This work was supported by the Maureen and Ronald Hirsch family philanthropic contribution and Field Neurosciences Institute, St. Mary&#39;s of Michigan. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We also thank Dr. Bernadette Zwaans and Elijah Ward for their critical review of the manuscript.

All methods described here have been approved by the Institutional Review Board (IRB) of Beaumont Health. All experiments were performed in accordance with relevant guidelines and regulations.
CAUTION: All potentially infectious materials should be handled according to Biosafety Level 2 standards including the use of personal protective equipment. Any procedures which may produce aerosol should be performed in a biosafety cabinet. Additionally, work with live mosquitoes should be performed in the appropriate Arthropod Containment Level 1-3 facility. Given the association of ZIKV infection with congenital abnormalities, women who are pregnant, trying to conceive, or the partners of these women should significantly minimize their laboratory exposure to ZIKV. Transport of ZIKV samples is classified in the United States as Category B Biological Substances in accordance with Department of Transportation Hazardous Materials Regulations (49 CFR Part 171-180) and therefore shipping samples should adhere to those guidelines. Import into the United States of ZIKV biospecimens requires a Centers for Disease Control and Prevention (CDC) Import Permit. Import of any arthropods that could serve as a vector for ZIKV transmission, even if they are not infected, requires a United States Department of Agriculture (USDA) permit. This information is current at the time of publication. Up-to-date recommendations can be found at https://www.cdc.gov/zika/laboratories/lab-safety.html.
NOTE: RT-LAMP reactions are prone to higher rates of false positive reactions, so precautions should be taken in experimental planning. All set-up and execution of RT-LAMP reactions should use designated pipettes and filter tips. Ideally, a lateral work flow should be established. If possible, analysis and imaging (Section 5) should occur in a separate enclosed room to prevent contamination. Opening of test tubes containing RT-LAMP products should be kept to a minimum.
1. RT-LAMP Primer Preparation
<ol>
	<li>Reconstitute each lyophilized RT-LAMP primer in molecular grade water to a final concentration of 100 &#181;M (Table 1). Briefly vortex the primer solution to ensure a homogenous solution and briefly spin down the solution at maximum speed in a table top centrifuge to collect all primer solution.</li>
	<li>Prepare a 10x RT-LAMP Primer Mix of the FIP, BIP, F3, B3, LF, and LB primers using the volumes in Table 2. Briefly vortex the primer solution to ensure a homogenous solution, and briefly spin down the solution at maximum speed in a table top centrifuge to avoid any loss. 
	NOTE: The RT-LAMP primer set for Ae. aegypti actin (AEDAE) does not contain a LB primer (loop primers are not always necessary for RT-LAMP reactions). In this case, replace the LB primer volume with molecular grade water.</li>
	<li>Store the primers at -20 &#176;C between uses and avoid free-thaw cycles.</li>
</ol>
2. Sample Preparation
<ol>
	<li>For human urine samples: Use either fresh urine, frozen urine, or urine in preservative. For fresh or frozen sample: immediately spin down the sample after the collection for 10 min at 700 x g, and use the supernatant for analysis or freeze at -80 &#176;C for future use. Thaw frozen samples on ice before use.</li>
	<li>For human serum samples: Use either fresh or frozen serum samples.</li>
	<li>For ZIKV infected cell lines: Use either conditioned media or cell lysates. 
	NOTE: Cell-free conditioned media from Ae. albopictus C6/36 cells 8 days post-infection can be used as positive controls for ZIKV RT-LAMP reactions.</li>
	<li>For Ae. aegypti mosquitoes: Use either whole fresh or frozen mosquito carcasses. Thaw frozen mosquitoes on ice. Prepare a crude mosquito lysate by placing an individual mosquito in 100 &#181;L of phosphate-buffered saline (PBS) and homogenize by crushing the mosquito 10 times with a P10 pipet tip (Figure 1). Briefly centrifuge the crude lysate to pellet any debris. Use the supernatant for downstream RT-LAMP analysis. 
	Note: Positive controls can be generated in a laboratory setting by infecting female mosquitoes using intrathoracic microinjection with approximately 103 genome equivalents of virus in a volume of 200 nL and harvesting the mosquito 5 days post-infection.</li>
</ol>
3. Prepare RT-LAMP Master Mix
<ol>
	<li>Prepare a RT-LAMP master mix reaction on ice for each primer set to be used by using volume guide in Table 3. 
	NOTE: The use of thermolabile Uracil DNA Glycosylase (UDG) assists in preventing false positives.</li>
	<li>Vortex briefly to ensure that all samples are well mixed, then spin down briefly to prevent volume loss.</li>
</ol>
4. RT-LAMP Assay
<ol>
	<li>Pipet 23.0 &#181;L of the RT-LAMP master mix per reaction into a 200 &#181;L PCR tube. Add 2.0 &#181;L of sample (urine, serum, or crude mosquito lysate supernatant as described in Step 2). This will bring the total volume to 25.0 &#181;L per RT-LAMP reaction. For the negative control, use molecular grade water. Include a positive control. 
	&#8203;NOTE: A PCR standard or virus stocks from supernatant of infected cell lines can be used as a positive control.
	<ol>
		<li>Optional: Include a specificity control reaction of a related arbovirus such as dengue virus (DENV). Prepare the sample as outlined in Step 2 according to sample type. Add 2.0 &#181;L of the specificity control to 23.0 &#181;L of the RT-LAMP master mix into a 200 &#181;L PCR tube.</li>
	</ol>
	</li>
	<li>Heat the samples at 61 &#176;C for 30 min using a heat block, water bath, or thermocycler.</li>
	<li>Heat deactivate the polymerase by heating to 80 &#176;C for 10 min.</li>
</ol>
5. RT-LAMP Analysis
NOTE: Perform RT-LAMP analysis in a separate, enclosed space.
<ol>
	<li>After the incubation, access RT-LAMP reactions visually by looking for the presence of a color change.
	<ol>
		<li>Dilute the fluorescent nucleic acid dye 1:10 in TAE (40 mM Tris, 20 mM acetic acid, 1 mM EDTA) buffer. 
		CAUTION: Any nucleic acid stain binds to nucleic acids and therefore is a carcinogen. Wear gloves when handling.</li>
		<li>To 12 &#181;L of the RT-LAMP reaction, add 2 &#181;L of fluorescent nucleic acid dye dilution. 
		NOTE: Negative reactions will be orange in color and positive reactions will be yellow/green in color.</li>
		<li>Optional: Take pictures of RT-LAMP reactions on a white background using a camera.</li>
	</ol>
	</li>
	<li>Place the samples under 302 nm UV light to confirm the presence of RT-LAMP products by fluorescence. Take picture of the result using a camera. 
	NOTE: Positive RT-LAMP reactions will have a fluorescent output. 
	CAUTION: Wear UV protective eye googles or face shield when working with UV light.</li>
	<li>Optional: Confirm the presence of RT-LAMP products by performing gel electrophoresis on the samples.
	<ol>
		<li>Pour a 2% agarose gel in 1x TAE buffer with a nucleic acid stain for visualization. 
		CAUTION: Any nucleic acid stain binds to nucleic acids and therefore is a carcinogen. Wear gloves when handling.</li>
		<li>Add 5 &#181;L of a DNA ladder in the first lane to compare the molecular weights.</li>
		<li>For each RT-LAMP reaction, mix 13 &#181;L of RT-LAMP reaction mixture with 2 &#181;L of DNA loading dye. Load the 15 &#181;L mixture containing the DNA loading dye.</li>
		<li>Run the gel at 90 V for 90 min or until the bands are separated and image with 302 nm UV light. 
		NOTE: Positive RT-LAMP reactions will have a laddering pattern. Negative RT-LAMP reactions should not contain any bands.</li>
	</ol>
	</li>
</ol>
6. Disposal
<ol>
	<li>Dispose of RT-LAMP reactions in double sealed bags. Do not autoclave as this may aerosolize the RT-LAMP products, leading to false positive reactions in the future.</li>
</ol>

<ol>
	<li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> New England Journal of Medicine. 374 (16), 1552-1563 (2016).</li><li>Francois, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robustness+of+a+loop-mediated+isothermal+amplification+reaction+for+diagnostic+applications.">Robustness of a loop-mediated isothermal amplification reaction for diagnostic applications.</a> Federation of European Microbiological Societies Immunology and Medical Microbiology. 62 (1), 41-48 (2011).</li><li>Tomita, N., Mori, Y., Kanda, H., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+of+gene+sequences+and+simple+visual+detection+of+products.">Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products.</a> Nature Protocols. 3 (5), 877-882 (2008).</li><li>Gandasegui, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rapid-Heat+LAMPellet+Method:+A+Potential+Diagnostic+Method+for+Human+Urogenital+Schistosomiasis.">The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis.</a> Public Library of Science Neglected Tropical Diseases. 9 (7), 0003963 (2015).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> The Journal of Visualized Experiments. (96), (2015).</li><li>Lamb, L. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+Detection+of+Zika+Virus+in+Urine+Samples+and+Infected+Mosquitos+by+Reverse+Transcription-Loop-Mediated+Isothermal+Amplification.">Rapid Detection of Zika Virus in Urine Samples and Infected Mosquitos by Reverse Transcription-Loop-Mediated Isothermal Amplification.</a> Scientific Reports. 8 (1), 3803 (2018).</li><li>Faye, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+RT-PCR+for+detection+of+Zika+virus.">One-step RT-PCR for detection of Zika virus.</a> Journal of Clinical Virology. 43 (1), 96-101 (2008).</li><li>Schrader, C., Schielke, A., Ellerbroek, L., Johne, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+inhibitors+-+occurrence,+properties+and+removal.">PCR inhibitors - occurrence, properties and removal.</a> Journal of Applied Microbiology. 113 (5), 1014-1026 (2012).</li><li>Poole, C. B., Tanner, N. A., Zhang, Y., Evans, T. C., Carlow, C. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diagnosis+of+brugian+filariasis+by+loop-mediated+isothermal+amplification.">Diagnosis of brugian filariasis by loop-mediated isothermal amplification.</a> Public Library of Science Neglected Tropical Diseases. 6 (12), 1948 (2012).</li><li>Tanner, N. A., Zhang, Y., Evans, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+multiple+target+detection+in+real-time+loop-mediated+isothermal+amplification.">Simultaneous multiple target detection in real-time loop-mediated isothermal amplification.</a> Biotechniques. 53 (2), 81-89 (2012).</li><li>Chan, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid,+Affordable+and+Portable+Medium-Throughput+Molecular+Device+for+Zika+Virus.">Rapid, Affordable and Portable Medium-Throughput Molecular Device for Zika Virus.</a> Scientific Reports. 6, 38223 (2016).</li><li>Lee, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+Highly+Sensitive+Molecular+Diagnosis+of+Zika+Virus+by+Lateral+Flow+Assays.">Simple and Highly Sensitive Molecular Diagnosis of Zika Virus by Lateral Flow Assays.</a> Analytical Chemistry. 88 (24), 12272-12278 (2016).</li><li>Pardee, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Low-Cost+Detection+of+Zika+Virus+Using+Programmable+Biomolecular+Components.">Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components.</a> Cell. 165 (5), 1255-1266 (2016).</li><li>Song, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Instrument-Free+Point-of-Care+Molecular+Detection+of+Zika+Virus.">Instrument-Free Point-of-Care Molecular Detection of Zika Virus.</a> Analytical Chemistry. 88 (14), 7289-7294 (2016).</li><li>Yaren, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Point+of+sampling+detection+of+Zika+virus+within+a+multiplexed+kit+capable+of+detecting+dengue+and+chikungunya.">Point of sampling detection of Zika virus within a multiplexed kit capable of detecting dengue and chikungunya.</a> BioMed Central Infectious Diseases. 17 (1), 293 (2017).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+and+sensitive+detection+of+Zika+virus+by+reverse+transcription+loop-mediated+isothermal+amplification.">Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification.</a> Journal of Virological Methods. 238, 86-93 (2016).</li><li>Priye, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+smartphone-based+diagnostic+platform+for+rapid+detection+of+Zika,+chikungunya,+and+dengue+viruses.">A smartphone-based diagnostic platform for rapid detection of Zika, chikungunya, and dengue viruses.</a> Scientific Reports. 7, 44778 (2017).</li></ol>

LEL and MBC have intellectual property on Zika virus diagnosis methods. The remaining authors have no competing interests.

The ZIKV RT-LAMP assay described in this paper works using both human and mosquito samples6. The limit of detection was approximately 1 genome equivalent6, which should be sufficient since the typical viral load of a symptomatic ZIKV infected patient is 103 to&#160;106 PFU/mL7. Additionally, this method can detect ZIKV in samples without first isolating RNA and without virus amplification in cell culture. This significantly decreases the time, cost, and health risks of this assay compared to qRT-PCR.
Urine samples used at the volume ratio indicated in this protocol should allow RT-LAMP reactions to occur without an RNA isolation. While one could theoretically increase the amount of sample used in an RT-LAMP reaction, care should be exercised when this sample is urine. Urine contains multiple chemicals that could inhibit PCR reactions; urea in the urine is known to degrade polymerases8 and using a urine/RT-LAMP reaction ratio that is too high will prevent the RT-LAMP reaction. If a low amount of virus is expected, it would be better to perform an RNA isolation using a kit specific for urine. Similarly, serum can contain PCR inhibitors that may inhibit RT-LAMP when serum is used at a higher volume8.
Included in this protocol is the inclusion of quality controls for RT-LAMP reactions, akin to a loading control in western blotting protocols. If a clinical sample is negative for the RT-LAMP quality control, then a negative reaction for the ZIKV RT-LAMP may be a false negative as the sample may contain a high amount of PCR inhibitors or low amounts of total RNA. It is not necessary to isolate RNA from the sample prior to the RT-LAMP assay. The representative RT-LAMP results in this protocol were obtained without RNA isolation. However, RNA isolation may improve the detection in samples with low virus load or that may contain high levels of PCR inhibitors. For most sample types including serum, an RNA isolation kit can be used following the manufacturer&#39;s suggested protocol. For urine samples, an RNA isolation kit specific for urine samples should be used. For mosquito samples, it is recommended to lyse the mosquito by running the mosquito in 100 &#181;L of PBS through a shredding column for 2 min at maximum speed or douncing before RNA isolation. RNA can be eluted in 30 &#181;L of elution buffer and stored at -80 &#176;C until use.
RNA isolation is then suggested to remove the endogenous PCR inhibitors or concentrate the RNA prior to RT-LAMP. If the RT-LAMP quality control is still negative, then qRT-PCR should be used for ZIKV detection.
The RT-LAMP primers in this protocol have been confirmed to work at a range of temperatures (57&#8211;65 &#176;C) and incubation times (8-60 min), as well as using unconventional heating sources (e.g., flameless ration heater, water bath) outside standard laboratory conditions. All the temperatures tested gave comparable results. Based on the detection by visual color change alone, the optimal time for the detection of ZIKV RT-LAMP products was 30 min. However, the detection by UV light excitation or banding patterns on gels were positive with as little as 8 min total incubation time. Some RT-LAMP protocols include DMSO, but in this protocol, it can result in the inhibition of the RT-LAMP reaction. Using a thermophilic DNA polymerase that can be set up at room temperature may have advantages over wild-type thermophilic DNA polymerase including faster amplification signals and have increased stability at room temperature9,10. Ethidium bromide can be used instead for nucleic acid visualization in 2% agarose gels, however, other fluorescent nucleic acid dyes for agarose gels have lower mutagenic potential making them a safer choice. However, appropriate safety precautions such as wearing gloves should still be used.
A limitation of this protocol is that it is a qualitative and not a quantitative technique, however, relative quantification can be done6. Furthermore, RT-LAMP primers are highly specific and were designed against a highly conserved sequence of the nonstructural protein 5 of ZIKV that is found in 16 strains and verified to work in at least 5 strains6. It is possible that extensive mutations to ZIKV in the wild may not be detectable by these primers in the future. Other groups have also developed new technologies for the detection of ZIKV that may be of interest11,12,13,14,15,16,17.
In summary, this protocol provides a fast, simple, and cost-effective method for ZIKV in a variety of sample types that does not require specialized equipment. This provides a new diagnostic tool for ZIKV detection in which RNA does not have to be isolated before the RT-LAMP reaction.

In 2015, Zika virus (ZIKV) gained prominent global attention as an infectious disease of concern because infection during pregnancy was linked to miscarriage, stillbirth, severe neurological birth defects including microcephaly, as well as other congenital birth defects1. In rare cases, ZIKV has been associated with Guillain-Barr&#233; syndrome. ZIKV is primarily transmitted by Aedes mosquitoes; however, it can also be spread through sexual contact1. Given that the infection with ZIKV is asymptomatic in most people or presents with mild flu-like symptoms that overlap with the symptoms of infection of other arborviruses1, there was a need for improved methods for rapid and cost-effective detection of ZIKV to screen both people as well as local mosquito populations.
Quantitative reverse transcription PCR (qRT-PCR) is a reliable assay for ZIKV detection; however, this technique requires expensive specialized equipment, trained personnel, and RNA isolation from the sample of interest. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) is a one-step nucleic acid amplification method based on PCR technology that only requires one incubation temperature due to the use of a thermophilic DNA polymerase with strand displacement properties. This circumvents the need for a thermocycler and decreases the length of time needed to complete the assay. Additional advantages of RT-LAMP include its high specificity and sensitivity, robustness at a range of pH levels and temperatures, and resistance to many PCR inhibitors2. It has a relatively low cost and reagents are stable at room temperature. Given these characteristics, RT-LAMP can be deployed in a laboratory or in the field. As such, LAMP reactions have been developed to detect a range of pathogens and other types of infection3,4,5. The goal of the RT-LAMP protocol described in this paper is to detect ZIKV without RNA isolation in human serum and urine samples as well as in a single infected mosquito within 30 min through RT-LAMP. This method can be used to replace qRT-PCR as it is a sensitive, rapid diagnostic tool that works quickly and in settings outside of the laboratory.

<table border="0" cellpadding="0" cellspacing="0" style="width:901px;" width="902">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Bst 2.0 WarmStart DNA polymerase</td>
			<td style="width:223px;">New England Biolabs</td>
			<td style="width:223px;">M0537S</td>
			<td style="width:207px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Isothermal Amplification Buffer&#160;</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">B0537S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">WarmStart RTx Reverse Transcriptase</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">M0380S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Antarctic Thermolabile UDG</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">M0372S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MgSO4</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">B1003S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">100mM dATP Solution</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">N0440S</td>
			<td>Deoxynucleotide Set N0446S</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">100mM dCTP Solution</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">N0441S</td>
			<td>Deoxynucleotide Set N0446S</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">100mM dTTP Solution</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">N0443S</td>
			<td>Deoxynucleotide Set N0446S</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">100mM dGTP Solution</td>
			<td>New England Biolabs</td>
			<td style="width:223px;">N0442S</td>
			<td>Deoxynucleotide Set N0446S</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">100mM dUTP Solution</td>
			<td style="width:223px;">Thermo Fisher Scientific</td>
			<td style="width:223px;">R0133</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SYBR Green I Nucleic Acid Gel Stain</td>
			<td style="width:223px;">Invitrogen</td>
			<td style="width:223px;">S7563</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nancy-520</td>
			<td style="width:223px;">Sigma Aldrich</td>
			<td style="width:223px;">01494</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Low DNA Mass Ladder</td>
			<td style="width:223px;">Invitrogen</td>
			<td style="width:223px;">10-068-013</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Zika Postive Control</td>
			<td style="width:223px;">Robert Koch Institute, Germany</td>
			<td style="width:223px;">N/A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Agarose</td>
			<td style="width:223px;">Thermo Fisher Scientific</td>
			<td style="width:223px;">BP1600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">BlueJuice Gel Loading Buffer</td>
			<td style="width:223px;">Invitrogen</td>
			<td style="width:223px;">10816015</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Primers</td>
			<td style="width:223px;">Integrated DNA Technologies</td>
			<td style="width:223px;">Custom Oligo</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Nuclease-Free Water</td>
			<td style="width:223px;">Ambion</td>
			<td style="width:223px;">AM9938</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">Urine Preservative</td>
			<td style="width:223px;">Norgen Biotek</td>
			<td style="width:223px;">18126</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:249px;">ZIKV PCR Standard</td>
			<td>Robert Koch Institute</td>
			<td style="width:223px;">N/A</td>
			<td>Vero E6 cell supernatants</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">DENV2 New Guinea C Control</td>
			<td style="width:223px;">Connecticut Agricultural Experiment Station</td>
			<td style="width:223px;">N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse transcription-loop-mediated isothermal amplification (rt-lamp) assay for zika virus and housekeeping genes in urine, serum, and mosquito samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth defects. The goal of this protocol is to quickly detect ZIKV in both human and mosquito samples. The current gold standard for ZIKV detection is quantitative reverse transcription PCR (qRT-PCR); reverse transcription loop-mediated isothermal amplification (RT-LAMP) may allow for a more efficient and low-cost testing without the need for expensive equipment. In this study, RT-LAMP is used for ZIKV detection in various biological samples within 30 min, without first isolating the RNA from the sample. This technique is demonstrated using ZIKV infected patient urine and serum, and infected mosquito samples. 18S ribosomal ribonucleic acid and actin are used as controls in human and mosquito samples, respectively.

RT-LAMP reactions can be analyzed using three different methods. First, with the addition of a fluorescent nucleic acid dye, positive reactions will be yellow/green in color where negative reactions will appear orange in color to the naked eye. Second, the addition of the fluorescent nucleic acid dye to RT-LAMP reaction results in a fluorescent signal when the samples are excited by UV light. Negative reactions will not have a detectable fluorescent signal over any background fluorescence that may be present in small amounts in the negative control. Lastly, RT-LAMP reactions can be run out on an agarose gel. Positive RT-LAMP reactions will have a banding pattern, whereas negative reactions will have no DNA bands. Examples of this using all three of these analysis methods are demonstrated in Figure 2 and 3. None of these samples had RNA isolated prior to RT-LAMP. Figure 1 demonstrates the crushing of a whole mosquito in PBS, which is sufficient for the use in the RT-LAMP reaction. In Figure 2, the specificity of the ZIKV RT-LAMP reaction is demonstrated: only the ZIKV molecular control, not the DENV molecular control or negative control, has a positive RT-LAMP reaction. Furthermore, ZIKV is detected in both the urine and serum of a patient with known ZIKV infection, but not in the asymptomatic control patient without ZIKV infection (Figure 2A). In Figure 2B, the samples are tested for human 18s rRNA using RT-LAMP. Only the samples from the patients (urine or serum), but not the molecular controls or the negative control, are positive for 18s rRNA. Therefore, 18s rRNA RT-LAMP can be used as a quality control for RT-LAMP reactions for the samples from human patients. Mosquito samples can be similarly tested for ZIKV or the RT-LAMP quality control, AEDAE (Figure 3). In this example, the positive molecular control for ZIKV as well as the mosquito infected with ZIKV are positive for ZIKV. The negative control, the molecular control for DENV, the mock infected mosquito (mosquito microinjected with cell culture media containing no virus), and the DENV infected mosquito are all negative for ZIKV (Figure 3A). However, all the mosquitoes are positive for AEDAE by RT-LAMP (Figure 3B).
When possible, all three analytical methods should be used to confirm a positive or negative reaction as sometimes the fluorescent signal can be weak and some individuals may be color blind, making the visual color change difficult to determine. In cases where the negative control is positive, the entire set of samples tested is invalid as contamination and therefore false positives cannot be ruled out. In cases where the positive control is negative, the entire set of samples is invalid as the RT-LAMP reaction may not have worked. This is a qualitative read out, however, higher copies of virus will result in an increase in RT-LAMP products that can be appreciated by fluorescent intensity or by the intensity of the DNA banding pattern by gel electrophoresis.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58436/58436fig1.jpg" /> 
Figure 1: Preparation of mosquito crude lysate. (A) Place a mosquito into 100 &#181;L of PBS in a microcentrifuge tube. (B) Using a P10 pipet tip, crush the mosquito against the sides of the tube 10 times. (C) This produces a crude lysate that should be spun down briefly in a table top centrifuge to pellet debris. Only the supernatant should be used for RT-LAMP reaction. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58436/58436fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58436/58436fig2.jpg" /> 
Figure 2:&#160;ZIKV and 18S rRNA RT-LAMP in patient urine and serum samples. Urine or serum samples from an asymptomatic control patient (C01) or ZIKV infected patient (Z01) were subjected to a ZIKV (A) or 18S rRNA (B) specific RT-LAMP reactions. RT-LAMP reactions were visualized after the addition of a fluorescent nucleic acid dye by eye (upper panel), green fluorescence (middle panel), or gel electrophoresis (bottom panel). Lane M: DNA Mass Marker; NTC: No template control (negative control); ZIKV: ZIKV PCR Standard positive control; DENV: DENV positive control. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58436/58436fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58436/58436fig3.jpg" /> 
Figure 3:&#160;ZIKV and AEDAE RT-LAMP in Ae. aegypti. Single Ae. aegypti infected with mock control, ZIKV, or DENV were subjected to ZIKV (A) or AEDAE (B) specific RT-LAMP reactions. RT-LAMP reactions were visualized after the addition of a fluorescent nucleic acid dye by eye (upper panel), green fluorescence (middle panel), or gel electrophoresis (bottom panel). Lane M: DNA Mass Marker; NTC: No template control (negative control); ZIKV: ZIKV PCR Standard positive control; DENV: DENV positive control. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58436/58436fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Target</td>
			<td>Primer</td>
			<td colspan="3">Sequence (5&#8217;-3&#8217;)</td>
		</tr>
		<tr>
			<td>Homo sapien 18S rRNA</td>
			<td>18SrRNA-FIP* 
			18SrRNA-BIP* 
			18SrRNA-F3 
			18SrRNA-B3 
			18SrRNA-LF 
			18SrRNA-LB</td>
			<td colspan="3">TGGCCTCAGTTCCGAAAACCAACCTGGATACCGCAGCTAGG 
			GGCATTCGTATTGCGCCGCTGGCAAATGCTTTCGCTCTG 
			GTTCAAAGCAGGCCCGAG 
			CCTCCGACTTTCGTTCTTGA 
			AGAACCGCGGTCCTATTCCATTATT 
			ATTCCTTGGACCGGCGCAAG</td>
		</tr>
		<tr>
			<td>ZIKV</td>
			<td>ZIKV-FIP* 
			ZIKV-BIP* 
			ZIKV-F3 
			ZIKV-B3 
			ZIKV-LF 
			ZIKV-LB</td>
			<td colspan="3">AACCTGAGGGCATGTGCAAACCGCGGTCAGTGGAGATGACT 
			CACAGGAGTGGAAACCCTCGACTGAAGTGGTGGGAGCAGAA 
			GCAGAGCAATGGATGGGATA 
			CCCATCCTTGAGGTACAGCT 
			TCGATTGGCTTCACAACGC 
			GGAGCAATTGGGAAGAAGTCC</td>
		</tr>
		<tr>
			<td>Ae. aegypti actin</td>
			<td>Ae21-FIP* 
			Ae21-BIP* 
			Ae21-LF 
			Ae21-F3 
			Ae21-B3</td>
			<td colspan="3">TGCTTGGTCCCTGCCTGGGAGACAGCCCACCAGAACGA 
			GAGACGAGAACGGCCCAGCGGGTCTGGTGTGTGTCTTTG 
			ACCGCAAGGCCAAGAACCG 
			CGGCGCCACCACAAGA 
			TCGTGCCTGTGTTTGTCG</td>
		</tr>
		<tr>
			<td colspan="5">*Primers should be purified by rapid high-performance liquid chromatography (HPLC). For all other primers, standard desalting conditions are sufficient.</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences for RT-LAMP reactions. Primer sequences are originally described in previous publication6.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Volume (&#181;L)</td>
			<td>Primer</td>
			<td>Stock Concentration (&#181;M)</td>
			<td>Final Concentration (&#181;M)</td>
		</tr>
		<tr>
			<td>80</td>
			<td>Forward Inner Primer (FIP)</td>
			<td>100</td>
			<td>16</td>
		</tr>
		<tr>
			<td>80</td>
			<td>Backward Inner Primer (BIP)</td>
			<td>100</td>
			<td>16</td>
		</tr>
		<tr>
			<td>10</td>
			<td>Forward Outer Primer (F3)</td>
			<td>100</td>
			<td>2</td>
		</tr>
		<tr>
			<td>10</td>
			<td>Backward Outer Primer (B3)</td>
			<td>100</td>
			<td>2</td>
		</tr>
		<tr>
			<td>20</td>
			<td>Loop Forward (LF)</td>
			<td>100</td>
			<td>4</td>
		</tr>
		<tr>
			<td>20</td>
			<td>Loop Backward (LB)</td>
			<td>100</td>
			<td>4</td>
		</tr>
		<tr>
			<td>280</td>
			<td>molecular grade water</td>
			<td>-</td>
			<td>-</td>
		</tr>
		<tr>
			<td>500</td>
			<td>Total</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: Preparation of 10x RT-LAMP Primer Mix. The RT-LAMP primer set for Ae. aegypti actin does not contain a BF primer; replace this volume with water.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>1x Volume (&#181;L)</td>
			<td>Component</td>
			<td>Final Conc. For 25 &#181;L Volume</td>
		</tr>
		<tr>
			<td>2.5</td>
			<td>10x Isothermic Amplification Buffer</td>
			<td>1x</td>
		</tr>
		<tr>
			<td>1.8</td>
			<td>100 mM dU/A/T/C/GTPs</td>
			<td>1.4 mM</td>
		</tr>
		<tr>
			<td>2.0</td>
			<td>100 mM MgSO4</td>
			<td>6 mM + 2 mM in buffer = 8 mM [4-10 mM range]</td>
		</tr>
		<tr>
			<td>2.5</td>
			<td>10x Primers</td>
			<td>1.6 &#181;M FIP/BIP, 0.2 &#181;M F3/B3, 0.4 &#181;M FL/BL</td>
		</tr>
		<tr>
			<td>1.0</td>
			<td>thermophilic DNA polymerase with strand displacement (8,000 U/mL)</td>
			<td>8 U</td>
		</tr>
		<tr>
			<td>0.5</td>
			<td>Reverse Transcriptase (15,000 U/mL)</td>
			<td>7.5 U</td>
		</tr>
		<tr>
			<td>0.5</td>
			<td>UDG (1,000 U/mL)</td>
			<td>0.5 U</td>
		</tr>
		<tr>
			<td>12.3</td>
			<td>molecular grade water</td>
			<td>-</td>
		</tr>
		<tr>
			<td>23.0</td>
			<td>Total</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 3: Preparation of RT-LAMP Master Mix.

Watch this Scientific Journal Video about Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples at JoVE

Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Infection with Zika virus (ZIKV) can be asymptomatic in adults, however, infection during pregnancy can lead to miscarriage and severe neurological birth ...

reverse-transcription-loop-mediated-isothermal-amplification-rt-lamp

Nanyang Technological University

Research

JoVE Journal

Genetics

13.7K Views.  Beaumont Health System. This protocol provides an efficient and low-cost method to detect Zika virus or control targets in human urine and serum samples or in mosquitoes by reverse transcription loop-mediated isothermal amplification (RT-LAMP). This method does not require RNA isolation and can be done within 30 min.

Video: Reverse Transcription-Loop-mediated Isothermal Amplification RT-LAMP Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

The Use of Induced Somatic Sector Analysis (ISSA) for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Secondary stem growth in trees and associated wood formation are significant both from biological and commercial perspectives. However, relatively little is known about the molecular control that governs their development. This is in part due to physical, resource and time limitations often associated with the study of secondary growth processes. A number of in vitro techniques have been used involving either plant part or whole plant system in both woody and non-woody plant species. However, questions about their applicability for the study of secondary stem growth processes, the recalcitrance of certain species and labor intensity are often prohibitive for medium to high throughput applications. Also, when looking at secondary stem development and wood formation the specific traits under investigation might only become measurable late in a tree&#39;s lifecycle after several years of growth. In addressing these challenges alternative in vivo protocols have been developed, named Induced Somatic Sector Analysis, which involve the creation of transgenic somatic tissue sectors directly in the plant&#39;s secondary stem. The aim of this protocol is to provide an efficient, easy and relatively fast means to create transgenic secondary plant tissue for gene and promoter functional characterization that can be utilized in a range of tree species. Results presented here show that transgenic secondary stem sectors can be created in all live tissues and cell types in secondary stems of a variety of tree species and that wood morphological traits as well as promoter expression patterns in secondary stems can be readily assessed facilitating medium to high throughput functional characterization.

The Use of Induced Somatic Sector Analysis ISSA for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Here we present a protocol that facilitates the medium to high throughput functional characterization of gene and promoter constructs in tree secondary stem tissue within comparatively short time frames. It is efficient, easy to use and widely applicable to a range of tree species.

Secondary stem growth in trees and associated wood formation are significant both from biological and commercial perspectives. However, relatively little ...

Peptide-derived Method to Transport Genes and Proteins Across Cellular and Organellar Barriers in Plants

The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as well as new applications in the field of plant biotechnology. Viable methods that currently exist for protein or gene transfer into plant cells, namely Agrobacterium and microprojectile bombardment, have disadvantages of low transformation frequency, limited host range, or a high cost of equipment and microcarriers. The following protocol outlines a simple and versatile method, which employs rationally-designed peptides as delivery agents for a variety of nucleic acid- and protein-based cargoes into plants. Peptides are selected as tools for development of the system due to their biodegradability, reduced size, diverse and tunable properties as well as the ability to gain intracellular/organellar access. The preparation, characterization and application of optimized formulations for each type of the wide range of delivered cargoes (plasmid DNA, double-stranded DNA or RNA, and protein) are described. Critical steps within the protocol, possible modifications and existing limitations of the method are also discussed.

Existing methods for the modification of plants have limited applicability. The novel peptide-derived technology proposed here promises both simplicity and efficiency in the introduction of exogenous protein or genes into the desired intracellular compartments of intact plants.

The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as ...

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, transcription factors, or chromatin-modifying enzymes at a given locus or on a genome-wide scale. The combination of ChIP assays with next-generation sequencing (i.e., ChIP-Seq) is a powerful approach to globally uncover gene regulatory networks and to improve the functional annotation of genomes, especially of non-coding regulatory sequences. ChIP protocols normally require large amounts of cellular material, thus precluding the applicability of this method to investigating rare cell types or small tissue biopsies. In order to make the ChIP assay compatible with the amount of biological material that can typically be obtained in vivo during early vertebrate embryogenesis, we describe here a simplified ChIP protocol in which the number of steps required to complete the assay were reduced to minimize sample loss. This ChIP protocol has been successfully used to investigate different histone modifications in various embryonic chicken and adult mouse tissues using low to medium cell numbers (5 x 104 - 5 x 105 cells). Importantly, this protocol is compatible with ChIP-seq technology using standard library preparation methods, thus providing global epigenomic maps in highly relevant embryonic tissues.

Chromatin Immunoprecipitation ChIP Protocol for Low-abundance Embryonic Samples

Here, we describe a chromatin immunoprecipitation (ChIP) and ChIP-seq library preparation protocol to generate global epigenomic profiles from low-abundance chicken embryonic samples.

Chromatin immunoprecipitation (ChIP) is a widely-used technique for mapping the localization of post-translationally modified histones, histone variants, ...

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell culture system. This system was developed to express foreign genes under the control of the baculoviral promoter in transient expression plasmids. Furthermore, this system can be applied to a functional assay of either the baculovirus itself or foreign proteins. The most widely and commercially available transient gene expression system is developed based on the immediate-early gene (IE) promoter of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). However, a low expression level of foreign genes in insect cells was observed. Therefore, a transient gene expression system was constructed for improving protein expression. In this system, recombinant plasmids were constructed to contain the target sequence under the control of the Drosophila heat shock 70 (Dhsp70) promoter. This protocol presents the application of this heat shock-based pDHsp/V5-His (V5 epitope with 6 histidine)/Spodoptera frugiperda cell (sf9 cell) system; this system is available not only for gene expression but also for evaluating the anti-apoptotic activity of candidate proteins in insect cells. Furthermore, this system can be either transfected with one recombinant plasmid or co-transfected two potentially functionally antagonistic recombinant plasmids in insect cells. The protocol demonstrates the efficiency of this system and provides a practical case of this technique.

Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell ...

Adapting 3' Rapid Amplification of CDNA Ends to Map Transcripts in Cancer

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the traditional method of choice is 3&#39; rapid amplification of cDNA ends (3&#39; RACE). Protocols for 3&#39; RACE require the careful design and selection of nested primers within the 3&#39; untranslated region (3&#39; UTR) of the target gene of interest. However, with a few modifications the protocol can be used to include the entire 3&#39; UTR and sequences within the open reading frame (ORF), providing a more comprehensive picture of the relationship between the ORF and the 3&#39; UTR. This is in addition to identification of the polyadenylation signal (PAS), as well as the cleavage and polyadenylation site provided by conventional 3&#39; RACE. Expanded 3&#39; RACE can detect unusual 3&#39; UTRs, including gene fusions within the 3&#39; UTR, and the sequence information can be used to predict potential miRNA binding sites as well as AU rich destabilizing elements that may affect the stability of the transcript.

The two different 3&#39; rapid amplification of cDNA ends (3&#39; RACE) protocols described here make use of two different DNA polymerases to map sequences that include a segment of the open reading frame (ORF), the stop codon, and the entire 3&#39; UTR of a transcript using RNA obtained from different cancer cell lines.

Maturation of eukaryotic mRNAs involves 3&#39; end formation, which involves the addition of a poly(A) tail. In order to map the 3&#39; end of a gene, the ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription polymerase chain reaction (nested RT-PCR) was developed to detect the conserved region of the nucleoprotein (N) gene of lyssaviruses. The method applies reverse transcription (RT) using viral RNA as template and oligo (dT)15 and random hexamers as primers to synthesize the viral complementary DNA (cDNA). Then, the viral cDNA is used as a template to amplify an 845 bp N gene fragment in first-round PCR using outer primers, followed by second-round nested PCR to amplify the final 371 bp fragment using inner primers. This method can detect different genetic clades of rabies viruses (RABV). The validation, using 9,624 brain specimens from eight domestic animal species in 10 years of clinical rabies diagnoses and surveillance in China, showed that the method has 100% sensitivity and 99.97% specificity in comparison with the direct fluorescent antibody test (FAT), the gold standard method recommended by the World Health Organization (WHO) and the World Organization for Animal Health (OIE). In addition, the method could also specifically amplify the targeted N gene fragment of 15 other approved and two novel lyssavirus species in the 10th Report of the International Committee on Taxonomy of Viruses (ICTV) as evaluated by a mimic detection of synthesized N gene plasmids of all lyssaviruses. The method provides a convenient alternative to FAT for rabies diagnosis and has been approved as a National Standard (GB/T36789-2018) of China.

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription ...

An In Vitro Protocol for Evaluating MicroRNA Levels, Functions, and Associated Target Genes in Tumor Cells

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including cancers. These small regulatory RNAs mainly interact with the 3&#8217; untranslated regions (3&#8217; UTR) of their target messenger RNAs (mRNAs) ultimately resulting in the inhibition of decoding processes of mRNAs and the augmentation of target mRNA degradations. Based on the expression levels and intracellular functions, miRNAs are able to serve as regulatory factors of oncogenic and tumor-suppressive mRNAs. Identification of bona fide target genes of a miRNA among hundreds or even thousands of computationally predicted targets is a crucial step to discern the roles and basic molecular mechanisms of a miRNA of interest. Various miRNA target prediction programs are available to search possible miRNA-mRNA interactions. However, the most challenging question is how to validate direct target genes of a miRNA of interest. This protocol describes a reproducible strategy of key methods on how to identify miRNA targets related to the function of a miRNA. This protocol presents a practical guide on step-by-step procedures to uncover miRNA levels, functions, and related target mRNAs using the probe-based real-time polymerase chain reaction (PCR), sulforhodamine B (SRB) assay following a miRNA mimic transfection, dose-response curve generation, and luciferase assay along with the cloning of 3&#8217; UTR of a gene, which is necessary for proper understanding of the roles of individual miRNAs.

This protocol uses a probe-based real-time polymerase chain reaction (PCR), a sulforhodamine B (SRB) assay, 3&#8217; untranslated regions (3&#8217; UTR) cloning, and a luciferase assay to verify the target genes of a miRNA of interest and to understand the functions of miRNAs.

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including ...

Reverse Transcription-Loop-mediated Isothermal Amplification (RT-LAMP) Assay for Zika Virus and Housekeeping Genes in Urine, Serum, and Mosquito Samples

Summary

Explore More Videos

Chapters in this video

The Use of Induced Somatic Sector Analysis (ISSA) for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Peptide-derived Method to Transport Genes and Proteins Across Cellular and Organellar Barriers in Plants

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Chromatin Immunoprecipitation (ChIP) Protocol for Low-abundance Embryonic Samples

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

Adapting 3' Rapid Amplification of CDNA Ends to Map Transcripts in Cancer

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

An In Vitro Protocol for Evaluating MicroRNA Levels, Functions, and Associated Target Genes in Tumor Cells