, isolation of mononuclear layer, separation of neutrophils from RBCsby dextran then lysis of residual erythrocytes. This method has been shown to isolate neutrophils &#8805; 90 % pure. To mimic the tumor microenvironment, 3-dimensional (3D) experiments were performed using basement membrane matrix such as Matrigel. Given the short half-life of neutrophils in vitro, 3D experiments with fresh human neutrophils cannot be performed. For this reason promyelocytic HL60 cells are differentiated along the granulocytic pathway using the differentiation inducers dimethyl sulfoxide (DMSO) and retinoic acid (RA). The aim of our experiments is to study the role of neutrophils on the sensitivity of lymphoma cells to anti-lymphoma agents. However these methods can be generalized to study the interactions of neutrophils or neutrophil-like cells with a large range of cell types in different situations.

Neutrophils are the most abundant type of white blood cells. The isolation of neutrophils from human blood by density gradient separation method and the differentiation of human promyelocytic (HL60) cells along the granulocytic pathway are described here; to test their role on sensitivity of lymphoma cells to anti-lymphoma agents.

Neutrophils are the most abundant (40% to 75%) type of white blood cells and among the first inflammatory cells to migrate towards the site of ...

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV is an RNA virus of the Flaviviridae family. ZIKV is mainly transmitted by mosquitoes, but can also be spread by maternal to fetal vertical transmission as well as sexual contact. To date, there are no reliable treatment or vaccine options available to protect those infected by the virus. The development of a reproducible, effective Zika virus infectious cell culture system is critical for studying the molecular mechanisms of ZIKV replication as well as drug and vaccine development. In this regard, a protocol describing a mammalian cell-based in vitro Zika virus culture system for viral production and growth analysis is reported here. Details on the formation of plaques by Zika virus on a cell monolayer and plaque assay for measuring viral titer are presented. Viral genome replication kinetics and double-stranded RNA genome replicatory intermediates are determined. This culture platform was utilized to screen against a library of a small set of cytokines resulting in the identification of interferon-&#945; (IFN-&#945;), IFN-&#946; and IFN-&#947; as potent inhibitors of Zika viral growth. In summary, an in vitro infectious Zika viral culture system and various virological assays are demonstrated in this study, which has the potential to greatly benefit the research community in elucidating further the mechanisms of viral pathogenesis and the evolution of viral virulence. Antiviral IFN-alpha can further be evaluated as a prophylactic, post-exposure prophylactic, and treatment option for Zika virus infections in high-risk populations, including infected pregnant women.

Zika Virus Infectious Cell Culture System and the In Vitro Prophylactic Effect of Interferons

Zika Virus (ZIKV), an emerging pathogen, is linked to fetal developmental abnormalities and microcephaly. The establishment of an effective infectious cell culture system is crucial for studies of ZIKV replication as well as vaccine and drug development. In this study, various virological assays pertaining to ZIKV are illustrated and discussed.

Zika Virus (ZIKV) is an emerging pathogen that is linked to fetal developmental abnormalities such as microcephaly, eye defects, and impaired growth. ZIKV ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

Rapid, Safe, and Simple Manual Bedside Nucleic Acid Extraction for the Detection of Virus in Whole Blood Samples

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for the rapid bedside inactivation of the Ebola virus during blood sampling for safe nucleic acid (NA) tests by adding a commercial lysis/binding buffer directly into the vacuum blood collection tubes. Using this bedside inactivation approach, we have developed a safe, rapid, and simplified bedside NA extraction method for the subsequent detection of a virus in lysis/binding buffer-inactivated whole blood. The NA extraction is directly performed in the blood collection tubes and requires no equipment or electricity. 
After the blood is collected into the lysis/binding buffer, the contents are mixed by flipping the tube by hand, and the mixture is incubated for 20 min at room temperature. Magnetic glass particles (MGPs) are added to the tube, and the contents are mixed by flipping the collection tube by hand. The MGPs are then collected on the side of the blood collection tube using a magnetic holder or a magnet and a rubber band. The MGPs are washed three times, and after the addition of elution buffer directly into the collection tube, the NAs are ready for NA tests, such as qPCR or isothermal loop amplification (LAMP), without the removal of the MGPs from the reaction. The NA extraction method is not dependent on any laboratory facilities and can easily be used anywhere (e.g., in field hospitals and hospital isolation wards). When this NA extraction method is combined with LAMP and a portable instrument, a diagnosis can be obtained within 40 min of the blood collection.

Here, we present a protocol for the rapid virus nucleic acid extraction from the virus-inactivated whole blood. The extraction is performed directly in the blood collection tubes and requires no equipment or electricity. The method is not dependent on laboratory facilities and can be used anywhere (e.g., in field hospitals).

The rapid diagnosis of an infection is essential for the outbreak management, risk containment, and patient care. We have previously shown a method for ...

Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought serious public safety concerns. Among the risk factors, antibody-dependent enhancement (ADE) poses the most significant threat, as the recent re-emergence of the Zika virus (ZIKV) is primarily in areas where the population has been exposed and is in a state of pre-immunity to other closely related flaviviruses, especially dengue virus (DENV). Here, we describe a protocol for quantifying the effect of human serum antibodies against DENV on ZIKV infection in primary human cells or cell lines.

We describe a method to evaluate the effect of pre-existing immunity against dengue virus on the Zika virus infection by using human serum, primary human cells, and infection quantification by quantitative real-time polymerase chain reaction.

The recent emergence of the flavivirus Zika and neurological complications, such as Guillain-Barr&#233; syndrome and microcephaly in infants, has brought ...