This work was supported by Grants from the National Institute of Mental Health (R00MH103531 and R01MH116901 to J.A.), a predoctoral training Grant from the National Institute of General Medicine (T32GM007635 to S.R.), and a Lyda Hill Gilliam Fellowship for Advanced Study (GT11021 to S.R.). We thank Dr. Kevin Woolfrey for help with the microscope, Dr. K Ulrich Bayer for the use of his epifluorescent microscope, and Thomas S&#252;dhof (Stanford University) for the LRRTM2 plasmid.

1. Cell culture and transfection
<ol>
	<li>Make HEK cell media with DMEM, 1x (Dulbecco&#39;s Modification of Eagle&#39;s Medium) supplemented with 4.5 g/L glucose, L-glutamine &#38; sodium pyruvate and 10% FBS. Sterile filter.</li>
	<li>Predetermine suitable ligands and receptors for aggregation assay. 
	NOTE: Neurexin3&#945; SS4+/- and one of its known ligands, LRRTM2, were used in this study. Ligands and receptors of interest were expressed from cDNAs in pcDNA3.1. A Gibson assembly was used to insert Neurexin3&#945; into pcDNA3.112. Neurexin3&#945; F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/ 
	GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.</li>
	<li>Prepare HEK293T cells.
	<ol>
		<li>Grow HEK293T cells to confluency in one T-75 flask.</li>
		<li>Once confluent, use 2 mL of trypsin and place in 37 &#176;C incubator for 2 min. Add 6 mL of HEK media to the flask to resuspend cells and transfer all 8 mL to a 15 mL conical tube.</li>
		<li>Pellet at 500 x g for 5 min and resuspend in HEK cell media for a total of 8 mL.</li>
		<li>Count cells and add 735,000 cells into each well of a 6-well plate. Adjust final volume to 2 mL for each well using HEK cell media.</li>
		<li>Place in 37 &#176;C incubator and allow cells to grow overnight or until they reach 50-60% confluency.</li>
	</ol>
	</li>
	<li>Transfect HEK293T cells using the calcium phosphate method13.
	<ol>
		<li>Transfect well-1 with 3 &#181;g of the protein of interest and co-transfect with 1 &#181;g of fluorescent protein (3 &#181;g of pcDNA3.1-Neurexin3&#945;WT SS4- and 1 &#181;g of mCherry).</li>
		<li>Transfect well-2 as in step 1.4.1. but with the mutated protein of interest (pcDNA3.1-Neurexin3&#945;A687T SS4-).</li>
		<li>Transfect well-3 with 3 &#181;g of the ligand of interest and co-transfect with 1 &#181;g of another fluorescent protein (3 &#181;g of pcDNA3.1 LRRTM2 and 1 &#181;g of GFP).</li>
		<li>Transfect well-4 and well-5 to serve as negative controls: well-4 with 1 &#181;g of GFP and well-5 with 1 &#181;g of mCherry.</li>
		<li>Prepare another plate (as in step 1.4.1-1.4.4) if requiring additional conditions or controls (Neurexin3&#945;WT/A687T SS4+). 
		NOTE: Transfection efficiency is analyzed 24 h after transfection under an epifluorescence microscope and quantified as the number of cells expressing the fluorescent protein they were transfected with. A more streamlined approach would include the transfection of HEK cells with a bicistronic vector coding for a fluorescent protein and the ligand of interest and is highly recommended above co-transfection. In the case of this study, alpha Neurexins are ~4.3 kb and low fluorescence intensity was observed using a bicistronic system necessitating co-transfection.</li>
	</ol>
	</li>
	<li>48 hours after transfection, harvest cells for aggregation.
	<ol>
		<li>Wash each well twice with PBS.</li>
		<li>Add 1 mL of 10 mM EDTA in PBS into each well to gently dissociate cell-to-cell interactions and incubate plate at 37 &#176;C for 5 min. 
		NOTE: Trypsin is not recommended for step 1.5.2 due to potential proteolytic cleavage of adhesion molecules in study. Additionally, after EDTA addition the protocol may not be stopped until completion as cells will now be exposed to ambient conditions.</li>
		<li>Gently tap plate to detach the cells, and harvest each well into separate 15 mL conical tubes.</li>
		<li>Centrifuge conical tubes at 500 x g and room temperature for 5 min.</li>
	</ol>
	</li>
	<li>While cells are pelleting, prepare 6 incubation tubes by labeling the top of each microcentrifuge tube with each condition. 
	NOTE: Each permutation of GFP and mCherry conditions should be used to encompass all experimental conditions and proper controls. For example: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3&#945;WT SS4-&#8212;mCherry, 4. GFP/Neurexin3&#945;A687T SS4- &#8211;mCherry, 5. Neurexin3&#945;WT SS4-&#8212;mCherry/LRRTM2&#8212;GFP, 6. Neurexin3&#945;A687T SS4- &#8211;mCherry/LRRTM2&#8212;GFP. Make additional tubes to accommodate further conditions and controls.</li>
	<li>Remove the supernatant and resuspend cells in 500 &#181;L of HEK media with 10 mM CaCl2 and 10 mM MgCl2 warmed to 37 &#176;C. 
	NOTE: The addition of CaCl2 and MgCl2 allows adhesion molecules to reestablish binding and is only required if the transcellular interaction partners in question require divalent cations for adhesion.</li>
	<li>Count the cells in each 15 mL conical tube using a hemocytometer and aliquot 200,000 cells of each condition into appropriate tube from step 1.6.1 for a 1:1 mix in a total volume of 500 &#181;L. 
	NOTE: It should only take 5 min per condition to count and aliquot amounts.</li>
	<li>Incubate tubes at room temperature in a slow tube rotator.</li>
</ol>
2. Image acquisition
<ol>
	<li>Optimize microscope acquisition parameters for specific samples. In this example, images were taken on a wide-field microscope. Use a 5x air objective (NA: 0.15; WD: 20000 &#956;m) to get a large enough field for analysis.</li>
	<li>Assess baseline aggregation immediately after mixing the two conditions of HEK cells in step 1.8. These are now the &#8216;time zero&#8217; images.
	<ol>
		<li>Pipette 40 &#181;L of each sample mixture onto a charged microscope slide and image under fluorescence in both the 488 and 561 channels.</li>
		<li>Acquire three different fields of view at one focus plane per sample drop.</li>
	</ol>
	</li>
	<li>Acquire final images at 60 min as the &#8216;time 60&#8217; image.
	<ol>
		<li>To obtain the &#8216;time 60&#8217; image of the mixture after a 60 min incubation, take another 40 &#181;L sample of each condition from rotating tubes and pipette each sample onto a charged slide. Image as in step 2.2.2. 
		NOTE: Cell aggregation should be checked every 15 min until saturation occurs. Timing of aggregation will depend on the proteins being tested.</li>
	</ol>
	</li>
</ol>
3. ImageJ/Fiji Analysis
<ol>
	<li>To quantify the extent of aggregation using Fiji/ImageJ, save analysis files.
	<ol>
		<li>Save the provided Supplemental coding files into the imageJ macros folder on the computer.</li>
		<li>Install the aggregation macro provided (Plugins, Macros, Install, and select the &#8220;AggregationAssay.txt&#8221; file).</li>
	</ol>
	</li>
	<li>Determine thresholds.
	<ol>
		<li>Load a &#8216;time zero&#8217; .tif file into imageJ and split the channels (Image | Color | Split Channels). 
		NOTE: The &#8216;time zero&#8217; image is used to determine the thresholding and smallest puncta size for the whole experiment.</li>
		<li>Mask each channel (Plugins | Macros | AggregationAssay_MakeMask). Make Mask From Image window will appear. Check boxes next to Determine Threshold for Image and Determine Cluster Params from Histogram and click OK.</li>
		<li>Determine the threshold of the image using the slide bar, record the number to the right of the slide bar and click OK.</li>
		<li>A Histogram of Cluster Size will appear. Select a cluster size from the histogram that suits the experiment, type this number in the Min Cluster Size: box, and click OK. Clusters below this size will not be analyzed.</li>
	</ol>
	</li>
	<li>Run the analysis.
	<ol>
		<li>Open the &#8216;time 60&#8217; image of condition 1 in imageJ and split the channels as in step 3.2.1.</li>
		<li>Mask each channel (Plugins, Macros, AggregationAssay_MakeMask). Use the same threshold and size determined in step 3.2.3 and step 3.2.4. Unselect the boxes next to Determine Threshold for Image and Determine Cluster Params from Histogram and manually type the size and thresholds into the appropriate fields then click OK.</li>
		<li>Calculate the aggregation index (Plugins | Macros | AggregationAssay_CalculateOverlap). Select the masked channels to be compared and directory into which the resulting files will save.</li>
		<li>Repeat steps 3.3.1&#8211;3.3.3 for every &#8216;time 60&#8217; image in every condition. 
		NOTE: The aggregation index is defined as the total overlap area divided by the sum of the two channel areas minus the overlap area multiplied by 100 (Aggregation index = overlap area/[area of channel 1 + area of channel 2 &#8211; overlap area] x 100). This normalization is an &#8216;OR&#8217; operation between the two masked channels representing the total pixels in either mask.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

The authors have nothing to disclose.

Dissecting the protein-protein interactions that occur in trans during cell adhesion can lead to a better understanding of the molecular mechanisms underlying basic cellular processes including the formation, function and maintenance of synapses during maturation and remodeling. The implications of cell-to-cell interactions expand beyond neurobiology and have broader roles in signal transduction, cell migration and tissue development14. Aberrations in cell adhesion can disrupt cellular processes imperative for proper cell function and can underly a variety of etiologies such as cancer, arthritis, addiction, autism and schizophrenia1,15,16. Here, we provide an optimized detailed protocol involving HEK cell aggregation that allows for testing cell-adhesion interactions in trans. 
With this HEK cell aggregation protocol, we can dissect differences in aggregation to approximate binding capacity between a presynaptic protein and its postsynaptic ligand. As such, we can ask questions such as: is the interaction between two essential synaptic proteins affected by a point mutation? More specifically, is the trans interaction of Neurexin3&#945; with LRRTM2 affected by A687T? The A687T missense mutation studied here is located in a previously unstudied linker region of the extracellular domain of Neurexin3&#945;7. The results illustrate that the A687T mutation enhances the aggregation of cells containing Neurexin3&#945;A687T to cells containing LRRTM2 (Figure 2C). This finding is significant because it was previously shown that LRRTMs only bind to Neurexins via a Neurexin domain called LNS617, and further suggests that sequences upstream of LNS6 can exert an independent effect on the trans interactions between Neurexin3&#945; SS4- and LRRTM27.
The results in Figure 2 exhibit the specificity of this assay as all negative controls (GFP/mCherry; Neurexin3&#945;WT/A687T SS4- &#8212;mCherry/GFP or LRRTM-GFP/mCherry) had no observable aggregation after 60 minutes. A critical control used in this study, Neurexin3&#945;WT/A687T SS4+ &#8212;mCherry/LRRTM-GFP, also exhibited no aggregation after 60 min because LRRTM2 is known to bind exclusively to SS4 lacking (SS4-) isoforms of Neurexin. This control demonstrates that simple overexpression of membrane-bound molecules is insufficient to force aggregation in this system, which further illustrates the specificity of this assay.
The cell adhesion assay described here has been widely used to test the interactions of transsynaptic cell-adhesion molecules8,18,19; however, it may be used to test adhesive cell-to-cell interactions of membrane tethered proteins. This protocol, which has evolved over time, was optimized from the original published protocol and subsequent variations of the protocol by changing three experimental parameters. One, the incubation temperature for the cells was changed. The original protocol calls for the incubation of cells in step 1.9 at 4 &#176;C. This low temperature can act as an environmental stressor and can decrease cell viability leading to cell death and lysis. During cell lysis, the cells secrete genomic DNA and cell debris into media that causes cells to clump in solution leading to false positives during imaging. Two, the number of cells per condition were increased to 200,000 per population and the objective size was changed to a 5x; this allows the researcher to image a greater number of interactions per field of view in order to increase statistical power within each n. Three, the aggregation index was measured differently. Previous aggregation indices were limited by the selection of cluster size by the experimenter leading to the exclusion of &#8220;subthreshold&#8221; clusters. By contrast thresholds are now set for individual cell size at &#8216;time zero&#8217;, and the aggregation is now calculated as the overlapping area divided by the sum of the two channel areas minus the overlap area multiplied by 100 at &#8216;time 60&#8217; which allows for the inclusion of smaller positive clusters making the assay more sensitive to other protein-ligand pairs (Figure 2B,C).
Troubleshooting and optimization may be needed depending on the interacting proteins tested. Although the incubation period until final image acquisition will differ depending on the tested proteins, it is critical that no aggregation is observed at &#8216;time zero&#8217;. If aggregation is seen at time zero, it may imply that the cells were not healthy to begin with. This may be due to several factors including sudden exposure to temperatures below 37 &#176;C or slow experimental procedure. Importantly, the resuspension media for step 1.7 should be at 37 &#176;C, which will allow the cells to gradually reach room temperature without a sudden harsh drop in temperature. One way to have optimal cell health throughout the experiment is to ensure that steps 1.7 through 1.9 are completed within a 25 min timeframe with no breaks in between. It is recommended that the microscope is setup and ready to use before cell harvest cells in step 1.5; this ensures that a true &#8216;time zero&#8217; image can be taken immediately in step 2.2.
If aggregation is not observed after 60 minutes of incubation, several factors may be contributing to this lack of adhesion. First, the proteins in question may not be binding partners or may engage in low affinity interactions not detectable by this assay. In this case, a more sensitive assay may be required.&#160; Second, the protein(s) of interest may not localize to the membrane when expressed alone in HEK cells. In this case, confirm that the protein is membrane localized by using biochemical techniques (surface biotinylation) or directly tag the protein of interest with a fluorescent tag and image HEK293T cells at 40x or higher magnification to assess surface expression. However, after membrane localization is confirmed, we recommend using untagged variants for this HEK cell aggregation assay in order to more accurately assess the binding capacity of the native protein. Third, in this protocol we allowed Neurexin3&#945; to express for 48 h; however, protein expression time may vary depending on the proteins tested. Fourth, it is critical to supplement the media in step 1.7 with MgCl2 and CaCl2 if the proteins in question are dependent on divalent cations as is the case with the example of Neurexins and LRRTM211. If it is unknown whether the interaction partners require divalent cations for adhesion, add EDTA into one condition. The EDTA should chelate remining cations naturally present in DMEM ensuring a calcium and magnesium free solution. If adhesion is observed after EDTA addition, the proteins in question do not require divalent cations for adhesion.
Many methods exist to test protein interactions; however, most are not specific for testing only trans interactions that occur from cell to cell and require tedious protein purification steps. Although the HEK cell aggregation assay is not a direct measure of affinity and should not be used to replace a more quantitative approach to recover dissociation constants, to the best of our knowledge, this assay represents an approach to test true trans interactions in a semi-quantitative and relatively efficient manner. Moreover, due to the relative ease of this assay, the HEK cell aggregation assay can be used in conjunction with these more quantitative approaches to obtain a broader and more complete characterization of the interactions taking place.

Synaptic interactions facilitated by synaptic adhesion molecules are foundational for the development, organization, specification, maintenance and function of synapses and the generation of neural networks. The identification of these transsynaptic cell adhesion molecules is rapidly increasing; thus, it is fundamentally important to identify binding partners and understand how these new adhesion molecules interact with each other. Additionally, genome sequencing has identified mutations in many of these adhesion molecules that are commonly linked to a multitude of neurodevelopmental, neuropsychiatric, and addiction disorders1. Mutations in genes that code for synaptic cell-adhesion molecules may detrimentally alter trans interactions and may contribute to pathophysiological alterations in synapse formation and or maintenance.
Multiple assays exist to quantitatively assess protein-protein interactions such as isothermal calorimetry, circular dichroism, surface plasmon resonance2 and although quantitative in nature, they have several limitations. First, they require recombinant protein, sometimes demanding lengthy and tedious purification steps. Second, they require sophisticated specialized equipment and technical expertise. Third, they can overestimate the extent of binding as they allow for both cis and trans interactions between proteins that are naturally tethered to a membrane in vivo. Here we propose a simple and relatively rapid assay that exclusively tests trans interactions.
To circumvent many of the complications associated with purified protein assays, we have optimized a cell-based protein interaction assay that recapitulates trans interactions in a reduced heterologous cell system. This assay has been previously used in various forms to study transcellular interactions. In this approach, candidate cell adhesion molecules are transfected into HEK293T cells. At physiological conditions, HEK293T cells do not exhibit self-aggregation, making them exemplary models for this assay. However, when individual populations of HEK cells expressing receptor and ligand are combined, the binding of the receptor and the ligand forces aggregation of HEK cells to occur. This aggregation is mediated exclusively by trans interactions and is usually observable in tens of minutes. No protein purification steps are required in this method, and the efficiency of the method relies on the paradigm that populations of HEK cells expressing cognate adhesion molecules are being combined and then imaged only tens of minutes later. Additionally, this method is relatively inexpensive, as neither antibodies nor costly equipment are required. The only equipment required for the acquisition of data is a standard fluorescent microscope. An additional advantage to this cell-based assay is the ability to quickly screen the effect of disease relevant point mutations on trans interactions. This can be performed by transfecting HEK cells with cDNAs of the mutant variants of the protein of interest.
In this protocol, we present an example in which we investigate whether a missense mutation in Neurexin3&#945; (Neurexin3&#945;A687T), identified in a patient diagnosed with profound intellectual disability and epilepsy, alters interactions in trans with leucine-rich repeat transmembrane protein 2 (LRRTM2). Neurexin3&#945; is a member of the evolutionarily conserved family of presynaptic cell-adhesion molecules and while recent work has identified multiple roles at the synapse3,4,5,6,7, our synaptic understanding of this molecule and all members of the neurexin family remains incomplete. LRRTM2 is an excitatory postsynaptic cell adhesion protein that participates in synapse formation and maintenance8,9,10. Importantly, LRRTM2 exclusively interacts with neurexin isoforms that lack the splice site 4 alternative exon (SS4-) but not with neurexin isoforms containing the splice site 4 alternative exon (SS4+). The human missense mutation (A687T) identified in Neurexin3&#945; is located in an unstudied extracellular region that is evolutionarily conserved and is conserved between all alpha neurexins7. As the interaction between these two molecules has been established8,9,11, we posed the question: is the binding capability of Neurexin3&#945; SS4- to LRRTM2 altered by an A687T point mutation? This assay revealed that the A687T point mutation unexpectedly enhanced the aggregation of Neurexin3&#945; to LRRTM2 suggesting that the extracellular region in which the point mutation is located, plays a role in mediating transsynaptic interactions.

<table><tbody><tr><td>1.5 mL disposable microtubes with snap caps</td><td>VWR</td><td>89000-028</td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>1000 mL Rapid&amp;mdash;Flow Filter Unit, 0.2 um aPES membrane</td><td>Thermo Fisher</td><td>567-0020</td><td>Sterilization of HEK media</td></tr><tr><td>15 mL SpectraTube centrifuge tubes</td><td>Ward&amp;rsquo;s Science</td><td>470224-998</td><td>Harvesting HEK cells</td></tr><tr><td>6 well sterile tissue culture plates</td><td>VWR</td><td>100062-892</td><td>culturing HEK cells</td></tr><tr><td>Calcium Chloride</td><td>Sigma</td><td>223506-500G</td><td>Calcium phosphate transfection, HEK cell resuspension</td></tr><tr><td>Centrifuge- Sorvall Legend RT</td><td>Kendro Laboratory Products</td><td>75004377</td><td>Harvesting HEK cells</td></tr><tr><td>CO2 cell incubator</td><td>Thermo Scientific</td><td>HERACELL 150i</td><td>Incubation of HEK cells during growth</td></tr><tr><td>DMEM, 1x (Dulbecco&#039;s Modification of Eagle&#039;s Medium) with 4.5 g/L glucose, L-glutamine &amp;amp; sodium pyruvate</td><td>Corning</td><td>10-013-CV</td><td>HEK cell maintenance</td></tr><tr><td>Dulbecco&amp;rsquo;s Phosphate Buffered Saline PBS (1X)</td><td>Gibco</td><td>14190-144</td><td>Passaging/harvesting HEK cell</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Sigma</td><td>ED-500G</td><td>Harvesting HEK cells</td></tr><tr><td>Falcon Vented culture flasks, 75cm&lt;sup&gt;2&lt;/sup&gt; growth area</td><td>Corning</td><td>9381M26</td><td>Culturing HEK cells</td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma</td><td>17L184</td><td>HEK cell maintenance</td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td></td><td>Model system</td></tr><tr><td>ImageJ</td><td>NIH</td><td>V: 2.0.0-rc-69/1.52p</td><td>Image analysis</td></tr><tr><td>Magnesium Chloride hexahydrate</td><td>Sigma</td><td>M9272-500G</td><td>HEK cell resuspension</td></tr><tr><td>Sodium phosphate dibasic anhydrous</td><td>Fisher BioReagents</td><td>BP332-500</td><td>Calcium phosphate transfection</td></tr><tr><td>Trypsin 0.25% (1X) Solution</td><td>GE Healthcare Life Sciences</td><td>SH30042.01</td><td>Passaging HEK cells</td></tr><tr><td>Tube rotator</td><td></td><td></td><td>Incubation of mixed population of HEK cells</td></tr><tr><td>UltraClear Microscope slides. White Frosted, Positive Charged</td><td>Denville Scientific Inc.</td><td>M1021</td><td>Image acquisition</td></tr><tr><td>Wide-field microscope</td><td>Zeiss</td><td>Axio Vert 200M</td><td>Image acquisition</td></tr></tbody></table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse formation and maintenance. Many of these fundamental interactions occur in trans and are typically induced by heterophilic or homophilic interactions between cells expressing membrane anchored binding pairs. Elucidating how disease relevant mutations disrupt these fundamental protein interactions can provide insight into a myriad of cell biology fields. Many protein-protein interaction assays do not typically disambiguate between cis and trans interactions, which potentially leads to an overestimation of the extent of binding that is occurring in vivo and involve labor intensive purification of protein and/or specialized monitoring equipment. Here, we present an optimized simple protocol that allows for the observation and quantification of only trans interactions without the need for lengthy protein purifications or specialized equipment. The HEK cell aggregation assay involves the mixing of two independent populations of HEK cells, each expressing membrane-bound cognate ligands. After a short incubation period, samples are imaged and the resulting aggregates are quantified.

The A687T mutation increases Neurexin3&#945; SS4- binding to LRRTM27 
To investigate how intercellular interactions of two known synaptic proteins are affected by the introduction of a point mutation found in a patient with intellectual disability and epilepsy, we used the above HEK cell aggregation assay (Figure 1). Cells were transfected according to section 1 and prepared for imaging according to sections 1 and 2 of the protocol. Cells were imaged at baseline where no aggregation was observed as expected (not shown). Images acquired at 60 minutes were analyzed as in section 3 of the protocol. To minimize selection bias, conditions were randomized to blind the experimenter. For similar reasons the whole field of view of every image was selected as an ROI.
Conditions in which cells were not expressing any synaptic ligands (GFP/mCherry) showed minimal aggregation after a 60-minute incubation (Figure 2). Equally, conditions in which only one of the two populations of cells were expressing synaptic ligands (mCherry/LRRTM2-GFP or GFP/Neurexin3&#945;WT/A687T SS4- &#8212;mCherry) exhibited minimal aggregation after a 60 min incubation (Figure 2). As expected, conditions that contained two populations of cells with incompatible adhesions molecules (Neurexin3&#945;WT/A687T SS4+&#8212;mCherry/LRRTM2-GFP) exhibited no aggregation at 60 minutes (Figure 2B). These conditions served as critical negative controls as LRRTM2 is known to bind exclusively to SS4 lacking isoforms (SS4-) of Neurexins and highlights the specificity of this aggregation assay.
Conditions with compatible adhesion molecules8,9,10 (Neurexin3&#945;WT SS4- &#8212;mCherry/LRRTM2-GFP) exhibited significant aggregation after a 60 min incubation (Figure 2C). Aggregation can be visualized as yellow and is present in the overlap between cells (Figure 1 and Figure 2). Surprisingly, the condition where Neurexin3&#945; A687T SS4- was co-incubated with LRRTM2 (Neurexin3&#945;A687T SS4- &#8212;mCherry/LRRTM2-GFP) exhibited significantly more aggregation as compared to its wildtype counterpart (Neurexin3&#945;WT SS4- &#8212;mCherry/LRRTM2-GFP; positive control). This suggests that the A687T point mutation in Neurexin3&#945; enhances the binding capabilities of Neurexin3&#945; SS4- to LRRTM2.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61237/61237fig1.jpg" /> 
Figure 1. Workflow of aggregation assay. (A) HEK293T cells are transfected using a protein-1/mCherry, or a protein-2/GFP. (B) Expression of Neurexin3&#945; takes 48 h. (C) Cells are harvested using 10 mM EDTA and then pelleted (D). (E) Cells are mixed in a 1:1 ratio and resuspended in 500 &#181;L of HEK media containing 10 mM CaCl2 and MgCl2. (F) Cells are incubated at room temperature until aggregation occurs and a final image is acquired at &#8216;time 60&#8217;. Aggregation is visualized as the number of yellow puncta visible in the field of view. No aggregation is observed when cells are not expressing the correct receptor ligand pairs and are thus seen as individual red or green puncta. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61237/61237fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61237/61237fig2.jpg" /> 
Figure 2. Neurexin3&#945;A687T SS4- has enhanced aggregation with excitatory ligand LRRTM2 compared to Neurexin3&#945;WT SS4-. (A) Representative images of negative controls after a 60 min incubation of mCherry with GFP, mCherry with LRRTM2, GFP with Neurexin3&#945;WT SS4+/-, and GFP with Neurexin3&#945;A687T SS4+/-. Aggregation was observed after 60 minutes in both LRRTM2 with Neurexin3&#945;WT SS4-, and LRRTM2 with Neurexin3&#945;A687T SS4-. (B) Quantification of the aggregation index in all SS4+ conditions after 60 minutes. Aggregation index = overlap area/(area of channel 1 + area of channel 2 &#8211; overlap area) x 100. (C) Same as (B) but SS4-. Data shown represent the mean &#177; SEM of the number of experiments (SEM: GFP/mCherry &#177; 0.0245, mCherry/LRRTM2 &#177; 0.02465, GFP/Neurexin3&#945;WT SS4- &#177; 0.02453, GFP/Neurexin3&#945;A687T SS4- &#177; 0.0109, Neurexin3&#945;WT SS4-/LRRTM2 &#177; 0.0538, Neurexin3&#945;A687T SS4-/LRRTM2 &#177; 0.0174; p= 0.0136). Numbers presented in bars represent the number of independent experiments carried out. Dotted lines represent baseline or average minimal aggregation of control conditions. Statistical significance was determined by one-way ANOVA, multiple comparisons; *p&#60;0.05; ****p&#60;0.0001.This figure has been modified from Restrepo et al.7. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61237/61237fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplemental Coding Files. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61237/Supplemental_Coding_Files.zip" target="_blank">Please click here to download these files.</a>

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Here, we present an optimized protocol to rapidly and semiquantitatively measure ligand-receptor interactions in trans in a heterologous cell system using fluorescence microscopy.

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Nanyang Technological University

Research

JoVE Journal

Neuroscience

3.4K Views.  University of Colorado Denver School of Medicine. Here, we present an optimized protocol to rapidly and semiquantitatively measure ligand-receptor interactions in trans in a heterologous cell system using fluorescence microscopy.

Video: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling cascades during homeostasis and disease, and as such represent prime therapeutic targets. Despite their relevance, these interaction networks remain significantly underrepresented in current databases; therefore, most extracellular proteins have no documented binding partner. This discrepancy is primarily due to the challenges associated with the study of the extracellular proteins, including expression of functional proteins, and the weak, low affinity, protein interactions often established between cell surface receptors. The purpose of this method is to describe the printing of a library of extracellular proteins in a microarray format for screening of protein-protein interactions. To enable detection of weak interactions, a method based on multimerization of the query protein under study is described. Coupled to this microbead-based multimerization approach for increased multivalency, the protein microarray allows robust detection of transient protein-protein interactions in high throughput. This method offers a rapid and low sample consuming-approach for identification of new interactions applicable to any extracellular protein. Protein microarray printing and screening protocol are described. This technology will be useful for investigators seeking a robust method for discovery of protein interactions in the extracellular space.

Here, we present a protocol to screen extracellular protein microarrays for identification of novel receptor-ligand interactions in high throughput. We also describe a method to enhance detection of transient protein-protein interactions by using protein-microbead complexes.

Secreted factors, membrane-tethered receptors, and their interacting partners are main regulators of cellular communication and initiation of signaling ...

Biochemistry

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring cells. Of interest, only few assays are capable of specifically probing such interactions directly in living cells. Here, we present an assay to measure the binding of proteins expressed at the surfaces of neighboring cells, at cell-cell contacts. This assay consists of two steps: mixing of cells expressing the proteins of interest fused to different fluorescent proteins, followed by fluorescence fluctuation spectroscopy measurements at cell-cell contacts using a confocal laser scanning microscope. We demonstrate the feasibility of this assay in a biologically relevant context by measuring the interactions of the amyloid precursor-like protein 1 (APLP1) across cell-cell junctions. We provide detailed protocols on the data acquisition using fluorescence-based techniques (scanning fluorescence cross-correlation spectroscopy, cross-correlation number and brightness analysis) and the required instrument calibrations. Further, we discuss critical steps in the data analysis and how to identify and correct external, spurious signal variations, such as those due to photobleaching or cell movement.
In general, the presented assay is applicable to any homo- or heterotypic protein-protein interaction at cell-cell contacts, between cells of the same or different types and can be implemented on a commercial confocal laser scanning microscope. An important requirement is the stability of the system, which needs to be sufficient to probe diffusive dynamics of the proteins of interest over several minutes.

This protocol describes a fluorescence fluctuation spectroscopy-based approach to investigate interactions among proteins mediating cell-cell interactions, i.e. proteins localized in cell junctions, directly in living cells. We provide detailed guidelines on instrument calibration, data acquisition and analysis, including corrections to possible artefact sources.

A variety of biological processes involves cell-cell interactions, typically mediated by proteins that interact at the interface between neighboring ...

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions for many of these proteins are poorly understood. Here we present a simple, rapid method for characterizing the adhesive properties of putative homophilic cell adhesion molecules. Cultured HEK293 cells are transfected with DNA plasmid encoding a secreted, epitope-tagged ectodomain of a cell surface protein. Using functionalized beads specific for the epitope tag, the soluble, secreted fusion protein is captured from the culture medium. The coated beads can then be used directly in bead aggregation assays or in fluorescent bead sorting assays to test for homophilic adhesion. If desired, mutagenesis can then be used to elucidate the specific amino acids or domains required for adhesion. This assay requires only small amounts of expressed protein, does not require the production of stable cell lines, and can be accomplished in 4 days.

Here we present a simple, rapid method for characterizing the intrinsic adhesive properties of putative cell adhesion molecules. The secreted, epitope-tagged ectodomain of a cell adhesion molecule is captured from the culture medium on small, uniform functionalized beads. These beads can then be used immediately in simple bead aggregation assays.

Cell-cell adhesion is fundamental to multicellular life and is mediated by a diverse array of cell surface proteins. However, the adhesive interactions ...

Bioengineering

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis elegans is a well-established model organism that has been widely used in the field to study protein aggregation and toxicity. Its optical transparency enables the direct visualization of protein aggregation by fluorescence microscopy. Moreover, the fast reproductive cycle and short lifespan make the nematode a suitable model to screen for genes and molecules that modulate this process.
However, the quantification of aggregate load in living animals is poorly standardized, typically performed by manual inclusion counting under a fluorescence dissection microscope at a single time point. This approach can result in high variability between observers and limits the understanding of the aggregation process. In contrast, amyloid-like protein aggregation in vitro is routinely monitored by thioflavin T fluorescence in a highly quantitative and time-resolved fashion.
Here, an analogous method is presented for the unbiased analysis of aggregation kinetics in living C. elegans, using a high-throughput confocal microscope combined with custom-made image analysis and data fitting. The applicability of this method is demonstrated by monitoring inclusion formation of a fluorescently labeled polyglutamine (polyQ) protein in the body wall muscle cells. The image analysis workflow allows the determination of the numbers of inclusions at different timepoints, which are fitted to a mathematical model based on independent nucleation events in individual muscle cells. The method described here may prove useful to assess the effects of proteostasis factors and potential therapeutics for protein aggregation diseases in a living animal in a robust and quantitative manner.

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Here, a method is presented for the analysis of protein aggregation kinetics in the nematode Caenorhabditis elegans. Animals from an age-synchronized population are imaged at different time points, followed by semiautomated inclusion counting in CellProfiler and fitting to a mathematical model in AmyloFit.

Protein aggregation into insoluble inclusions is a hallmark of a variety of human diseases, many of which are age-related. The nematode Caenorhabditis ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

4D Imaging of Protein Aggregation in Live Cells

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental conditions and an intracellular environment that is tightly packed, sticky, and hazardous to protein stability1. The ability to dynamically balance protein production, folding and degradation demands highly-specialized quality control machinery, whose absolute necessity is observed best when it malfunctions. Diseases such as ALS, Alzheimer's, Parkinson's, and certain forms of Cystic Fibrosis have a direct link to protein folding quality control components2, and therefore future therapeutic development requires a basic understanding of underlying processes. Our experimental challenge is to understand how cells integrate damage signals and mount responses that are tailored to diverse circumstances.
The primary reason why protein misfolding represents an existential threat to the cell is the propensity of incorrectly folded proteins to aggregate, thus causing a global perturbation of the crowded and delicate intracellular folding environment1. The folding health, or "proteostasis," of the cellular proteome is maintained, even under the duress of aging, stress and oxidative damage, by the coordinated action of different mechanistic units in an elaborate quality control system3,4. A specialized machinery of molecular chaperones can bind non-native polypeptides and promote their folding into the native state1, target them for degradation by the ubiquitin-proteasome system5, or direct them to protective aggregation inclusions6-9.
In eukaryotes, the cytosolic aggregation quality control load is partitioned between two compartments8-10: the juxtanuclear quality control compartment (JUNQ) and the insoluble protein deposit (IPOD) (Figure 1 - model). Proteins that are ubiquitinated by the protein folding quality control machinery are delivered to the JUNQ, where they are processed for degradation by the proteasome. Misfolded proteins that are not ubiquitinated are diverted to the IPOD, where they are actively aggregated in a protective compartment.
Up until this point, the methodological paradigm of live-cell fluorescence microscopy has largely been to label proteins and track their locations in the cell at specific time-points and usually in two dimensions. As new technologies have begun to grant experimenters unprecedented access to the submicron scale in living cells, the dynamic architecture of the cytosol has come into view as a challenging new frontier for experimental characterization. We present a method for rapidly monitoring the 3D spatial distributions of multiple fluorescently labeled proteins in the yeast cytosol over time. 3D timelapse (4D imaging) is not merely a technical challenge; rather, it also facilitates a dramatic shift in the conceptual framework used to analyze cellular structure.
We utilize a cytosolic folding sensor protein in live yeast to visualize distinct fates for misfolded proteins in cellular aggregation quality control, using rapid 4D fluorescent imaging. The temperature sensitive mutant of the Ubc9 protein10-12 (Ubc9ts) is extremely effective both as a sensor of cellular proteostasis, and a physiological model for tracking aggregation quality control. As with most ts proteins, Ubc9ts is fully folded and functional at permissive temperatures due to active cellular chaperones. Above 30 &deg;C, or when the cell faces misfolding stress, Ubc9ts misfolds and follows the fate of a native globular protein that has been misfolded due to mutation, heat denaturation, or oxidative damage. By fusing it to GFP or other fluorophores, it can be tracked in 3D as it forms Stress Foci, or is directed to JUNQ or IPOD.

Cellular viability depends on timely and efficient management of protein misfolding. Here we describe a method for visualizing the different potential fates of a misfolded protein: refolding, degradation, or sequestration in inclusions. We demonstrate the use of a folding sensor, Ubc9ts, for monitoring proteostasis and aggregation quality control in live cells using 4D microscopy.

One of the key tasks of any living cell is maintaining the proper folding of newly synthesized proteins in the face of ever-changing environmental ...

Biology

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ryanodine receptor (RyR) is necessary for the formation of a functional Ca2+ release channel pore. Here, we describe detailed protocols for the assessment of protein self-association, including yeast two-hybrid (Y2H), co-immunoprecipitation (co-IP) and chemical cross-linking assays. In the Y2H system, protein self-interaction is detected by &#946;-galactosidase assay in yeast co-expressing GAL4 bait and target fusions of the test protein. Protein self-interaction is further assessed by co-IP using HA- and cMyc-tagged fusions of the test protein co-expressed in mammalian HEK293 cells. The precise stoichiometry of the protein homo-oligomer is examined by cross-linking and SDS-PAGE analysis following expression in HEK293 cells. Using these different but complementary techniques, we have consistently observed the self-association of the RyR N-terminal domain and demonstrated its intrinsic ability to form tetramers. These methods can be applied to protein-protein interaction and homo-oligomerization studies of other mammalian integral membrane proteins.

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

Oligomerization of the ryanodine receptor, a homo-tetrameric ion channel mediating Ca2+ release from intracellular stores, is critical for skeletal and cardiac muscle contraction. Here, we present complementary in vivo and in vitro methods to detect protein self-association and determine homo-oligomer stoichiometry.

Oligomerization is often a structural requirement for proteins to accomplish their specific cellular function. For instance, tetramerization of the ...

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the JDP family could form transient heterocomplexes in eukaryotes to fine-tune substrate selection for the 70 kDa heat shock protein (Hsp70) chaperone-based protein disaggregases. The JDP complexes target acute/chronic stress induced aggregated proteins and presumably help assemble the disaggregases by recruiting multiple Hsp70s to the surface of protein aggregates. The extent of the protein quality control (PQC) network formed by these physically interacting JDPs remains largely uncharacterized in vivo. Here, we describe a microscopy-based in situ protein interaction assay named the proximity ligation assay (PLA), which is able to robustly capture&#160;these transiently formed chaperone complexes in distinct cellular compartments of eukaryotic cells. Our work expands the employment of PLA from human cells to yeast (Saccharomyces cerevisiae) and bacteria (Escherichia coli), thus rendering an important tool to monitor the dynamics of transiently formed protein assemblies in both prokaryotic and eukaryotic cells.

Cognate J-domain proteins cooperate with the Hsp70 chaperone to assist in a myriad of biological processes ranging from protein folding to degradation. Here, we describe an in situ proximity ligation assay, which allows the monitoring of these transiently formed chaperone machineries in bacterial, yeast and human cells.

J-domain proteins (JDPs) form the largest and the most diverse co-chaperone family in eukaryotic cells. Recent findings show that specific members of the ...

Live Cell Single-Molecule Imaging-Based Quantification of Protein Interactions

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number of cellular functions. Characterizing LLPS in live cells is also important because aberrant condensation has been linked to numerous diseases, including cancers and neurodegenerative disorders. LLPS is often driven by selective, transient, and multivalent interactions between intrinsically disordered proteins. Of great interest are the interaction dynamics of proteins participating in LLPS, which are well-summarized by measurements of their binding residence time (RT), that is, the amount of time they spend bound within condensates. Here, we present a method based on live-cell single-molecule imaging that allows us to measure the mean RT of a specific protein within condensates. We simultaneously visualize individual protein molecules and the condensates with which they associate, use single-particle tracking (SPT) to plot single-molecule trajectories, and then fit the trajectories to a model of protein-droplet binding to extract the mean RT of the protein. Finally, we show representative results where this single-molecule imaging method was applied to compare the mean RTs of a protein at its LLPS condensates when fused and unfused to an oligomerizing domain. This protocol is broadly applicable to measuring the interaction dynamics of any protein that participates in LLPS.

Author Spotlight: Evaluation of Protein-Condensate Dynamics in Live Human Cells

Many intrinsically disordered proteins have been shown to participate in the formation of highly dynamic biomolecular condensates, a behavior important for numerous cellular processes. Here, we present a single-molecule imaging-based method for quantifying the dynamics by which proteins interact with each other in biomolecular condensates in live cells.

Biomolecular condensates formed via liquid-liquid phase separation (LLPS) have been considered critical in cellular organization and an increasing number ...

Cell Aggregation Assay to Detect Trans Interactions between Cell Adhesion Molecules

Source: Restrepo, S., et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/61237">Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System.</a> J. Vis. Exp. (2020)
In this video, we demonstrate the technique to measure transcellular interactions between synaptic cell adhesion molecules through the HEK cell aggregation assay. In this assay, an equal number of HEK cells expressing a desired presynaptic cell adhesion molecule and a fluorescent protein are mixed with HEK cells expressing a post-synaptic cell adhesion molecule and another fluorescent protein. The interaction between the cell adhesion molecules forces the cells to aggregate, which can be measured by fluorescence microscopy.

Source: Restrepo, S., et al., Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System. J. Vis. Exp. (2020)
In this ...

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Summary

Explore More Videos

Chapters in this video

Extracellular Protein Microarray Technology for High Throughput Detection of Low Affinity Receptor-Ligand Interactions

A Fluorescence Fluctuation Spectroscopy Assay of Protein-Protein Interactions at Cell-Cell Contacts

Bead Aggregation Assays for the Characterization of Putative Cell Adhesion Molecules

Monitoring Protein Aggregation Kinetics In Vivo using Automated Inclusion Counting in Caenorhabditis elegans

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

4D Imaging of Protein Aggregation in Live Cells

Genetic and Biochemical Approaches for In Vivo and In Vitro Assessment of Protein Oligomerization: The Ryanodine Receptor Case Study

In Situ Monitoring of Transiently Formed Molecular Chaperone Assemblies in Bacteria, Yeast, and Human Cells

Single-Molecule Measurement of Protein Interaction Dynamics Within Biomolecular Condensates

Cell Aggregation Assay to Detect Trans Interactions between Cell Adhesion Molecules