The authors acknowledge support from the NIH/NIGMS (R01GM084135 to HJN) and Mizutani Foundation for Glycoscience (grant #110071 to HJN), and are grateful to Tom V. Lee for discussions and suggestions on the assays, and Spyros Artavanis-Tsakonas, Hugo Bellen, Robert Fleming, Ken Irvine and The Drosophila Genomics Resource Center (DGRC) for plasmids and cell lines.

1. Preparation of Double Stranded RNA (dsRNA) for Shams Knockdown
<ol>
	<li>PCR amplification of the products
	<ol>
		<li>Use wild-type yellow white (y w) genomic DNA and pAc5.1-EGFP as template and the following primer pairs to amplify the DNA fragments used in dsRNA synthesis. Use the following PCR thermal profile: Denaturation (95 &#176;C, 30 s), Annealing (58 &#176;C, 30 s) and Extension (72 &#176;C, 1 min). 
		Enhanced Green Fluorescent Protein (EGFP) dsRNA primers (5&#39;-3&#39;)- 
		Forward primer- GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG 
		Reverse primer- GAAATTAATACGACTCACTATAGGGGGTCTTTGCTCAGGGCGG 
		Shams dsRNA primers (5&#39;-3&#39;)- 
		Forward primer- TTAATACGACTCACTATAGGGGAGATGCTGTATGTGGACACGGAT 
		Reverse primer- TTAATACGACTCACTATAGGGGAGATCCGTGGATAACCTTAACGA 
		NOTE: EGFP dsRNA is used as negative control.</li>
	</ol>
	</li>
	<li>Gel-purify the polymerase chain reaction (PCR) products using a commercial gel purification kit according to manufacturer&#39;s protocol.</li>
	<li>Perform in vitro transcription using a commercial product capable of transcribing from a T7 promoter according to manufacturer&#39;s protocol.</li>
	<li>Purify the dsRNA using an RNA purification kit according to manufacturer&#39;s protocol and store at -80 &#176;C.</li>
	<li>Assess the efficiency of shams knockdown by using the following steps (1.5.1-1.5.5).
	<ol>
		<li>Count the cells manually using a hemocytometer and plate 5 x 105 S2 cells in each well of a 6 well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% Fetal Bovine Serum (FBS) and 100 U/mL Penicillin-Streptomycin.</li>
		<li>Add 7.5 &#181;g of EGFP- or shams dsRNA to each well and incubate at 25 &#176;C for 24 h.</li>
		<li>Harvest the control (EGFP dsRNA-treated) and shams dsRNA-treated S2 cells by gentle pipetting followed by pelleting down by centrifugation at 1,000 x g for 5 min at 25 &#176;C and process for RNA isolation using an RNA extraction kit according to manufacturer&#39;s protocol.</li>
		<li>Quantify the RNA using a spectrophotometer and process 100 ng of RNA for 1-step qRT-PCR using commercial qPCR reagents and primer/probes and the following PCR thermal profile: Denaturation (95 &#176;C, 15 s) and Annealing/Extension (60 &#176;C, 1 min). 
		NOTE: Please see the Table of Materials for information on the primer/probe sets and the instrument used for shams and control qRT-PCR experiments in these studies.</li>
		<li>Calculate relative shams mRNA levels using the 2-&#916;&#916;CT method16.</li>
	</ol>
	</li>
</ol>
2. Assessment of the Binding Between the Notch Receptor and Trans-ligands
<ol>
	<li>Prepare signal-receiving cells (S2 cells expressing the Notch receptor).
	<ol>
		<li>Count the cells manually using a hemocytometer and plate 5 x 105 S2 and stable S2-Notch cells in each well of a 6-well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin. 
		NOTE: For S2-Notch cells, which are available from Drosophila Genomics Resource Center (DGRC), add 200 nM methotrexate in media. To prepare a 0.5 mM methotrexate stock solution, first prepare a 20 mM methotrexate solution in 250 &#181;L of 1 M NaOH. Next, dilute this solution to 0.5 mM in 1 M phosphate buffer saline and store at -20 &#176;C. In S2-Notch cells, expression of the Notch protein is under the control of the Drosophila metallothionein promoter in the pMT vector.</li>
		<li>Add 7.5 &#181;g of dsRNA to each well and incubate at 25 &#176;C for 24 h.</li>
		<li>Add 0.7 mM CuSO4 to induce the expression of Notch and incubate at 25 &#176;C for 3 days. 
		NOTE: CuSO4 is used to induce expression of proteins controlled by the metallothionein promoter.</li>
	</ol>
	</li>
	<li>Prepare signal-sending cells (S2 cell expressing Delta or Serrate ligands).
	<ol>
		<li>Count the cells manually using a hemocytometer and plate ~5 x 106 stable S2-Delta or S2-SerrateTom cells in each well of a 6-well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin. 
		NOTE: Add 200 nM methotrexate for S2-Delta cells and 100 &#181;g/mL hygromycin for S2-SerrateTom cells in media. Expression of Delta and SerrateTom&#8212;a Tomato-tagged, functional version of Serrate12&#8212;is under Drosophila metallothionein promoter in the pMT vector.</li>
		<li>Add 0.7 mM CuSO4 to induce the expression of ligands and incubate at 25 &#176;C for 3 h.</li>
	</ol>
	</li>
	<li>Perform aggregation between signal-sending and signal-receiving cells.
	<ol>
		<li>Harvest the dsRNA-treated S2 (control) and S2-Notch cells by gentle pipetting and plate 2.5 x 105 cells/well in a 24-well plate after manual counting by hemocytometer.</li>
		<li>Add 5 x 105 stable S2-Delta or S2-SerrateTom cells in a total volume of 200 &#181;L of Schneider&#39;s medium (supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin). 
		NOTE: All S2 cells handling (including plating, induction and dsRNA treatment) was done under a biosafety cabinet.</li>
		<li>Place the plate on an orbital shaker at 150 rpm (942.48 rad/min).</li>
		<li>After 1 min, mix the contents of each well and take 20 &#181;L out for counting the number of aggregates.
		<ol>
			<li>Simultaneously take a representative image under inverted compound microscope using 10x magnification (PLL 10/0.25 objective).</li>
			<li>Manually count the aggregates (&#62;6 cells) using a hemocytometer.</li>
		</ol>
		</li>
		<li>Place the plate on a shaker.</li>
		<li>Repeat the image acquisition and counting after 5 min and 15 min of aggregation.</li>
	</ol>
	</li>
	<li>Perform quantification of trans-binding.
	<ol>
		<li>Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-SerrateTom cells as a background control.</li>
		<li>Calculate the number of aggregates per mL between S2-Notch and S2-Delta or S2-SerrateTom cells (magnitude of trans-binding).</li>
	</ol>
	</li>
</ol>
3. Evaluation of Inhibition of Binding Between Notch and Trans-ligands by Cis-ligands
<ol>
	<li>Prepare signal-receiving cells.
	<ol>
		<li>Plate 5 x 105 S2 cells in each well of a 6-well plate in 1 mL/well of Schneider&#39;s medium supplemented with 10% FBS and 100 U/mL Penicillin-Streptomycin.</li>
		<li>Add 7.5 &#181;g of dsRNA to each well and incubate at 25 &#176;C for 24 h.</li>
		<li>Co-transfect the dsRNA-treated cells with pBluescript and pMT-Notch11 (DGRC) alone or with pMT-Notch and pMT-Delta11 (DGRC) or pMT-Serrate17 for a total DNA concentration of 2 &#181;g/well using a commercial transfection reagent according to manufacturer&#39;s protocol. 
		NOTE: pBluescript is used as a control. The co-transfected cells will be called S2-Notch&#38;Deltatransient or S2-Notch&#38;Serratetransient cells hereafter.</li>
		<li>Incubate the transiently-transfected S2 cells at 25 &#176;C for 24 h.</li>
		<li>Add 0.7 mM CuSO4 to induce the expression of Notch and the ligands and incubate at 25 &#176;C for 3 days.</li>
	</ol>
	</li>
	<li>Prepare signal-sending cells as described in 2.2.</li>
	<li>Perform aggregation between signal-sending and signal-receiving cells as described in section 2.3.</li>
	<li>Quantify inhibition of trans-binding by cis-ligands.
	<ol>
		<li>Calculate the number of aggregates per mL between S2 cells and S2-Delta or S2-Serrate cells as a background control.</li>
		<li>Quantify the magnitude of inhibition by cis-ligands as follows.
		<ol>
			<li>Define A as Number of aggregates between S2-Notchtransient and S2-Delta cells.</li>
			<li>Define B as Number of aggregates between S2 cells transiently co-transfected with Notch and Delta (S2-Notch&#38;Deltatransient) and S2-Delta cells.</li>
			<li>Calculate relative aggregation C = (B x 100)/A</li>
			<li>Calculate magnitude of inhibition by cis-ligand (Delta or Serrate) as 100 &#8211; C. 
			NOTE: As an example, if relative aggregation is 45%, then cis-ligands are considered to inhibit the trans-binding by 55%.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>

<ol>
	<li>de Celis, J. F., Bray, S., Garcia-Bellido, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signalling+regulates+veinlet+expression+and+establishes+boundaries+between+veins+and+interveins+in+the+Drosophila+wing.">Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing.</a> Development. 124 (10), 1919-1928 (1997).</li><li>Fortini, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Notch+signaling:+the+core+pathway+and+its+posttranslational+regulation.">Notch signaling: the core pathway and its posttranslational regulation.</a> Dev Cell. 16 (5), 633-647 (2009).</li><li>del Alamo, D., Rouault, H., Schweisguth, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+and+significance+of+cis-inhibition+in+Notch+signalling.">Mechanism and significance of cis-inhibition in Notch signalling.</a> Curr Biol. 21 (1), R40-R47 (2011).</li><li>Sprinzak, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cis-interactions+between+Notch+and+Delta+generate+mutually+exclusive+signalling+states.">Cis-interactions between Notch and Delta generate mutually exclusive signalling states.</a> Nature. 465 (7294), 86-90 (2010).</li><li>Kopan, R., Ilagan, M. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+Notch+signaling+pathway:+unfolding+the+activation+mechanism.">The canonical Notch signaling pathway: unfolding the activation mechanism.</a> Cell. 137 (2), 216-233 (2009).</li><li>Huppert, S. S., Jacobsen, T. L., Muskavitch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Feedback+regulation+is+central+to+Delta-Notch+signalling+required+for+Drosophila+wing+vein+morphogenesis.">Feedback regulation is central to Delta-Notch signalling required for Drosophila wing vein morphogenesis.</a> Development. 124 (17), 3283-3291 (1997).</li><li>Lee, T. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negative+regulation+of+notch+signaling+by+xylose.">Negative regulation of notch signaling by xylose.</a> PLoS Genet. 9 (6), e1003547 (2013).</li><li>Lee, T. V., Pandey, A., Jafar-Nejad, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xylosylation+of+the+Notch+receptor+preserves+the+balance+between+its+activation+by+trans-Delta+and+inhibition+by+cis-ligands+in+Drosophila.">Xylosylation of the Notch receptor preserves the balance between its activation by trans-Delta and inhibition by cis-ligands in Drosophila.</a> PLoS Genet. 13 (4), e1006723 (2017).</li><li>Jacobsen, T. L., Brennan, K., Arias, A. M., Muskavitch, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cis-interactions+between+Delta+and+Notch+modulate+neurogenic+signalling+in+Drosophila.">Cis-interactions between Delta and Notch modulate neurogenic signalling in Drosophila.</a> Development. 125 (22), 4531-4540 (1998).</li><li>Schneider, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+lines+derived+from+late+embryonic+stages+of+Drosophila+melanogaster.">Cell lines derived from late embryonic stages of Drosophila melanogaster.</a> J Embryol Exp Morphol. 27 (2), 353-365 (1972).</li><li>Fehon, R. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+interactions+between+the+protein+products+of+the+neurogenic+loci+Notch+and+Delta,+two+EGF-homologous+genes+in+Drosophila.">Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila.</a> Cell. 61 (3), 523-534 (1990).</li><li>Fleming, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+extracellular+region+of+Serrate+is+essential+for+ligand-induced+cis-inhibition+of+Notch+signaling.">An extracellular region of Serrate is essential for ligand-induced cis-inhibition of Notch signaling.</a> Development. 140 (9), 2039-2049 (2013).</li><li>Saj, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+combined+ex+vivo+and+in+vivo+RNAi+screen+for+notch+regulators+in+Drosophila+reveals+an+extensive+notch+interaction+network.">A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.</a> Dev Cell. 18 (5), 862-876 (2010).</li><li>Fiuza, U. M., Klein, T., Martinez Arias, A., Hayward, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+ligand-mediated+inhibition+in+Notch+signaling+activity+in+Drosophila.">Mechanisms of ligand-mediated inhibition in Notch signaling activity in Drosophila.</a> Dev Dyn. 239 (3), 798-805 (2010).</li><li>Ahimou, F., Mok, L. P., Bardot, B., Wesley, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+adhesion+force+of+Notch+with+Delta+and+the+rate+of+Notch+signaling.">The adhesion force of Notch with Delta and the rate of Notch signaling.</a> J Cell Biol. 167 (6), 1217-1229 (2004).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Okajima, T., Xu, A., Irvine, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modulation+of+notch-ligand+binding+by+protein+O-fucosyltransferase+1+and+fringe.">Modulation of notch-ligand binding by protein O-fucosyltransferase 1 and fringe.</a> J Biol Chem. 278 (43), 42340-42345 (2003).</li><li>Acar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rumi+is+a+CAP10+domain+glycosyltransferase+that+modifies+Notch+and+is+required+for+Notch+signaling.">Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling.</a> Cell. 132 (2), 247-258 (2008).</li><li>Bruckner, K., Perez, L., Clausen, H., Cohen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycosyltransferase+activity+of+Fringe+modulates+Notch-Delta+interactions.">Glycosyltransferase activity of Fringe modulates Notch-Delta interactions.</a> Nature. 406 (6794), 411-415 (2000).</li><li>Yamamoto, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+EGF+repeat-8+of+Notch+discriminates+between+Serrate/Jagged+and+Delta+family+ligands.">A mutation in EGF repeat-8 of Notch discriminates between Serrate/Jagged and Delta family ligands.</a> Science. 338 (6111), 1229-1232 (2012).</li></ol>

The authors have no conflict of interest.

Canonical Notch signaling depends on the interactions between the Notch receptor and its ligands5. Although most studies on the Notch pathway primarily consider the binding of Notch and ligands in neighboring cells (trans), Notch and same-cell ligands do interact, and these so-called cis-interactions can play an inhibitory role in Notch signaling3,4. Accordingly, to decipher the mechanisms underlying the effects of a modifier on canonical notch signaling, it is often pertinent to examine both types of Notch-ligand interactions (trans and cis). However, in many contexts during animal development, involvement of both of these interactions and their feed-back regulation complicates the in vivo studies1,6. In the present protocol, we provide a detailed methodology for in vitro cell aggregation assays using Drosophila S2 cells to evaluate the binding of Notch receptor with trans-ligands and its inhibition by cis-ligands. We have presented the utilization of this methodology to assess the effect of a genetic modifier of Notch signaling (the xylosyltransferase Shams7,8) on receptor-ligand binding.
First, aggregation assays were performed between stable S2-Delta and EGFP or shams dsRNA-treated stable S2-Notch cells to examine the effect of shams KD on trans-binding. Aggregation of S2-Delta cells with shams dsRNA-treated plain S2 cells was taken as background control. Shams KD enhanced the aggregation between S2-Notch and S2-Delta cells compared to control. It is important to perform background experimental control aggregations between plain S2 cells and ligand-carrying S2 cells in parallel to the trans-binding experiments. Although Drosophila S2 cells do not express endogenous Notch receptor and Delta ligand11, expression of low levels of Serrate is reported in S2 cells13. Considering this, plain S2 cells were used in cell aggregation assays as background control; these cells did not show any aggregation (Figure 5B). Aggregates are counted manually using a hemocytometer. To ensure consistency in aggregate quantification, 10-20 &#181;L of mixed cell population can be pipetted out from at least three different areas per well for counting. These assays require healthy growing S2 cells. Considering the semi-adherent nature of S2 cells, gentle pipetting while collecting the cells and constant shaking during the aggregation assay are important.
Previously, we and others have used well-established, soluble ligand-receptor binding assays for a quantitative assessment of receptor-ligand binding in trans17,18,19,20. Since aggregation assays are semi-quantitative, soluble ligand binding assays were also performed to examine the effect of shams KD on Notch-ligand trans-binding. The observed results were similar in trend with those obtained from aggregation assays8. This attested the faithful evaluation of binding of Notch with trans-ligands using cell aggregation assays. Although the aggregate formation is a readout of receptor-ligand binding, it can be intricate if the surface expression of the Notch receptor or its ligands is affected by the given modifiers. This highlights the limitation of the cell aggregation assays, as it cannot be distinguished if the change in aggregate formation is because of altered receptor-ligand binding or altered surface expression. Therefore, parallel to aggregation assays, the effects of each modifier on surface expression of Notch and ligands needs to be tested in S2 cells. In the context of our studies, surface levels of Notch and Delta were not affected in shams dsRNA-treated S2 cells8.
To examine the inhibition of trans-binding by addition of cis-ligands, aggregation assays were performed between S2-Delta cells and EGFP or shams dsRNA-treated S2-Notch&#38;Deltatransient cells. The number of aggregates formed between these cells was compared with the number of aggregates formed between S2-Delta cells and S2-Notchtransient cells. The relative decrease in the number of aggregates was calculated and used as an indicator for the magnitude of inhibition by cis-Delta. The control experiments showed that cis-ligands show a robust and dosage-dependent inhibition of Notch/trans-Delta binding over a rather wide range of Notch to cis-ligand ratios (1:1 to 1:0.1) (Figure 5A)8. A 1:1 ratio resulted in the strongest degree of cis-inhibition, and decreasing the relative level of cis-Delta weakened cis-inhibition. Accordingly, the KD experiments over this range of ratios was performed. Of note, the amount of Notch receptor and the total amount of transfected DNA was kept constant in all experiments. This will ensure that aggregate formation is primarily affected by the activity of cis-ligands and not by altered levels of Notch expression by the cells.
It was previously shown that co-expression of Notch and cis-ligands in S2 cells can result in the formation of homotypic aggregations14. To examine whether similar homotypic aggregations among S2-Notch&#38;Deltatransient or S2-Notch&#38;Serratetransient cells can compromise our interpretations of the aggregate quantifications in cis-ligand studies, a control aggregation assay was performed between S2-Notch&#38;Deltatransient and plain S2 cells. The number of S2 cells used in these experiments was the same as S2-Delta cells used in cis-Delta experiments. Some homotypic aggregation was observed, but quantification showed that the resultant aggregates contribute a low fraction of the total aggregates compared with the heterotypic aggregates between S2-Notch&#38;Deltatransient and S2-Delta cells (Figure 5B). We conclude that the changes observed in the number of aggregates in cis-ligand assays are primarily due to the inhibitory effect of cis-ligands on binding between Notch and trans-Delta.
In summary, the aggregation assays presented in this protocol provide an easy and straightforward methodology for semi-quantitative assessment of the trans- and cis-interactions of the Notch receptor and its ligands. These assays can be used to examine the effects of genetic or pharmacological Notch pathway modifiers on Notch-ligand binding in vitro and therefore can help elucidate the mechanisms underlying the in vivo effects of these modifiers on Notch signaling.

Canonical Notch signaling is a short-range cell to cell communication mechanism that requires physical contact of neighboring cells to facilitate the interaction between Notch receptors and their ligands1. Interaction of Notch receptor (present on the surface of signal-receiving cells) with ligands (present on the surface of signal-sending cells) initiates Notch signaling and is known as trans-activation2. On the other hand, interaction between Notch and its ligands in the same cell leads to the inhibition of Notch pathway and is known as cis-inhibition3. The balance between trans- and cis-interactions is required to ensure optimum ligand-dependent Notch signaling4. Drosophila has one Notch receptor and two ligands (Delta and Serrate) as opposed to mammals, which have four Notch receptors and five ligands [jagged 1 (JAG1), JAG2, delta-like 1 (DLL1), DLL3 and DLL4]5. Having this simplicity, the Drosophila model offers the ease to dissect/study the effects of pathway modifiers on Notch-ligand interactions and subsequently on Notch signaling. In certain contexts during animal development (including wing development in Drosophila), both cis- and trans-interactions are involved to achieve proper Notch signaling and cell fate1,6. It is important to distinguish the effects of Notch pathway modifiers in these contexts on cis- versus trans-interactions of Notch with its ligands.
Our group previously reported that addition of a carbohydrate residue called xylose to Drosophila Notch negatively regulates Notch signaling in certain contexts, including wing development7. Loss of shams (the enzyme that xylosylates Notch) leads to a &#34;loss of wing vein&#34; phenotype7. More recently, gene dosage experiments and clonal analysis were used to show that loss of shams enhances Delta-mediated Notch singling. To distinguish whether the enhanced Notch signaling in shams mutants is a result of decreased cis-inhibition or increased trans-activation, ectopic overexpression studies of Notch ligands in larval wing imaginal discs using the dpp-GAL4 driver were performed. These experiments provided evidence suggesting that Shams regulates trans-activation of Notch by Delta without affecting Notch cis-inhibition by ligands8. However, feed-back regulations and effects of endogenous ligands might complicate the interpretation of ectopic overexpression studies1,6,9.
To resolve this issue, Drosophila S2 cells10 were used, which provide a simple in vitro system for Notch-ligand interaction studies11,12. S2 cells do not express endogenous Notch receptor and Delta ligand11 and express a low level of Serrate13, which does not affect Notch-ligand aggregation experiments8. Therefore, S2 cells can be stably or transiently transfected by Notch and/or individual ligands (Delta or Serrate) to generate cells that exclusively express the Notch receptor or one of its ligands, or a combination of them. Mixing of Notch-expressing S2 cells with ligand-expressing S2 cells results in the formation of heterotypic aggregates mediated by receptor-ligand binding11,12,14. Quantification of the aggregate formation provides a measure of trans-binding between Notch and its ligands15 (Figure 1). Similarly, S2 cells can be co-transfected with Notch and Delta or Serrate ligands (i.e. cis-ligands). Cis-ligands in these Notch-expressing S2 cells abrogate the binding of Notch with trans-ligands and result in decreased aggregate formation8,12,14. The relative decrease in aggregate formation caused by cis-ligands provides a measure of the inhibitory effect of cis-ligands on binding between Notch and trans-ligands (Figure 2). Accordingly, cell aggregation assays were utilized to examine the effect of loss of xylosylation on trans- and cis-interactions between Notch and its ligands.
Here, we present a detailed protocol for cell aggregation assays aimed to evaluate the binding of Notch with trans-ligands and its inhibition by cis-ligands using Drosophila S2 cells. As an example, we provide the data that allowed us to determine the effect of Notch xylosylation on binding between Notch and trans-Delta8. These straightforward assays provide a semi-quantitative assessment of Notch-ligand interactions in vitro and help determine the molecular mechanisms underlying the in vivo effects of Notch pathway modifiers.

<table><tbody><tr><td>BioWhittaker Schneider&amp;rsquo;s Drosophila medium, Modified</td><td>Lonza</td><td>04-351Q</td><td></td></tr><tr><td>HyClone Penicillin-Streptomycin 100X solution</td><td>GE Healthcare lifescience&amp;nbsp;</td><td>SV30010</td><td></td></tr><tr><td>CELLSTAR 6 well plate</td><td>Greiner Bio-One</td><td>657 160</td><td></td></tr><tr><td>CELLSTAR 24 well plate</td><td>Greiner Bio-One</td><td>662160</td><td></td></tr><tr><td>VWR mini shaker</td><td>Marshell Sceintific</td><td>12520-956</td><td></td></tr><tr><td>Hemocytometer</td><td>Fisher Sceintific&amp;nbsp;</td><td>267110</td><td></td></tr><tr><td>FuGENE HD Transfection Reagent</td><td>Promega</td><td>E2311</td><td></td></tr><tr><td>MEGAscrip T7 Transcription Kit</td><td>Ambion</td><td>AM1334</td><td></td></tr><tr><td>Quick-RNA MiniPrep (RNA purification Kit)</td><td>Zymo Research</td><td>R1054</td><td></td></tr><tr><td>VistaVision Inverted microscope</td><td>VWR</td><td></td><td></td></tr><tr><td>9MP USB2.0 Microscope Digital Camera + Advanced Software</td><td>AmScope</td><td>MU-900</td><td>Image acquisition using ToupView software</td></tr><tr><td>PureLink Quick Gel Extraction Kit</td><td>Invitrogen</td><td>K210012</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>GenDepot</td><td>F0600-050</td><td></td></tr><tr><td>Methotrexate</td><td>Sigma-Aldrich</td><td>A6770-10</td><td></td></tr><tr><td>Hygromycin B</td><td>Invitrogen</td><td>HY068-L6</td><td></td></tr><tr><td>Copper sulphate</td><td>Macron Fine Chemicals</td><td>4448-02</td><td></td></tr><tr><td>S2 cells</td><td>Invitrogen</td><td>R69007</td><td></td></tr><tr><td>S2-Serrate&lt;sup&gt;Tom &lt;/sup&gt;cells</td><td></td><td></td><td>Gift from R. Fleming (Fleming et al, Development, 2013)</td></tr><tr><td>S2-Delta cells</td><td>DGRC</td><td>152</td><td></td></tr><tr><td>S2-Notch cells</td><td>DGRC</td><td>154</td><td></td></tr><tr><td>pMT-Delta vector</td><td>DGRC</td><td>1021</td><td>Gift from S. Artavanis-Tsakonas</td></tr><tr><td>pMT-Serrate vector</td><td></td><td></td><td>Gift from Ken Irvine (Okajima et al, JBC, 2003)</td></tr><tr><td>pMT-Notch vector</td><td>DGRC</td><td>1022</td><td>Gift from S. Artavanis-Tsakonas</td></tr><tr><td>pAc5.1-EGFP</td><td></td><td></td><td>Gift from Hugo Bellen</td></tr><tr><td>TaqMan RNA-to-Ct 1-&lt;em&gt;Step&lt;/em&gt; Kit</td><td>Applied Biosystem</td><td>1611091</td><td></td></tr><tr><td>TaqMan Gene Expression Assay for CG9996 (Shams)</td><td>Applied Biosystem</td><td>Dm02144576_g1&amp;nbsp;</td><td>with FAM-MGB dye</td></tr><tr><td>TaqMan Gene Expression Assay for CG7939 (RpL32)</td><td>Applied Biosystem</td><td>Dm02151827_g1</td><td>with FAM-MGB dye</td></tr><tr><td>Applied Biosystems 7900HT Fast Real-Time PCR system</td><td>Applied Biosystem</td><td>4351405</td><td>96-well Block module</td></tr></tbody></table>

cell aggregation assays to evaluate the binding of the drosophila notch with trans-ligands and its inhibition by cis-ligands

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the Notch receptor with ligands from neighboring cells induces activation of the signaling pathway (trans-activation), while interaction with ligands from the same cell inhibits signaling (cis-inhibition). Proper balance between trans-activation and cis-inhibition helps establish optimal levels of Notch signaling in some contexts during animal development. Because of the overlapping expression domains of Notch and its ligands in many cell types and the existence of feedback mechanisms, studying the effects of a given post-translational modification on trans- versus cis-interactions of Notch and its ligands in vivo is difficult. Here, we describe a protocol for using Drosophila S2 cells in cell-aggregation assays to assess the effects of knocking down a Notch pathway modifier on the binding of Notch to each ligand in trans and in cis. S2 cells stably or transiently transfected with a Notch-expressing vector are mixed with cells expressing each Notch ligand (S2-Delta or S2-Serrate). Trans-binding between the receptor and ligands results in the formation of heterotypic cell aggregates and is measured in terms of the number of aggregates per mL composed of &#62;6 cells. To examine the inhibitory effect of cis-ligands, S2 cells co-expressing Notch and each ligand are mixed with S2-Delta or S2-Serrate cells and the number of aggregates is quantified as described above. The relative decrease in the number of aggregates due to the presence of cis-ligands provides a measure of cis-ligand-mediated inhibition of trans-binding. These straightforward assays can provide semi-quantitative data on the effects of genetic or pharmacological manipulations on the binding of Notch to its ligands, and can help deciphering the molecular mechanisms underlying the in vivo effects of such manipulations on Notch signaling.

Our in vivo observations suggested that loss of the xylosyltransferase gene shams results in gain of Notch signaling due to increased Delta-mediated trans-activation of Notch without affecting the cis-inhibition of Notch by ligands8. To test this notion, in vitro cell aggregation assays were performed. First, shams expression in S2 cells was knocked down using shams dsRNA. EGFP dsRNA was used as control. Efficiency of knockdown (KD) was examined by real-time PCR and was shown to be greater than 80%8. Then, the binding of Notch receptor with trans-Delta upon shams KD was examined using aggregation assays. The aggregation between S2-Notch and S2-Delta cells was examined at various time points after mixing them. Aggregation between plain S2 cells and S2-Delta cells was taken as background control. Figure 3 shows the graph indicating the number of aggregates formed at different time points (1, 5, 15 and 30 min) after mixing. A sharp increase was observed in the number of aggregates between 1 and 5 min. Afterwards, the number of aggregates continued to increase until 30 min at a slower rate. Therefore, aggregate formation was imaged at 1, 5 and 15 min and the number of aggregates was quantified after 5 min of mixing.
Figure 4A shows representative images of cell aggregation assays between stable S2-Notch and S2-Delta cells to assess the effects of shams KD on the binding between Notch receptor and trans-Delta. Images show the aggregation at three-time points (1, 5 and 15 min). For background control, plain S2 cells (treated with shams dsRNA) were mixed with S2-Delta cells. EGFP dsRNA-treated S2-Notch cells formed aggregates with S2-Delta cells, which increase in number with time. In contrast, shams dsRNA-treated S2-Notch cells formed aggregates faster, and the aggregates were bigger and greater in number than the control ones (Figure 4B). This indicated that decreasing Shams levels enhances the trans-binding of Notch with Delta8.
To examine whether Shams regulates the inhibitory effect of cis-ligands on binding between Notch and trans-Delta, we first established that co-expression of Notch and Delta in the signal-receiving cell can decrease the cell aggregation mediated by Notch and trans-Delta. Figure 5A shows the graph indicating the number of aggregates formed between S2-Delta and S2-Notch&#38;Deltatransient cells with different amounts of cis-Delta. Transfecting equal amounts of Notch- and Delta-expression constructs into S2 cells dramatically decreases the number of aggregates formed between these cells and S2-Delta cells. Moreover, decreasing the amount of cis-Delta results in an increase in the number of aggregates, indicating that in the range of Notch/cis-Delta ratios used in these assays, cis-Delta can inhibit the binding between Notch and trans-Delta in a dosage-dependent manner. Since the S2-Notch&#38;Deltatransient cells express both Notch and Delta, they might form homotypic aggregates independently of the S2-Delta cells. To examine if the formation of homotypic aggregates among S2-Notch&#38;Deltatransient cells can be a confounding factor in the cis-inhibition assays shown in Figure 5A, we mixed these cells with S2 cells and quantified the aggregates. Figure 5B shows the number of aggregates formed after mixing S2 cells with S2-Notch&#38;Deltatransient cells expressing various Notch/cis-Delta ratios. A rather small number of homotypic aggregates compared to heterotypic aggregates as shown in Figure 5A was observed. We conclude that these aggregation assays faithfully measure the effect of cis-Delta on binding between Notch and trans-Delta.
We next examined the effect of shams KD on the inhibitory ability of cis-Delta. To this end, aggregation between S2-Delta and S2-Notch&#38;Deltatransient cells was examined. Figure 6A shows representative images of aggregation between S2-Delta cells and S2-Notchtransient (control) or S2-Notch&#38;Deltatransient cells. S2-Delta and EGFP dsRNA-treated S2-Notchtransient cells formed aggregates, which increase in number with time, similar to the aggregation between S2-Delta and stable S2-Notch cells (Figure 4). Notably, mixing S2-Delta and S2-Notch&#38;Deltatransient cells co-transfected with equal amounts of Notch- and Delta-expression plasmids formed less aggregates upon both EGFP KD and shams KD, suggesting that decreasing the level of Shams does not affect the ability of cis-Delta to block Notch/trans-Delta binding. To better assess the effects of shams KD on the activity of cis-Delta, the magnitude of inhibition by cis-Delta was measured by calculating the relative aggregation percentage over a range of Notch/cis-Delta ratios as explained in Section 3.4.2. Quantification of relative aggregation showed a comparable inhibition of aggregation upon EGFP and shams dsRNA treatment (Figure 6B). Together, these observations strongly suggest that loss of xylosylation promotes trans-binding without affecting cis-inhibition8, and provide a molecular mechanism for the wing vein loss phenotype observed in shams mutants.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56919/56919fig1.jpg" /> 
Figure 1: Schematic Representation of Cell Aggregation Assay for Trans-binding. Diagram showing induction of receptor (S2-Notch) and ligand (S2-Delta or S2-Serrate) expressing S2 cells by 0.7 mM CuSO4. Induction of both S2 cells is followed by mixing, which tends to make aggregates. These aggregates (&#62;6 cells) are imaged and quantified. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56919/56919fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56919/56919fig2.jpg" /> 
Figure 2: Schematic Representation of Cell Aggregation Assay to Assess Cis-inhibition. S2 cells were transiently transfected with pMT-Notch (S2-Ntransient), pMT-Notch and pMT-Delta (S2-Notch&#38;Deltatransient), or pMT-Notch and pMT-Serrate (S2-Notch&#38;Serratetransient). After induction by 0.7 mM CuSO4 and mixing with S2-Delta cells, aggregates (&#62;6 cells) are quantified. Inhibition by cis-ligands is measured in terms of relative aggregation percentage in the presence and absence of each cis-ligand. The effects of cis-ligands on binding between Notch and trans-Serrate can be determined by mixing the transiently-transfected cells with S2-SerrateTom cells (not shown). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56919/56919fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56919/56919fig3.jpg" /> 
Figure 3: Aggregation between S2-Notch and S2 or S2-Delta Cells at Different Time Points. Graph shows the number of aggregates per mL at different time points (1, 5, 15 and 30 min) between the indicated types of cells. Error bars indicate standard error of the mean (SEM) of three replicates. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56919/56919fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56919/56919fig4.jpg" /> 
Figure 4: Cell Aggregation Mediated by Notch and trans-Delta. (A) Images show aggregation at different time points (1, 5 and 15 min). Aggregation between shams dsRNA-treated plain S2 cells and S2-Delta cells was taken as background control. Shams-dsRNA treated S2-Notch cells show an increase in the number and size of aggregates compared to EGFP dsRNA-treated (control) S2-Notch cells after mixing with S2-Delta cells. Scale bar = 100 &#181;m. (B) Quantification of number of cell aggregates greater than 6 cells after 5 min of aggregation. Error bars indicate SEM. * P &#60;0.01 (One-way Analysis of Variance (ANOVA)). Three replicates with three independent repeats were performed. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56919/56919fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56919/56919fig5.jpg" /> 
Figure 5: Cis-Delta Inhibits the Cell Aggregate Formation Mediated by Notch and trans-Delta in a Dosage-dependent Manner. (A) Graph shows the aggregation (in terms of number of aggregates/mL) between S2-Delta cells and S2 cells transiently transfected with different ratios of expression vectors for Notch and cis-Delta (1:0, 1:1, 1:0.5, 1:0.2 and 1:0.1). Error bars indicate SEM. * P &#60;0.01 (One-way ANOVA). Three replicates with three independent repeats were performed. Note that decreasing the level of cis-Delta results in an increase in aggregation, likely due to reduced cis-inhibition. (B) Graph showing homotypic aggregation (in terms of number of aggregates per mL) in S2 cells transiently transfected with different ratios of Notch and Delta (1:0, 1:1, 1:0.5, 1:0.2 and 1:0.1) and mixed with plain S2 cells. Error bars indicate SEM. Number of aggregates is much smaller than the number of heterotypic aggregates formed between S2-Delta and S2-Notch&#38;Deltatransient cells. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56919/56919fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56919/56919fig6.jpg" /> 
Figure 6: Knockdown of shams does not Affect the Inhibitory Activity of cis-Delta. (A) Shown are representative images of the effect of shams KD on cis-Delta-mediated inhibition of cell aggregation mediated by Notch/trans-Delta binding. Images show aggregation at different time points (1, 5 and 15 min). Aggregation between shams dsRNA-treated plain S2 cells and S2-Delta cells was taken as background control. Similar to stably transfected S2-Notch cells, shams KD increased the number of aggregates between S2-Delta and S2-Notchtransient cells as compared to control (EGFP dsRNA-treated). Co-expression of cis-Delta with Notch in a 1:1 ratio resulted in a comparable decrease in the number of aggregates in control (EGFP dsRNA-treated) as well as in shams dsRNA treated cells. Scale bar = 100 &#181;m. (B) Graph shows relative aggregation between S2-Delta cells and S2 cells transiently co-transfected with indicated ratios (1:0, 1:1, 1:0.5, 1:0.2 and 1:0.1) of Notch and cis-Delta. EGFP and shams dsRNA treatment show a comparable decrease in aggregation at each Notch/cis-Delta ratio. Data presented here are representative of three independent experiments. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56919/56919fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands at JoVE.com

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Notch signaling is an evolutionarily conserved cell-cell communication system used broadly in animal development and adult maintenance. Interaction of the ...

cell-aggregation-assays-to-evaluate-binding-drosophila-notch-with

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

7.4K Views.  Baylor College of Medicine. Complexity of in vivo systems makes it difficult to distinguish between the activation and inhibition of Notch receptor by trans- and cis-ligands, respectively. Here, we present a protocol based on in vitro cell-aggregation assays for qualitative and semi-quantitative evaluation of the binding of Drosophila Notch to trans-ligands vs cis-ligands.

Video: Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Drug-induced Sensitization of Adenylyl Cyclase: Assay Streamlining and Miniaturization for Small Molecule and siRNA Screening Applications

Sensitization of adenylyl cyclase (AC) signaling has been implicated in a variety of neuropsychiatric and neurologic disorders including substance abuse and Parkinson&#39;s disease. Acute activation of G&#945;i/o-linked receptors inhibits AC activity, whereas persistent activation of these receptors results in heterologous sensitization of AC and increased levels of intracellular cAMP. Previous studies have demonstrated that this enhancement of AC responsiveness is observed both in vitro and in vivo following the chronic activation of several types of G&#945;i/o-linked receptors including D2 dopamine and &#956; opioid receptors. Although heterologous sensitization of AC was first reported four decades ago, the mechanism(s) that underlie this phenomenon remain largely unknown. The lack of mechanistic data presumably reflects the complexity involved with this adaptive response, suggesting that nonbiased approaches could aid in identifying the molecular pathways involved in heterologous sensitization of AC. Previous studies have implicated kinase and Gb&#947; signaling as overlapping components that regulate the heterologous sensitization of AC. To identify unique and additional overlapping targets associated with sensitization of AC, the development and validation of a scalable cAMP sensitization assay is required for greater throughput. Previous approaches to study sensitization are generally cumbersome involving continuous cell culture maintenance as well as a complex methodology for measuring cAMP accumulation that involves multiple wash steps. Thus, the development of a robust cell-based assay that can be used for high throughput screening (HTS) in a 384&#160;well format would facilitate future studies. Using two D2 dopamine receptor cellular models (i.e.&#160;CHO-D2L and HEK-AC6/D2L), we have converted our 48-well sensitization assay (&#62;20 steps 4-5 days) to a five-step, single day assay in 384-well format. This new format is amenable to small molecule screening, and we demonstrate that this assay design can also be readily used for reverse transfection of siRNA in anticipation of targeted siRNA library screening.

Persistent activation of inhibitory G protein-coupled receptors results in sensitization of adenylyl cyclase signaling. To identify the essential molecular pathways, nonbiased approaches are necessary; however, this strategy requires the development of a scalable cell-based cAMP sensitization assay. Herein, we describe a sensitization assay for small molecule and siRNA screening.

Sensitization of adenylyl cyclase (AC) signaling has been implicated in a variety of neuropsychiatric and neurologic disorders including substance abuse ...

Bioengineering

Methods to Assay Drosophila Behavior

Drosophila melanogaster, the fruit fly, has been used to study molecular mechanisms of a wide range of human diseases such as cancer, cardiovascular disease and various neurological diseases1. We have optimized simple and robust behavioral assays for determining larval locomotion, adult climbing ability (RING assay), and courtship behaviors of Drosophila. These behavioral assays are widely applicable for studying the role of genetic and environmental factors on fly behavior. Larval crawling ability can be reliably used for determining early stage changes in the crawling abilities of Drosophila larvae and also for examining effect of drugs or human disease genes (in transgenic flies) on their locomotion. The larval crawling assay becomes more applicable if expression or abolition of a gene causes lethality in pupal or adult stages, as these flies do not survive to adulthood where they otherwise could be assessed. This basic assay can also be used in conjunction with bright light or stress to examine additional behavioral responses in Drosophila larvae. Courtship behavior has been widely used to investigate genetic basis of sexual behavior, and can also be used to examine activity and coordination, as well as learning and memory. Drosophila courtship behavior involves the exchange of various sensory stimuli including visual, auditory, and chemosensory signals between males and females that lead to a complex series of well characterized motor behaviors culminating in successful copulation. Traditional adult climbing assays (negative geotaxis) are tedious, labor intensive, and time consuming, with significant variation between different trials2-4. The rapid iterative negative geotaxis (RING) assay5 has many advantages over more widely employed protocols, providing a reproducible, sensitive, and high throughput approach to quantify adult locomotor and negative geotaxis behaviors. In the RING assay, several genotypes or drug treatments can be tested simultaneously using large number of animals, with the high-throughput approach making it more amenable for screening experiments.

Methods to Assay Drosophila Behavior

Drosophila melanogaster is a genetically and behaviorally tractable model system that has been used to understand the molecular and cellular basis of many important biological processes for over a century 1. Drosophila has been well exploited to gain insights into the genetic basis of fly behavior.

Drosophila melanogaster, the fruit fly, has been used to study molecular mechanisms of a wide range of human diseases such as cancer, cardiovascular ...

Neuroscience

A Cell-based Assay to Investigate Non-muscle Myosin II Contractility via the Folded-gastrulation Signaling Pathway in Drosophila S2R+ Cells

We have developed a cell-based assay using Drosophila cells that recapitulates apical constriction initiated by folded gastrulation (Fog), a secreted epithelial morphogen. In this assay, Fog is used as an agonist to activate Rho through a signaling cascade that includes a G-protein-coupled receptor (Mist), a G&#945;12/13 protein (Concertina/Cta), and a PDZ-domain-containing guanine nucleotide exchange factor (RhoGEF2). Fog signaling results in the rapid and dramatic reorganization of the actin cytoskeleton to form a contractile purse string. Soluble Fog is collected from a stable cell line and applied ectopically to S2R+ cells, leading to morphological changes like apical constriction, a process observed during developmental processes such as gastrulation. This assay is amenable to high-throughput screening and, using RNAi, can facilitate the identification of additional genes involved in this pathway.

A Cell-based Assay to Investigate Non-muscle Myosin II Contractility via the Folded-gastrulation Signaling Pathway in Drosophila S2R+ Cells

Here we describe a contractility assay using Drosophila S2R+ cells. The application of an exogenous ligand, folded gastrulation (Fog), leads to the activation of the Fog signaling pathway and cellular contractility. This assay can be used to investigate the regulation of cellular contractility proteins in the Fog signaling pathway.

We have developed a cell-based assay using Drosophila cells that recapitulates apical constriction initiated by folded gastrulation (Fog), a secreted ...

Live Dissection of Drosophila Embryos: Streamlined Methods for Screening Mutant Collections by Antibody Staining

Drosophila embryos between stages 14 and 17 of embryonic development can be readily dissected to generate "fillet" preparations. In these preparations, the central nervous system runs down the middle, and is flanked by the body walls. Many different phenotypes have been examined using such preparations. In most cases, the fillets were generated by dissection of antibody-stained fixed whole-mount embryos. These "fixed dissections" have some disadvantages, however. They are time-consuming to execute, and it is difficult to sort mutant (GFP-negative) embryos from stocks in which mutations are maintained over GFP balancer chromosomes. Since 2002, our group has been conducting deficiency and ectopic expression screens to identify ligands for orphan receptors. In order to do this, we developed streamlined protocols for live embryo dissection and antibody staining of collections containing hundreds of balanced lines. We have concluded that it is considerably more efficient to examine phenotypes in large collections of stocks by live dissection than by fixed dissection. Using the protocol described here, a single trained individual can screen up to 10 lines per day for phenotypes, examining 4-7 mutant embryos from each line under a compound microscope. This allows the identification of mutations conferring subtle, low-penetrance phenotypes, since up to 70 hemisegments per line are scored at high magnification with a 40X water-immersion lens.

Live Dissection of Drosophila Embryos: Streamlined Methods for Screening Mutant Collections by Antibody Staining

We describe a streamlined protocol for generating "fillet" preparations of Drosophila embryos of specific genotypes. This protocol allows efficient execution of a variety of genetic screens. It also allows excellent visualization of structures in the late embryo.

Drosophila embryos between stages 14 and 17 of embryonic development can be readily dissected to generate "fillet" preparations.  In these preparations, ...

Biology

Detection of In Situ Protein-protein Complexes at the Drosophila Larval Neuromuscular Junction Using Proximity Ligation Assay

Discs large (Dlg) is a conserved member of the membrane-associated guanylate kinase family, and serves as a major scaffolding protein at the larval neuromuscular junction (NMJ) in Drosophila. Previous studies have shown that the postsynaptic distribution of Dlg at the larval NMJ overlaps with that of Hu-li tai shao (Hts), a homologue to the mammalian adducins. In addition, Dlg and Hts are observed to form a complex with each other based on co-immunoprecipitation experiments involving whole adult fly lysates. Due to the nature of these experiments, however, it was unknown whether this complex exists specifically at the NMJ during larval development.
Proximity Ligation Assay (PLA) is a recently developed technique used mostly in cell and tissue culture that can detect protein-protein interactions in situ. In this assay, samples are incubated with primary antibodies against the two proteins of interest using standard immunohistochemical procedures. The primary antibodies are then detected with a specially designed pair of oligonucleotide-conjugated secondary antibodies, termed PLA probes, which can be used to generate a signal only when the two probes have bound in close proximity to each other. Thus, proteins that are in a complex can be visualized. Here, it is demonstrated how PLA can be used to detect in situ protein-protein interactions at the Drosophila larval NMJ. The technique is performed on larval body wall muscle preparations to show that a complex between Dlg and Hts does indeed exist at the postsynaptic region of NMJs.

Detection of In Situ Protein-protein Complexes at the Drosophila Larval Neuromuscular Junction Using Proximity Ligation Assay

This protocol demonstrates how Proximity Ligation Assay can be used to detect in situ protein-protein interactions at the Drosophila larval neuromuscular junction. With this technique, Discs large and Hu-li tai shao are shown to form a complex at the postsynaptic region, an association previously identified through co-immunoprecipitation.

Discs large (Dlg) is a conserved member of the membrane-associated guanylate kinase family, and serves as a major scaffolding protein at the larval ...

Enhancing Protein Visualization with Antibody-Mediated Live Imaging

Visualizing Low-Abundance Proteins and Post-Translational Modifications in Living Drosophila Embryos via Fluorescent Antibody Injection

Visualization of proteins in living cells using GFP (Green Fluorescent Protein) and other fluorescent tags has greatly improved understanding of protein localization, dynamics, and function. Compared to immunofluorescence, live imaging more accurately reflects protein localization without potential artifacts arising from tissue fixation. Importantly, live imaging enables quantitative and temporal characterization of protein levels and localization, crucial for understanding dynamic biological processes such as cell movement or division. However, a major limitation of fluorescent tagging approaches is the need for sufficiently high protein expression levels to achieve successful visualization. Consequently, many endogenously tagged fluorescent proteins with relatively low expression levels cannot be detected. On the other hand, ectopic expression using viral promoters can sometimes lead to protein mislocalization or functional alterations in physiological contexts. To address these limitations, an approach is presented that utilizes highly sensitive antibody-mediated protein detection in living embryos, essentially performing immunofluorescence without the need for tissue fixation. As proof of principle, endogenously GFP-tagged Notch receptor that is barely detectable&#160;in living embryos can be successfully visualized after antibody injection. Furthermore, this approach was adapted to visualize post-translational modifications (PTMs) in living embryos, allowing the detection of temporal changes in tyrosine phosphorylation patterns during early embryogenesis and revealing a novel subpopulation of phosphotyrosine (p-Tyr) underneath apical membranes. This approach can be modified to accommodate other protein-specific, tag-specific, or PTM-specific antibodies and should be compatible with other injection-amenable model organisms or cell lines. This protocol opens new possibilities for live imaging of low-abundance proteins or PTMs that were previously challenging to detect using traditional fluorescent tagging methods.

Author Spotlight: Unveiling the Dynamics of Mechanical and Biochemical Signals in Animal Morphogenesis Research 

This protocol describes the customized antibody-based fluorescence labeling and injection into early Drosophila embryos to enable live imaging of low-abundance proteins or post-translational modifications that are challenging to detect using traditional GFP/mCherry-tag approaches.

Visualization of proteins in living cells using GFP (Green Fluorescent Protein) and other fluorescent tags has greatly improved understanding of protein ...

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse formation and maintenance. Many of these fundamental interactions occur in trans and are typically induced by heterophilic or homophilic interactions between cells expressing membrane anchored binding pairs. Elucidating how disease relevant mutations disrupt these fundamental protein interactions can provide insight into a myriad of cell biology fields. Many protein-protein interaction assays do not typically disambiguate between cis and trans interactions, which potentially leads to an overestimation of the extent of binding that is occurring in vivo and involve labor intensive purification of protein and/or specialized monitoring equipment. Here, we present an optimized simple protocol that allows for the observation and quantification of only trans interactions without the need for lengthy protein purifications or specialized equipment. The HEK cell aggregation assay involves the mixing of two independent populations of HEK cells, each expressing membrane-bound cognate ligands. After a short incubation period, samples are imaged and the resulting aggregates are quantified.

Here, we present an optimized protocol to rapidly and semiquantitatively measure ligand-receptor interactions in trans in a heterologous cell system using fluorescence microscopy.

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

Characterization of G Protein-coupled Receptors by a Fluorescence-based Calcium Mobilization Assay

For more than 20 years, reverse pharmacology has been the preeminent strategy to discover the activating ligands of orphan G protein-coupled receptors (GPCRs). The onset of a reverse pharmacology assay is the cloning and subsequent transfection of a GPCR of interest in a cellular expression system. The heterologous expressed receptor is then challenged with a compound library of candidate ligands to identify the receptor-activating ligand(s). Receptor activation can be assessed by measuring changes in concentration of second messenger reporter molecules, like calcium or cAMP. The fluorescence-based calcium mobilization assay described here is a frequently used medium-throughput reverse pharmacology assay. The orphan GPCR is transiently expressed in human embryonic kidney 293T (HEK293T) cells and a promiscuous G&#945;16 construct is co-transfected. Following ligand binding, activation of the G&#945;16 subunit induces the release of calcium from the endoplasmic reticulum. Prior to ligand screening, the receptor-expressing cells are loaded with a fluorescent calcium indicator, Fluo-4 acetoxymethyl. The fluorescent signal of Fluo-4 is negligible in cells under resting conditions, but can be amplified more than a 100-fold upon the interaction with calcium ions that are released after receptor activation. The described technique does not require the time-consuming establishment of stably transfected cell lines in which the transfected genetic material is integrated into the host cell genome. Instead, a transient transfection, generating temporary expression of the target gene, is sufficient to perform the screening assay. The setup allows medium-throughput screening of hundreds of compounds. Co-transfection of the promiscuous G&#945;16, which couples to most GPCRs, allows the intracellular signaling pathway to be redirected towards the release of calcium, regardless of the native signaling pathway in endogenous settings. The HEK293T cells are easy to handle and have proven their efficacy throughout the years in receptor deorphanization assays. However, optimization of the assay for specific receptors may remain necessary.

The here described fluorescence-based calcium mobilization assay is a medium-throughput reverse pharmacology screening system for the identification of functionally activating ligand(s) of orphan G protein-coupled receptors (GPCRs).

For more than 20 years, reverse pharmacology has been the preeminent strategy to discover the activating ligands of orphan G protein-coupled receptors ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Cell Aggregation Assay to Detect Trans Interactions between Cell Adhesion Molecules

Source: Restrepo, S., et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/61237">Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the technique to measure transcellular interactions between synaptic cell adhesion molecules through the HEK cell aggregation assay. In this assay, an equal number of HEK cells expressing a desired presynaptic cell adhesion molecule and a fluorescent protein are mixed with HEK cells expressing a post-synaptic cell adhesion molecule and another fluorescent protein. The interaction between the cell adhesion molecules forces the cells to aggregate, which can be measured by fluorescence microscopy.

Source: Restrepo, S., et al., Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System. J. Vis. Exp. (2020)
In this ...

Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands

Summary

Explore More Videos

Chapters in this video

Drug-induced Sensitization of Adenylyl Cyclase: Assay Streamlining and Miniaturization for Small Molecule and siRNA Screening Applications

Methods to Assay Drosophila Behavior

A Cell-based Assay to Investigate Non-muscle Myosin II Contractility via the Folded-gastrulation Signaling Pathway in Drosophila S2R+ Cells

Live Dissection of Drosophila Embryos: Streamlined Methods for Screening Mutant Collections by Antibody Staining

Detection of In Situ Protein-protein Complexes at the Drosophila Larval Neuromuscular Junction Using Proximity Ligation Assay

Visualizing Low-Abundance Proteins and Post-Translational Modifications in Living Drosophila Embryos via Fluorescent Antibody Injection

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Characterization of G Protein-coupled Receptors by a Fluorescence-based Calcium Mobilization Assay

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Cell Aggregation Assay to Detect Trans Interactions between Cell Adhesion Molecules