This work was supported by the National Institutes of Health grants AG040191 and AG054566&#160;to VML. This research was conducted while VML was an AFAR Research Grant recipient from the American Federation for Aging Research.

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Tanenbaum, M. E., Stern-Ginossar, N., Weissman, J. S., Vale, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+mRNA+translation+during+mitosis.">Regulation of mRNA translation during mitosis.</a> Elife. 4, (2015).</li><li>Ingolia, N. T., Ghaemmaghami, S., Newman, J. R., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+in+vivo+of+translation+with+nucleotide+resolution+using+ribosome+profiling.">Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling.</a> Science. 324 (5924), 218-223 (2009).</li><li>Ingolia, N. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+translational+profiling+by+ribosome+footprinting.">Genome-wide translational profiling by ribosome footprinting.</a> Methods Enzymol. 470, 119-142 (2010).</li><li>Brar, G. A., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosome+profiling+reveals+the+what,+when,+where+and+how+of+protein+synthesis.">Ribosome profiling reveals the what, when, where and how of protein synthesis.</a> Nat Rev Mol Cell Biol. 16 (11), 651-664 (2015).</li><li>Wolin, S. L., Walter, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosome+pausing+and+stacking+during+translation+of+a+eukaryotic+mRNA.">Ribosome pausing and stacking during translation of a eukaryotic mRNA.</a> EMBO J. 7 (11), 3559-3569 (1988).</li><li>Guo, H., Ingolia, N. T., Weissman, J. S., Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+microRNAs+predominantly+act+to+decrease+target+mRNA+levels.">Mammalian microRNAs predominantly act to decrease target mRNA levels.</a> Nature. 466 (7308), 835-840 (2010).</li><li>Ingolia, N. T., Brar, G. A., Rouskin, S., McGeachy, A. M., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+ribosome+profiling+strategy+for+monitoring+translation+in+vivo+by+deep+sequencing+of+ribosome-protected+mRNA+fragments.">The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments.</a> Nat Protoc. 7 (8), 1534-1550 (2012).</li><li>Bartholomaus, A., Del Campo, C., Ignatova, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+the+non-standardized+biases+of+ribosome+profiling.">Mapping the non-standardized biases of ribosome profiling.</a> Biol Chem. 397 (1), 23-35 (2016).</li><li>Larsson, O., Sonenberg, N., Nadon, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=anota:+Analysis+of+differential+translation+in+genome-wide+studies.">anota: Analysis of differential translation in genome-wide studies.</a> Bioinformatics. 27 (10), 1440-1441 (2011).</li><li>Zhong, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RiboDiff:+detecting+changes+of+mRNA+translation+efficiency+from+ribosome+footprints.">RiboDiff: detecting changes of mRNA translation efficiency from ribosome footprints.</a> Bioinformatics. 33 (1), 139-141 (2017).</li><li>Xiao, Z., Zou, Q., Liu, Y., Yang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+assessment+of+differential+translations+with+ribosome+profiling+data.">Genome-wide assessment of differential translations with ribosome profiling data.</a> Nat Commun. 7, 11194 (2016).</li><li>Chung, B. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+duplex-specific+nuclease+in+ribosome+profiling+and+a+user-friendly+software+package+for+Ribo-seq+data+analysis.">The use of duplex-specific nuclease in ribosome profiling and a user-friendly software package for Ribo-seq data analysis.</a> RNA. 21 (10), 1731-1745 (2015).</li><li>Popa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RiboProfiling:+a+Bioconductor+package+for+standard+Ribo-seq+pipeline+processing.">RiboProfiling: a Bioconductor package for standard Ribo-seq pipeline processing.</a> F1000Res. 5, 1309 (2016).</li><li>Dunn, J. G., Weissman, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plastid:+nucleotide-resolution+analysis+of+next-generation+sequencing+and+genomics+data.">Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.</a> BMC Genomics. 17 (1), 958 (2016).</li><li>Baranov, P. V., Michel, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+translation+with+ribosome+profiling+spectra.">Illuminating translation with ribosome profiling spectra.</a> Nat Methods. 13 (2), 123-124 (2016).</li><li>Calviello, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+actively+translated+open+reading+frames+in+ribosome+profiling+data.">Detecting actively translated open reading frames in ribosome profiling data.</a> Nat Methods. 13 (2), 165-170 (2016).</li><li>Michel, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RiboGalaxy:+A+browser+based+platform+for+the+alignment,+analysis+and+visualization+of+ribosome+profiling+data.">RiboGalaxy: A browser based platform for the alignment, analysis and visualization of ribosome profiling data.</a> RNA Biol. 13 (3), 316-319 (2016).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet J. 17 (1), 10-12 (2011).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biol. 10 (3), R25 (2009).</li><li>Anders, S., Pyl, P. T., Huber, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HTSeq--a+Python+framework+to+work+with+high-throughput+sequencing+data.">HTSeq--a Python framework to work with high-throughput sequencing data.</a> Bioinformatics. 31 (2), 166-169 (2015).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biol. 15 (12), 550 (2014).</li><li>van den Elzen, A. M., Schuller, A., Green, R., Seraphin, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dom34-Hbs1+mediated+dissociation+of+inactive+80S+ribosomes+promotes+restart+of+translation+after+stress.">Dom34-Hbs1 mediated dissociation of inactive 80S ribosomes promotes restart of translation after stress.</a> EMBO J. 33 (3), 265-276 (2014).</li><li>Guydosh, N. R., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dom34+rescues+ribosomes+in+3'+untranslated+regions.">Dom34 rescues ribosomes in 3' untranslated regions.</a> Cell. 156 (5), 950-962 (2014).</li><li>Ingolia, N. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosome+profiling:+new+views+of+translation,+from+single+codons+to+genome+scale.">Ribosome profiling: new views of translation, from single codons to genome scale.</a> Nat Rev Genet. 15 (3), 205-213 (2014).</li><li>Gerashchenko, M. V., Lobanov, A. V., Gladyshev, V. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+ribosome+profiling+reveals+complex+translational+regulation+in+response+to+oxidative+stress.">Genome-wide ribosome profiling reveals complex translational regulation in response to oxidative stress.</a> Proc Natl Acad Sci U S A. 109 (43), 17394-17399 (2012).</li><li>Weinberg, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+ribosome-footprint+and+mRNA+measurements+provide+insights+into+dynamics+and+regulation+of+yeast+translation.">Improved ribosome-footprint and mRNA measurements provide insights into dynamics and regulation of yeast translation.</a> Cell Rep. 14 (7), 1787-1799 (2016).</li><li>Park, J. E., Yi, H., Kim, Y., Chang, H., Kim, V. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+poly(A)+tail+and+translation+during+the+somatic+cell+cycle.">Regulation of poly(A) tail and translation during the somatic cell cycle.</a> Mol Cell. 62 (3), 462-471 (2016).</li><li>Howard, M. T., Carlson, B. A., Anderson, C. B., Hatfield, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+redefinition+of+UGA+codons+is+regulated+by+selenium+availability.">Translational redefinition of UGA codons is regulated by selenium availability.</a> J Biol Chem. 288 (27), 19401-19413 (2013).</li><li>Gerashchenko, M. V., Gladyshev, V. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribonuclease+selection+for+ribosome+profiling.">Ribonuclease selection for ribosome profiling.</a> Nucleic Acids Res. 45 (2), e6 (2017).</li><li>Gerashchenko, M. V., Gladyshev, V. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+inhibitors+cause+abnormalities+in+ribosome+profiling+experiments.">Translation inhibitors cause abnormalities in ribosome profiling experiments.</a> Nucleic Acids Res. 42 (17), e134 (2014).</li><li>O'Connor, P. B., Andreev, D. E., Baranov, P. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+survey+of+the+relative+impact+of+mRNA+features+on+local+ribosome+profiling+read+density.">Comparative survey of the relative impact of mRNA features on local ribosome profiling read density.</a> Nat Commun. 7, 12915 (2016).</li></ol>

The authors declare that they have no competing financial interests.

The Ribo-Seq approach has emerged as a powerful technology for the analysis of mRNA translation in vivo at the genome-wide level 3. Studies using this approach, which allows monitoring translation with single-codon resolution, has contributed to our understanding of translational regulation. Despite its advantages, Ribo-Seq has several limitations. Ribosomal RNA (rRNA) fragments are always co-purified during isolation of ribosome-protected footprints decreasing the yield of useful sequencing reads that can be obtained in Ribo-Seq experiments 9,25. Our data demonstrate that rRNA contamination can contribute to as many as 40-50% of all reads (Figure 8). One of the ways to overcome this limitation is to increase the sequencing depth. Additional rounds of sequencing should be performed until the required number of sequencing reads is achieved for each of the analyzed samples. Analysis of the sequencing libraries prepared using our protocol shows that more than 5 million footprint reads can be obtained for each footprint library, when 12 samples are multiplexed together in a standard 50-bp single-end run on Illumina HiSeq 2000 platform. However, if significant contamination with rRNA is observed, an optional rRNA removal step can be performed.
One of the strategies to remove rRNA contaminating fragments from footprint libraries is to use subtractive hybridization with the biotinylated oligonucleotides as described previously 8,26,27. Alternatively, rRNA contaminating reads can be removed by using commercially available rRNA depletion kits. For this, researchers can perform rRNA depletion on purified 3&#39;-adapter-ligated footprint fragments from step 5.4. Following rRNA depletion, footprint samples can be precipitated and used directly for reverse transcription (step 6) as described in the protocol.
In addition to purification of monosomes using sucrose gradient fractionation described in our protocol, several methods have been developed that utilize a column-based purification 28 and ultracentrifugation through a sucrose cushion 8,29. While these methods can speed up the process of footprint library preparation and are less technically challenging compared to sucrose gradient fractionation, they do not allow qualitative analysis of the purified monosomes and efficiency of the nuclease digestion step. Recently, the choice of nuclease has been shown to affect the efficiency of purification of ribosome-protected RNA fragments in different species 30. While RNase I has robust activity in yeast cell lysates, its activity has been shown to affect the integrity of ribosomes in mouse tissues as well as in fruit flies. Therefore, the choice and concentration of nuclease should be optimized when adopting this protocol to other species.
Another important consideration is the use of the translation inhibitors. Most protocols for ribosome profiling typically involve treating cells with elongation inhibitors, such as cycloheximide or harringtonine, in order to prevent the run-off of ribosomes during cell&#160;harvesting 3. One of the limitations of the use of translation inhibitors is that the drugs diffuse progressively in the cell, inducing a progressive inhibition of the ribosomes 31. Moreover, the drugs do not inhibit translation initiation or termination. As a consequence, ribosomes disproportionately accumulate at the start codon and are depleted at the stop codon 8,27,31. In order to limit this artifact, we chose to flash freeze the cells in liquid nitrogen and treat with cycloheximide at the time of extraction in lysis buffer only.
Despite a relatively large number of reports that have utilized Ribo-Seq in various species, standardized protocols for performing Ribo-Seq analysis are lacking. As a consequence, Ribo-Seq data generated by different labs cannot be directly compared. For example, comparison of published ribosome profiling datasets revealed significant discrepancies in results among studies 32. This is in part due to continuous improvements that have been made as the protocol evolved over the past several years. In addition, many researchers modified the ribosome profiling protocol to adopt it to the specific needs of their study or model system 9,25. Further standardizing the ribosome profiling protocol as well as data analysis and normalization, would allow preventing some of the experimental biases and ensure accurate and reproducible quantification of in vivo translation.

mRNA translation is one of the fundamental processes in the cell, which plays an important role in the regulation of protein expression. Therefore, mRNA translation is tightly controlled in response to different internal and external physiological stimuli 1,2. However, the mechanisms of translational regulation remain understudied. Here, we describe the protocol for the genome-wide quantification of translation in budding yeast by ribosome profiling. The overall goal of the ribosome profiling technique is to study and quantify the translation of specific mRNAs under different cellular conditions. This technique uses next-generation sequencing to quantitatively analyze ribosome occupancy throughout the genome and allows monitoring the rate of protein synthesis in vivo at the single codon resolution 3,4. Currently, this method provides the most advanced means of measuring the levels of protein translation, and has proven to be a useful discovery tool providing information that cannot be revealed by other currently available techniques, e.g. microarrays or translation state array analysis (TSAA) 5. As ribosome profiling reports on the combined changes in transcript levels and translational output, it also provides much greater sensitivity compared to other methods.
This approach is based on deep sequencing of ribosome-protected mRNA fragments 3. During protein translation, ribosomes protect ~ 28 nt portions of the mRNA (called footprints) 6. By determining the sequence of the ribosome-protected fragments, Ribo-Seq can map the position of ribosomes on the translated mRNA and identify which regions of mRNA are likely to be actively translated into protein 3,7. In addition, we can quantitatively measure the translation of mRNA by counting the number of footprints that align to a given mRNA transcript.
In order to isolate the ribosome-protected fragments, cell lysates are initially treated with a translation inhibitor to stall the ribosomes followed by ribonuclease digestion. Whereas free mRNA and portions of translated mRNAs not protected by ribosomes are degraded by ribonuclease, the ribosome-protected mRNA fragments can be recovered by purifying intact ribosome-footprint complexes. These mRNA footprints are then converted into cDNA library and analyzed by deep sequencing (Figure 1). In parallel to ribosome profiling, intact mRNA is extracted from the same sample and sequenced. By comparing the level of translation identified by Ribo-Seq with mRNA abundance measurements, we can identify genes that are specifically up- or down-regulated at the level of translation and calculate translation efficiency of mRNA at the genome-wide level. While the protocol described in this article is specific for yeast, it should be also useful for&#160;researchers who will try to establish the Ribo-Seq protocol in other systems.

<table>
	<tbody>
		<tr>
			<td>0.45 &#956;M membrane filters</td>
			<td>Millipore</td>
			<td>HVLP04700</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 M EDTA</td>
			<td>Invitrogen</td>
			<td>AM9261</td>
			<td></td>
		</tr>
		<tr>
			<td>0.5 mL centrifugal filters (100 kDa MWCO)</td>
			<td>Millipore</td>
			<td>UFC510024</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M Tris-HCl, pH 7.0</td>
			<td>Invitrogen</td>
			<td>AM9850G</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M Tris-HCl, pH 7.5 (pH 8.0 at 4&#176;C)</td>
			<td>Invitrogen</td>
			<td>15567-027</td>
			<td></td>
		</tr>
		<tr>
			<td>10X TBE buffer</td>
			<td>Invitrogen</td>
			<td>AM9863</td>
			<td></td>
		</tr>
		<tr>
			<td>10% TBE-urea gel</td>
			<td>Invitrogen</td>
			<td>EC6875BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>15% TBE-urea gel</td>
			<td>Invitrogen</td>
			<td>EC6885BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>2 M MgCl2</td>
			<td>RPI</td>
			<td>M24500-10.0</td>
			<td></td>
		</tr>
		<tr>
			<td>2X TBE-urea sample buffer</td>
			<td>Invitrogen</td>
			<td>LC6876</td>
			<td></td>
		</tr>
		<tr>
			<td>3M NaOAc, pH 5.5</td>
			<td>Invitrogen</td>
			<td>AM9740</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#39; Deadenylase (10 U/&#956;L)</td>
			<td>Epicentre</td>
			<td>DA11101K</td>
			<td></td>
		</tr>
		<tr>
			<td>5X Nucleic acid sample loading buffer</td>
			<td>Bio-Rad</td>
			<td>161-0767</td>
			<td></td>
		</tr>
		<tr>
			<td>8% TBE gel</td>
			<td>Invitrogen</td>
			<td>EC6215BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>Acid-Phenol:Chloroform, pH 4.5 (with IAA, 125:24:1)</td>
			<td>Invitrogen</td>
			<td>AM9722</td>
			<td></td>
		</tr>
		<tr>
			<td>Blue light transilluminator</td>
			<td>Clare Chemical Research</td>
			<td>DR-46B</td>
			<td></td>
		</tr>
		<tr>
			<td>Chrome-steel beads, 3.2 mm</td>
			<td>BioSpec Products</td>
			<td>11079132c</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryogrinder</td>
			<td>Biospec product</td>
			<td>3110BX</td>
			<td></td>
		</tr>
		<tr>
			<td>Cycloheximide</td>
			<td>RPI</td>
			<td>C81040-5.0</td>
			<td></td>
		</tr>
		<tr>
			<td>Data Acquisition System</td>
			<td>DATAQ Instruments</td>
			<td>DI-245</td>
			<td></td>
		</tr>
		<tr>
			<td>Deoxynucleotide (dNTP) solution mix (10 mM)</td>
			<td>NEB</td>
			<td>N0447L</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycogen</td>
			<td>Invitrogen</td>
			<td>AM9510</td>
			<td></td>
		</tr>
		<tr>
			<td>Gradient fractionation system</td>
			<td>Brandel</td>
			<td>BR-184X</td>
			<td></td>
		</tr>
		<tr>
			<td>High-fidelity DNA polymerase (2,000 U/mL)</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td>Supplied with 5X Phusion HF Buffer</td>
		</tr>
		<tr>
			<td>Next-generation sequencing library quantification kit</td>
			<td>Kapa Biosystems</td>
			<td>KK4824</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleic acid gel stain</td>
			<td>Invitrogen</td>
			<td>S11494</td>
			<td></td>
		</tr>
		<tr>
			<td>Optima XE-90 ultracentrifuge</td>
			<td>Beckman Coulter</td>
			<td>A94471</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly(A) mRNA isolation kit</td>
			<td>Invitrogen</td>
			<td>61011</td>
			<td></td>
		</tr>
		<tr>
			<td>Rec J exonuclease (10 U/&#956;L)</td>
			<td>Epicentre</td>
			<td>RJ411250</td>
			<td></td>
		</tr>
		<tr>
			<td>Reverse transcriptase (200 U/&#956;L)</td>
			<td>Invitrogen</td>
			<td>18080093</td>
			<td>Supplied with 5X first-strand buffer and 0.1 M DTT</td>
		</tr>
		<tr>
			<td>RNA fragmentation buffer</td>
			<td>NEB</td>
			<td>E6186A</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase I (100 U/&#956;L)</td>
			<td>Invitrogen</td>
			<td>AM2295</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase inhibitor (20 U/&#956;L)</td>
			<td>Invitrogen</td>
			<td>AM2696</td>
			<td></td>
		</tr>
		<tr>
			<td>Silicone rubber caps</td>
			<td>BioSpec Products</td>
			<td>2008</td>
			<td></td>
		</tr>
		<tr>
			<td>ssDNA ligase (100 U/&#956;L)</td>
			<td>Epicentre</td>
			<td>CL9021K</td>
			<td>Supplied with 10X CircLigase II buffer and 50 mM MnCl2</td>
		</tr>
		<tr>
			<td>Stainless steel microvials, 1.8 mL</td>
			<td>BioSpec Products</td>
			<td>2007</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose</td>
			<td>RPI</td>
			<td>S24060-5000.0</td>
			<td></td>
		</tr>
		<tr>
			<td>SW-41 Ti rotor</td>
			<td>Beckman Coulter</td>
			<td>331362</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe pump</td>
			<td>New Era Pump Systems</td>
			<td>NE-300</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 polynucleotide kinase (10,000 U/mL)</td>
			<td>NEB</td>
			<td>M0201S</td>
			<td>Supplied with 10X T4 polynucleotide kinase buffer</td>
		</tr>
		<tr>
			<td>T4 RNA ligase 2 truncated KQ (200,000 U/mL)</td>
			<td>NEB</td>
			<td>M0373S</td>
			<td>Supplied with 10X T4 RNA ligase buffer and 50% PEG8000</td>
		</tr>
		<tr>
			<td>Thermal cycler</td>
			<td>Bio-Rad</td>
			<td>1851148</td>
			<td></td>
		</tr>
		<tr>
			<td>Thinwall polyallomer tubes, 13.2 mL</td>
			<td>Beckman Coulter</td>
			<td>331372</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma Aldrich</td>
			<td>X100-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>UV monitor</td>
			<td>Bio-Rad</td>
			<td>7318160</td>
			<td></td>
		</tr>
		<tr>
			<td>Saccharomyces cerevisiae strain BY4741</td>
			<td>Open Biosystems</td>
			<td>YSC1048</td>
			<td></td>
		</tr>
	</tbody>
</table>

genome-wide quantification of translation in budding yeast by ribosome profiling

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription reflect changes in protein synthesis, but many exceptions have been observed. Recently, a technique called ribosome profiling (or Ribo-Seq) has emerged as a powerful method that allows identification, with high accuracy, which regions of mRNA are translated into proteins and quantification of translation at the genome-wide level. Here, we present a generalized protocol for genome-wide quantification of translation using Ribo-Seq in budding yeast. In addition, combining Ribo-Seq data with mRNA abundance measurements allows us to simultaneously quantify translation efficiency of thousands of mRNA transcripts in the same sample and compare changes in these parameters in response to experimental manipulations or in different physiological states. We describe a detailed protocol for generation of ribosome footprints using nuclease digestion, isolation of intact ribosome-footprint complexes via sucrose gradient fractionation, and preparation of DNA libraries for deep sequencing along with appropriate quality controls necessary to ensure accurate analysis of in vivo translation.

Detailed pipelines for bioinformatic analysis of ribosome profiling data have been described previously 8,9. In addition, several research groups have developed bioinformatics tools for differential gene expression analysis and processing of sequencing data, which are specific for ribosome profiling method 10,11,12,13,14,15,16,17,18. The first step in the analysis of Ribo-Seq data is demultiplexing and trimming the 3&#39; adapter sequence AGATCGGAAGAGCACACGTCT using Cutadapt software 19. Then the sequencing reads are aligned against non-coding RNAs, such as rRNA and tRNA, using Bowtie 20 to remove contaminating sequences, and reads that do not align are then mapped to the yeast genome. Read count per gene can then be assessed by HTseq-count software 21, and differentially expressed genes are identified using DESeq2 22.
Figure 8 shows representative results of quantitative analysis of translation in hbs1&#916; 23,24 yeast deletion mutant that were obtained using our protocol. First, we assessed the number and proportion of reads that correspond to non-coding RNA (e.g. rRNAs) obtained after sequencing footprint and mRNA libraries generated for wild-type cells and the hbs1&#916; mutant. We found that, even without any rRNA depletion steps (discussed below), from 50 to 60% of all sequenced reads in our footprint libraries correspond to ribosome-protected footprint fragments (Figure 8A). In contrast, only 3% of rRNA-derived fragments were observed in mRNA libraries demonstrating that poly(A) mRNA isolation allows effective elimination of rRNA reads. Together, we were able to obtain more than 10 million footprint reads for each of the footprint samples by sequencing 2 replicates. To assess the variability of library generation and reproducibility of the data, we usually analyze at least two independent biological replicates per each experimental condition. Both footprint and mRNA sample libraries show good reproducibility with Pearson correlation coefficient R ~ 0.99 between matched samples (Figure 8B).
In addition to assessing the level of protein translation at the genome-wide level, ribosome profiling allows measuring changes in translation efficiency between experimental conditions 3. For this, an aliquot of the cell lysate (not treated with ribonuclease) is used for poly(A) mRNA isolation and preparation of an RNA-Seq library. Because both footprint library and RNA-Seq library are prepared under the same controlled conditions and can be traced to each individual replicate, Ribo-Seq and RNA-Seq datasets can be directly compared to identify genes that are regulated by the changes in mRNA transcription, translation efficiency, or by a combined effect. To identify genes that are up- or down-regulated specifically at the level of protein translation in the hbs1&#916; mutant, we calculated changes in translation efficiency by dividing footprint rpkm values by mRNA rpkm for each of the genes (Figure 8C).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56820/56820fig1.jpg" /> 
Figure 1: Overview of the Ribo-Seq protocol. The entire protocol can be performed in approximately 11 days. Estimated time for each step is shown. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56820/56820fig2.jpg" /> 
Figure 2: Preparation of sucrose gradients <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56820/56820fig3.jpg" /> 
Figure 3: Representative sucrose gradient profiles. (A) Sucrose gradient profile obtained for control (not treated with RNase I) sample. (B) In order to extract ribosome-protected RNA fragments, cell lysates are treated with RNase I for 1 h at room temperature (RT). Fractions corresponding to the monosomal peak are then collected for footprint extraction. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56820/56820fig4.jpg" /> 
Figure 4: Representative images of the 15% polyacrylamide gels obtained after T4 polynucleotide kinase treatment. (A) The size of the excised gel slice around 28 and 32 nt is shown for footprint samples. (B) Cut the gel slice about 50-70 nt for mRNA samples. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56820/56820fig5.jpg" /> 
Figure 5: Representative images of the 10% polyacrylamide gels obtained after reverse transcription. (A) Cut the upper band ~ 128 nt for footprint samples, corresponding to the product of reverse transcription. (B) Cut the band around 150-170 nt for the mRNA samples (upper band). The lower bands correspond to the RT primer. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56820/56820fig6.jpg" /> 
Figure 6: Polyacrylamide gel purification of PCR-amplified libraries. PCR products obtained after 8, 10, 12, and 14 cycles of library amplification were resolved on a non-denaturing 8% TBE gel. The size of the full-length footprint libraries is ~ 150 bp, whereas the size of mRNA libraries is ~170-190 bp. Avoid the lower band that does not contain insert.
<img alt="Figure 7" class="xfigimg" src="/files/ftp_upload/56820/56820fig7.jpg" /> 
Figure 7: Bioanalyzer analysis. (A) Representative Bioanalyzer profiles of the PCR-amplified footprint library. The average size of the footprint library is expected to be from 148 to 152 nt. (B) Representative Bioanalyzer profiles of the sequencing library obtained for mRNA samples. The expected size of the mRNA library is 170-190 nt. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 8" class="xfigimg" src="/files/ftp_upload/56820/56820fig8.jpg" /> 
Figure 8: Representative results. (A) Number of mRNA, footprint, and rRNA reads obtained for wild-type sample and the hbs1&#916; mutant. Combined number of reads generated by sequencing two biological replicates are shown for wild-type cells and the hbs1&#916; mutant. (B) Reproducibility of footprint and mRNA-abundance measurements between two replicates. Pearson correlation coefficients (R) are indicated. (C) Transcriptional and translational changes in the hbs1&#916; mutant. Significantly up-regulated and down-regulated genes in hbs1&#916; are grouped in accordance to whether they are affected by a change in mRNA transcription, translation efficiency, or by a combined effect. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56820/56820fig8large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers</td>
			<td colspan="5">Sequence</td>
			<td>Index</td>
		</tr>
		<tr>
			<td>3&#39; adapter (100 ng/&#181;L)</td>
			<td colspan="5">/5rApp/AGATCGGAAGAGCACACGTCT/3ddC/</td>
			<td></td>
		</tr>
		<tr>
			<td>RT primer</td>
			<td colspan="5">pGATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT/iSp18/GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td></td>
		</tr>
		<tr>
			<td>Forward PCR primer</td>
			<td colspan="5">AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGACG</td>
			<td></td>
		</tr>
		<tr>
			<td>Index primer 1</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td>ATCACG</td>
		</tr>
		<tr>
			<td>Index primer 2</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td>CGATGT</td>
		</tr>
		<tr>
			<td>Index primer 3</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td>TTAGGC</td>
		</tr>
		<tr>
			<td>Index primer 4</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td>TGACCA</td>
		</tr>
		<tr>
			<td>Index primer 5</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td>ACAGTG</td>
		</tr>
		<tr>
			<td>Index primer 6</td>
			<td colspan="5">CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT</td>
			<td>GCCAAT</td>
		</tr>
	</tbody>
</table>
Table 1: 3&#39; Adapter and primer sequences.

Watch this Scientific Journal Video about Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling at JoVE.com

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

genome-wide-quantification-translation-budding-yeast-ribosome

Nanyang Technological University

Research

JoVE Journal

Biochemistry

11.4K Views.  Boston University School of Medicine. Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Video: Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological processes. Affinity purification coupled to mass spectrometry (AP-MS) has become the method of choice for identifying protein-protein interactions. However, conventional AP-MS studies provide information on protein interactions, but the organizational information is lost. To address this issue, we developed a strategy to unravel the distinct functional assemblies a protein might be involved in, by resolving affinity-purified protein complexes prior to their characterization by mass spectrometry. Protein complexes isolated through affinity purification of a bait protein using an epitope tag and competitive elution are separated through blue native electrophoresis. Comparison of protein migration profiles through correlation profiling using quantitative mass spectrometry allows assignment of interacting proteins to distinct molecular entities. This method is able to resolve protein complexes of close molecular weights that might not be resolved by traditional chromatographic techniques such as gel filtration. With little more work than conventional AP-geLC-MS/MS, we demonstrate this strategy may in many cases be adequate for obtaining protein complex topological information concomitantly to identifying protein interactions.

Here we present protocols for affinity purification of protein complexes and their separation by blue native PAGE, followed by protein correlation profiling using label free quantitative mass spectrometry. This method is useful to resolve interactomes into distinct protein complexes.

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Deep Proteome Profiling by Isobaric Labeling, Extensive Liquid Chromatography, Mass Spectrometry, and Software-assisted Quantification

Many exceptional advances have been made in mass spectrometry (MS)-based proteomics, with particular technical progress in liquid chromatography (LC) coupled to tandem mass spectrometry (LC-MS/MS) and isobaric labeling multiplexing capacity. Here, we introduce a deep-proteomics profiling protocol that combines 10-plex tandem mass tag (TMT) labeling with an extensive LC/LC-MS/MS platform, and post-MS computational interference correction to accurately quantitate whole proteomes. This protocol includes the following main steps: protein extraction and digestion, TMT labeling, 2-dimensional (2D) LC, high-resolution mass spectrometry, and computational data processing. Quality control steps are included for troubleshooting and evaluating experimental variation. More than 10,000 proteins in mammalian samples can be confidently quantitated with this protocol. This protocol can also be applied to the quantitation of post translational modifications with minor changes. This multiplexed, robust method provides a powerful tool for proteomic analysis in a variety of complex samples, including cell culture, animal tissues, and human clinical specimens.

We present a protocol to accurately quantitate proteins with isobaric labelling, extensive fractionation, bioinformatics tools, and quality control steps in combination with liquid chromatography interfaced to a high-resolution mass spectrometer.

Many exceptional advances have been made in mass spectrometry (MS)-based proteomics, with particular technical progress in liquid chromatography (LC) ...

Quantification of Hypopigmentation Activity In Vitro

This study presents laboratory methods for the quantification of hypopigmentation activity in vitro. Melanin, the major pigment in melanocytes, is synthesized in response to multiple cellular and environmental factors. Melanin protects skin cells from ultraviolet damage, but also has biophysical and biochemical functions. Excessive production or accumulation of melanin in melanocytes can cause dermatological problems, such as freckles, dark spots, melasma, and moles. Therefore, the control of melanogenesis with hypopigmentation agents is important in individuals with clinical or cosmetic needs. Melanin is primarily synthesized in the melanosomes of melanocytes in a complex biochemical process called melanogenesis, which is influenced by extrinsic and intrinsic factors, such as hormones, inflammation, age, and ultraviolet light exposure. We describe three methods to determine the hypopigmentation activity of chemicals or natural substances in melanocytes: measurement of the 1) cellular tyrosinase activity and 2) melanin content, and 3) staining and quantifying cellular melanin with image analysis.
In melanogenesis, tyrosinase catalyzes the rate-limiting step that converts L-tyrosine into 3,4-dihydroxyphenylalanine (L-DOPA) and then into dopaquinone. Therefore, the inhibition of tyrosinase is a primary hypopigmentation mechanism. In cultured melanocytes, tyrosinase activity can be quantified by adding L-DOPA as a substrate and measuring dopaquinone production by spectrophotometry. Melanogenesis can also be measured by quantifying the melanin content. The melanin-containing cellular fraction is extracted with NaOH and melanin is quantified spectrophotometrically. Finally, the melanin content can be quantified by image analysis following Fontana-Masson staining of melanin. Although the results of these in vitro assays may not always be reproduced in human skin, these methods are widely used in melanogenesis research, especially as the initial step to identify potential hypopigmentation activity. These methods can also be used to assess melanocyte activity, growth, and differentiation. Consistent results with the three different methods ensure the validity of the effects.

We describe three experimental methods for evaluating the hypopigmentation activity of chemicals in vitro: quantification of 1) cellular tyrosinase activity and 2) melanin content, and 3) measurement of melanin by cellular melanin staining and image analysis.

This study presents laboratory methods for the quantification of hypopigmentation activity in vitro. Melanin, the major pigment in melanocytes, is ...

Nitropeptide Profiling and Identification Illustrated by Angiotensin II

Protein nitration is one of the most important post-translational modifications (PTM) on tyrosine residues and it can be induced by chemical actions of reactive oxygen species (ROS) and reactive nitrogen species (RNS) in eukaryotic cells. Precise identification of nitration sites on proteins is crucial for understanding the physiological and pathological processes related to protein nitration, such as inflammation, aging, and cancer. Since the nitrated proteins are of low abundance in cells even under induced conditions, no universal and efficient methods have been developed for the profiling and identification of protein nitration sites. Here we describe a protocol for nitropeptide enrichment by using a chemical reduction reaction and biotin labeling, followed by high resolution mass spectrometry. In our method, nitropeptide derivatives can be identified with high accuracy. Our method exhibits two advantages compared to the previously reported methods. First, dimethyl labeling is used to block the primary amine on nitropeptides, which can be used to generate quantitative results. Second, a disulfide bond containing NHS-biotin reagent is used for the enrichment, which can be further reduced and alkylated to enhance the detection signal on a mass spectrometer. This protocol has been successfully applied to the model peptide Angiotensin II in the current paper.

Proteomic profiling of tyrosine-nitrated proteins has been a challenging technique due to the low abundance of the 3-nitrotyrosine modification. Here we describe a novel approach for nitropeptide enrichment and profiling by using Angiotensin II as the model. This method can be extended for other in vitro or in vivo systems.

Protein nitration is one of the most important post-translational modifications (PTM) on tyrosine residues and it can be induced by chemical actions of ...

DNA Sequence Recognition by DNA Primase Using High-Throughput Primase Profiling

DNA primase synthesizes short RNA primers that initiate DNA synthesis of Okazaki fragments on the lagging strand by DNA polymerase during DNA replication. The binding of prokaryotic DnaG-like primases to DNA occurs at a specific trinucleotide recognition sequence. It is a pivotal step in the formation of Okazaki fragments. Conventional biochemical tools that are used to determine the DNA recognition sequence of DNA primase provide only limited information. Using a high-throughput microarray-based binding assay and consecutive biochemical analyses, it has been shown that 1) the specific binding context (flanking sequences of the recognition site) influences the binding strength of the DNA primase to its template DNA, and 2) stronger binding of primase to the DNA yields longer RNA primers, indicating higher processivity of the enzyme. This method combines PBM and primase activity assay and is designated as high-throughput primase profiling (HTPP), and it allows characterization of specific sequence recognition by DNA primase in unprecedented time and scalability.&#160;

Protein binding microarray (PBM) experiments combined with biochemical assays link the binding and catalytic properties of DNA primase, an enzyme that synthesizes RNA primers on template DNA. This method, designated as high-throughput primase profiling (HTPP), can be used to reveal DNA-binding patterns of a variety of enzymes.

DNA primase synthesizes short RNA primers that initiate DNA synthesis of Okazaki fragments on the lagging strand by DNA polymerase during DNA replication. ...

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. To investigate its mechanism, there are two essential technical requirements. First is single-nt resolution that can resolve normal translocation from frameshifting, during which the ribosome moves by other than 3 nt. The second is the capability to probe both the entrance and exit sides of mRNA in order to elucidate the whole picture of translocation. We report the dual DNA ruler assay that is based on the critical dissociation forces of DNA-mRNA duplexes, obtained by force-induced remnant magnetization spectroscopy (FIRMS).&#160; With 2-4 pN force resolution, the dual ruler assay is sufficient to distinguish different translocation steps. By implementing a long linker on the probing DNAs, they can reach the mRNA on the opposite side of the ribosome, so that the mRNA position can be determined for both sides. Therefore, the dual ruler assay is uniquely suited to investigate the ribosome translocation, and nucleic acid motion in general. We show representative results which indicated a looped mRNA conformation and resolved normal translocation from frameshifting.

Dual DNA ruler assay is developed to determine the mRNA position during ribosome translocation, which relies on the dissociation forces of the formed DNA-mRNA duplexes. With single-nucleotide resolution and capability of reaching both ends of mRNA, it can provide mechanistic insights for ribosome translocation and probe other nucleic acid displacements.

The ribosome translocation refers to the ribosomal movement on the mRNA by exactly three nucleotides (nt), which is the central step in protein synthesis. ...

High-Resolution Complexome Profiling by Cryoslicing BN-MS Analysis

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed complexes. The latter can be elegantly resolved according to molecular size using native polyacrylamide gel electrophoresis (BN-PAGE). Coupling of such separations to sensitive mass spectrometry (BN-MS) has been well-established and theoretically allows for exhaustive assessment of the extractable complexome in biological samples. However, this approach is rather laborious and provides limited complex size resolution and sensitivity. Also, its application has remained restricted to abundant mitochondrial and plastid proteins. Thus, for a majority of proteins, information regarding integration into stable protein complexes is still lacking. Presented here is an optimized approach for complexome profiling comprising preparative-scale BN-PAGE separation, sub-millimeter sampling of broad gel lanes by cryomicrotome slicing, and mass spectrometric analysis with label-free protein quantification. The procedures and tools for critical steps are described in detail. As an application, the report describes complexome analysis of a solubilized endosome-enriched membrane fraction from mouse kidneys, with 2,545 proteins profiled in total. The results demonstrate identification of uniform, low-abundance membrane proteins such as intracellular ion channels as well as high resolution, complex protein assembly patterns, including glycosylation isoforms. The results are in agreement with independent biochemical analyses. In summary, this methodology allows for comprehensive and unbiased identification of protein (super)complexes and their subunit composition, providing a basis for investigating stoichiometry, assembly, and interaction dynamics of protein complexes in any biological system.

A versatile cryoslicing BN-MS protocol using a microtome is presented for high-resolution complexome profiling.

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed ...

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based phosphoproteomics has transformed the way of studying plant signal transduction. However, requirement of lots of starting materials and prolonged MS measurement time to achieve the depth of coverage has been the limiting factor for the high throughput study of global phosphoproteomic changes in plants. To improve the sensitivity and throughput of plant phosphoproteomics, we have developed a stop and go extraction (stage) tip based phosphoproteomics approach coupled with Tandem Mass Tag (TMT) labeling for the rapid and comprehensive analysis of plant phosphorylation perturbation in response to osmotic stress. Leveraging the simplicity and high throughput of stage tip technique, the whole procedure takes approximately one hour using two tips to finish phosphopeptide enrichment, fractionation, and sample cleaning steps, suggesting an easy-to-use and high efficiency of the approach. This approach not only provides an in-depth plant phosphoproteomics analysis (&#62; 11,000 phosphopeptide identification) but also demonstrates the superior separation efficiency (&#60; 5% overlap) between adjacent fractions. Further, multiplexing has been achieved using TMT labeling to quantify the phosphoproteomic changes of wild-type and snrk2 decuple mutant plants. This approach has successfully been used to reveal the phosphorylation events of Raf-like kinases in response to osmotic stress, which sheds light on the understanding of early osmotic signaling in land plants.

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Presented here is a phosphoproteomic approach, namely stop and go extraction tip based phosphoproteomic, which provides high-throughput and deep coverage of Arabidopsis phosphoproteome. This approach delineates the overview of osmotic stress signaling in Arabidopsis.

Protein phosphorylation is crucial for the regulation of enzyme activity and gene expression under osmotic condition. Mass spectrometry (MS)-based ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Summary

Explore More Videos

Chapters in this video

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Quantitative Immunofluorescence to Measure Global Localized Translation

Deep Proteome Profiling by Isobaric Labeling, Extensive Liquid Chromatography, Mass Spectrometry, and Software-assisted Quantification

Quantification of Hypopigmentation Activity In Vitro

Nitropeptide Profiling and Identification Illustrated by Angiotensin II

DNA Sequence Recognition by DNA Primase Using High-Throughput Primase Profiling

Dual DNA Rulers to Study the Mechanism of Ribosome Translocation with Single-Nucleotide Resolution

High-Resolution Complexome Profiling by Cryoslicing BN-MS Analysis

Phosphoproteomic Strategy for Profiling Osmotic Stress Signaling in Arabidopsis

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation